Download Molecular identification of 26 syntaxin genes and

First publ. in: Traffic 8 (2007), pp. 523-542
Molecular Identification of 26 Syntaxin Genes and
their Assignment to the Different Trafficking
Pathways in Paramecium
Roland Kissmehl*,†, Christina Schilde†, Thomas
Wassmer†, Carsten Danzer, Kathrin Nuehse,
Kaya Lutter and Helmut Plattner
Department of Biology, University of Konstanz,
PO Box 5560, 78457 Konstanz, Germany
*Corresponding author: Roland Kissmehl,
[email protected]
†
These authors contributed equally to this work
SNARE proteins have been classified as vesicular (v)- and
target (t)-SNAREs and play a central role in the various
membrane interactions in eukaryotic cells. Based on the
Paramecium genome project, we have identified a multigene family of at least 26 members encoding the t-SNARE
syntaxin (PtSyx) that can be grouped into 15 subfamilies.
Paramecium syntaxins match the classical build-up of
syntaxins, being ‘tail-anchored’ membrane proteins with
an N-terminal cytoplasmic domain and a membranebound single C-terminal hydrophobic domain. The membrane anchor is preceded by a conserved SNARE domain
of 60 amino acids that is supposed to participate in
SNARE complex assembly. In a phylogenetic analysis,
most of the Paramecium syntaxin genes were found to
cluster in groups together with those from other organisms in a pathway-specific manner, allowing an assignment to different compartments in a homology-dependent
way. However, some of them seem to have no counterparts in metazoans. In another approach, we fused one
representative member of each of the syntaxin isoforms to
green fluorescent protein and assessed the in vivo localization, which was further supported by immunolocalization of some syntaxins. This allowed us to assign syntaxins
to all important trafficking pathways in Paramecium.
Key words: exocytosis, Golgi, Paramecium, SNAREs,
syntaxin
Received 27 November 2005, revised and accepted for
publication 23 January 2007, published online 26 March
2007
Trafficking between intracellular membrane compartments is largely mediated by vesicular transport. A high
degree of specificity and complexity occurs in the regulation of vesicle budding, docking and fusion. Central to the
docking and fusion process are numerous SNARE proteins, which are localized in various intracellular organelle
membranes, thereby maintaining integrity and identity of
a given intracellular compartment (1–3). SNAREs vary
widely in size and structure and share only one homolo-
gous sequence, the SNARE motif, that serves as their
defining feature. Specific SNAREs present on two opposing membranes interact to form a highly stable ‘trans
SNARE complex’ whose formation is tightly coupled to
membrane fusion (4,5). SNARE complex assembly involves the interaction of coiled-coil domains present in
the individual SNARE proteins to form a parallel, twisted
four-helix bundle (6–8). Three of the helices are contributed
by Q-SNAREs, while the other helix is provided by an RSNARE (7,9). The structural classification of SNAREs as
either ‘Q’ or ‘R’ derives from the presence of a highly
conserved glutamine or arginine residue in the core of the
helical bundle (10), with the Q-SNAREs further subdivided
into Qa-, Qb- and Qc-SNAREs (2,3,11). In the majority of
intracellular membrane fusion pathways, the three helical
domains contributed by Q-SNAREs are present in three
distinct proteins (12), one of which, Qa, is provided by
syntaxin (10,11). However, in exocytotic membrane
fusion, the two other helices (Qb and Qc) are present in
a single SNARE protein, SNAP-23/25 (7).
Large efforts have been undertaken to assign SNARE
proteins to different trafficking pathways and defined
steps of specific pathways in yeast and mammals
(1,3,13). In the ciliate Paramecium, no syntaxins have been
identified so far. The identification of molecules involved in
the specificity of membrane interactions in ciliates is
interesting because these cells have very complex and
well-established trafficking pathways (14,15). The plasma
membrane of ciliates possesses several specialized, regularly arranged sites for endocytosis (16,17). Constitutive
endo- and exocytosis (18) occurs at coated pits (parasomal
sacs), while exocytosis of dense core secretory vesicles
(trichocysts) takes place at alternating preformed sites
(15,19,20). Phagocytosis of food particles takes place at
the cytopharynx and in different stages; phagosomes (food
vacuoles) undergo acidification and neutralization, fusion
with lysosomes and retrieval of membranes (14,21).
Finally, food vacuoles expel indigestible waste materials
by exocytosis at the cytoproct (14). There are two additional sites at the dorsal surface of a Paramecium cell,
through which the paired contractile vacuole system
expels excess water from the cytosol (22). Each of these
complexes is composed of a central vacuole surrounded
by a periodically fusing membrane system of ampullae and
collecting radial arms. The latter are connected to the
‘spongiome,’ a three-dimensional system of tubules with
smooth surface or surface decorations that assists
sequestering fluid (23).
523
Konstanzer Online-Publikations-System (KOPS)
URL: http://www.ub.uni-konstanz.de/kops/volltexte/2008/4341/
URN: http://nbn-resolving.de/urn:nbn:de:bsz:352-opus-43412
Studying proteins involved in membrane interactions in
a cell with so many different pathways may help to
understand the mechanisms underlying membrane recognition, a process that is not yet well understood. Recently,
we identified and characterized the SNARE-specific chaperone N-ethylmaleimide-sensitive factor (NSF) (24,25) and
a multigene family of R-SNAREs (26) in Paramecium
tetraurelia and we now provide evidence of the existence
of a putative interaction partner, the Q-SNARE syntaxin.
The identification and characterization of a syntaxin multigene family with at least 26 members and their localization
using either green fluorescent protein (GFP) fusion genes
or isoform-specific antibodies yielded interesting insights
into the complex trafficking pathways of the Paramecium
cell and allowed us to identify candidates of the secretory
pathway including those for the Golgi apparatus and the
plasma membrane.
Results
Characteristics of Paramecium syntaxins
On the basis of the Paramecium sequencing project of the
macronucleus (27), we were able to identify and annotate 26
syntaxin coding sequences by manual assembly of single
reads during the early steps of the genome project, which
were deposited at European Molecular Biology Laboratory
Bank under the accession numbers shown in Table 1.
Although, except for two, they all lie on different scaffolds
in the assembled whole macronuclear genome, most of
them cluster in pairs that allow grouping them into 15
subfamilies (Table 1). Within a subfamily, corresponding
paralogues contain the same number of introns located at
corresponding positions (except intron 3 in Ptsyx1-1 and
intron 2 in Ptsyx8-2). The isoforms also reveal a close
relationship to each other, with identities of up to 93% on
the nucleotide level and even slightly more on the level of
amino acid sequence (Table 1). However, between subfamilies the deduced syntaxin proteins differ remarkably, with
identities of 20%, except for the members of the first three
subfamilies (Table 1), which were analysed in more detail.
Because cDNA sequences could be obtained for most of
the 26 syntaxin genes, we conclude that most of them are
expressed (Table 1). The genes encode proteins of 226–
315 amino acids with calculated molecular masses ranging
between 26.2 and 36.3 kDa (Table 1). Their open reading
frames are interrupted by one to seven short introns,
which all display the characteristics of Paramecium introns, i.e. bordering by 50 -GT and AG-30 and a size of 20–31
nucleotides (28,29). However, two genes, Ptsyx6-2 and
Ptsyx13-1, appear to be pseudogenes because, if translated, both would produce truncated gene products
because of the presence of interrupting TGA stop codons
in their open reading frames. Although the genes may be
transcribed, which at least is true for Ptsyx13-1 according
to presence of the corresponding cDNA (Table 1), their
function still remains to be elucidated.
524
The domain structure of most of the gene products largely
resembles that of syntaxins known from other species
(30). Most of them are composed of three putative
functional domains, a carboxy-terminal transmembrane
region of 16–20 hydrophobic amino acids, which is supposed to anchor the proteins into the target membranes
(31), preceded by a characteristic 60-residue long membrane-proximal region with the propensity to form coiledcoil a-helical structures and, in some cases, an additional
a-helical enriched region of 90–100 residues in the
N-terminus (Figure 1). While the coiled-coil domain is
present in each of the Paramecium syntaxins and contains
the typical features of Q-SNAREs, such as a conserved
glutamine at the zero layer and heptad repeats of hydrophobic residues (Figure 2), the N-terminal syntaxin domain
are conserved only in a subset of Paramecium Q-SNAREs
(Figure 1).
To make a prediction about the possible function of the
different syntaxin genes, we performed a phylogenetic
analysis (Figure 3), taking advantage of the fact that
functional conservation should be reflected by sequence
conservation. The analysis of the evolutionary relationships
reveals that many of the PtSyx proteins are clustering
together with syntaxin families of well-known intracellular
locations and pathways. For example, PtSyx1–3 can be
assigned to syntaxins associated with the plasma membrane (Figure 3). Other syntaxin paralogues were predicted to be associated with the endoplasmic reticulum
(ER) (PtSyx8) and the Golgi apparatus (PtSyx5). However,
no homologues were found for endosomal syntaxins
(including early endosome) neither in the genome of
Paramecium nor in that of its close relative Tetrahymena
thermophila. Moreover, a large group of Paramecium
syntaxins (PtSyx7, PtSyx9, PtSyx10, PtSyx11 and
PtSyx12) exists, which seems to have no direct counterpart in metazoan cells (Figure 3). Because close orthologues of this group also exist in the Tetrahymena
genome, the syntaxins of this clade might be involved in
more protozoan-typical pathways, such as the complex
phagosomal system (14). Another group of ciliate specific
syntaxins, PtSyx4-1, PtSyx4-2 and PtSyx6-1, has members
in Paramecium as well as in Tetrahymena and may be
involved in another recycling pathway resembling transcytosis (see below).
PtSyx14-1, PtSyx14-2 and PtSyx15-1 in P. tetraurelia and
Tt28413 in T. thermophila all cluster with the Qc-SNAREs
that are functionally related to the C-terminus of SNAP-25
(32,33). Members of this clade are known to be involved in
multiple membrane trafficking events between early and
late endosome, trans Golgi network (TGN) and the yeast
vacuole (13,34,35).
As we are especially interested in SNAREs acting in
stimulated exocytosis, the group of Paramecium syntaxins
clustering with plasma membrane-associated syntaxins
was analysed in more detail. The members of the three
Table 1: Molecular characteristics of the syntaxins in Paramecium tetraurelia
Gene
Ptsyx1 1c
Ptsyx1 2c
Ptsyx2 1c
Ptsyx2 2
Ptsyx3 1c
Ptsyx3 2c
Ptsyx4 1c
Ptsyx4 2c
Ptsyx5 1c
Ptsyx5 2
Ptsyx6 1c
Ptsyx6 2d
Ptsyx7 1c
Ptsyx7 2
Ptsyx8 1c
Ptsyx8 2c
Ptsyx9 1c
Ptsyx9 2
Ptsyx10 1
Ptsyx10 2
Ptsyx11 1c
Ptsyx12 1c
Ptsyx13 1c,d
Ptsyx14 1c
Ptsyx14 2c
Ptsyx15 1c
Accession number
CR855934
CR855933
CR855927
CR855926
CR855925
CR855924
CR855923
CR855922
CR855921
CR855920
CR855914
CR855980
CR855913
CR855919
CR855918
CR855917
CR855916
CR855915
CR855932
CR855931
CR855930
CR855929
CR855928
gi124392812
gi124423260
gi124414298
Scaffold number
2
22
102
40
94
81
127
103
124
88
3
6
20
13
117
9
76
64
58
56
38
13
50
11
7
41
DNA
Protein
Length
(bp)
ORF
(bp)
Introns
(number)
Identitya
(%)
Length
(aa)
Size
(kDa)
Identitya
(%)
Identitya,b
(%)
1037
1018
1044
1038
1040
1044
1125
1127
892
891
807
806
914
921
837
872
863
851
891
891
787
915
883
709
709
823
888
894
894
894
915
915
942
948
813
813
786
120
867
870
813
825
816
804
741
741
717
867
363
681
681
798
6
5
6
6
5
5
7
7
3
3
1
100
76.9
100
90.4
100
79.6
100
62.4
100
86.0
100
2
2
1
2
2
2
6
6
3
2
3
1
1
1
100
61.4
100
39.9
100
68.1
100
86.4
100
100
295
297
297
297
304
304
313
315
270
270
261
39
288
289
270
274
271
267
246
246
238
288
120
226
226
265
33.8
33.6
34.4
34.4
35.0
34.7
36.2
36.3
31.8
31.7
30.8
4.8
33.4
33.8
31.6
32.2
31.6
31.5
28.3
28.2
27.7
33.6
14.4
26.4
26.2
30.3
100
67.9
100
95.0
100
77.0
100
53.5
100
94.8
100
97.5
100
48.1
100
40.2
100
67.9
100
89.9
100
100
100
67.9
31.1
31.4
41.9
45.6
14.5
12.2
13.9
13.2
12.8
1.0
14.9
13.9
10.1
8.1
16.9
16.6
13.5
13.2
11.5
15.5
2.0
6.8
7.1
10.5
100
93.1
100
100
91.2
100
ORF, open reading frame; aa, amino acid.
a
Sequences were aligned by the CLUSTALW method.
b
Numbers refer to the amino acid sequence of PtSyx1 1.
c
Genes were analysed also on the cDNA level.
d
Putative pseudogene.
Paramecium subfamilies PtSyx1, PtSyx2 and PtSyx3 show
a higher similarity to each other than to syntaxins from
other subfamilies, exhibiting sequence identities of more
than 30% on the amino acid level (Table 1). Consequently,
secondary structure predictions confirm such a close
relationship between the members of these subfamilies,
and corroborate their affiliation to the group of plasma
membrane-associated syntaxins (Figure 4A). They contain
a bundle of three a-helices at the amino-terminal half
domain (Habc domain), interspaced with linker regions of
variable sizes (Figure 4A). Molecular modelling data (Figure 4B) support the hypothesis that such a conserved
autonomously folding structure in the amino-terminal half
of the molecule may act as an autoinhibitory regulatory
domain, as it is known from the exocytosis-relevant
syntaxin 1A (36,37). By folding back onto the membraneproximal SNARE domain (H3 domain) with the conserved
glutamine at the center, the molecule may adopt a ‘closed’
configuration that would prevent the formation of a core
fusion complex with SNARE domains from other SNAREs
(Figure 4B). Structural modelling also revealed the coiledcoil conformation typical of a syntaxin SNARE domain
(Figure 4C). Attempts of molecular modelling with other
members of the Paramecium syntaxin subfamilies did not
yield any defined structures.
Localization of Paramecium syntaxins
To test whether the bioinformatical data correctly predict
the compartment or pathway of a given syntaxin, we fused
at least one isoform of each subfamily to the gfp gene (38)
and transformed the macronucleus of Paramecium cells.
The following results are based on the assumption that the
GFP fusion proteins reflect the correct localization of the
endogenous proteins. In two cases, for PtSyx1 and
PtSyx2, we also used antibodies to confirm the localization
of the endogenous protein. Most syntaxins were C-terminally fused to GFP. However, in case of ER retention an
additional fusion protein was constructed with the GFP
gene fused to the 50 -end of the syntaxin gene (see
‘Materials and Methods’ section).
GFP-PtSyx1-1 was localized predominantly in the cell
cortex, particularly in the plasma membrane, including
the numerous sites for constitutive and stimulated
525
Figure 1: Domain structure of
individual members of the Paramecium syntaxin superfamily.
Results from conserved motif
searching are shown for individual
members of each of the subfamilies.
Characteristic features are the syn
taxin domain (green), the SNARE
domain (pink) and the transmem
brane region (blue/black). Note, the
N terminal syntaxin domain is not
well conserved within the Parame
cium syntaxins.
exocytosis. This is visible in median sections through a cell
(Figure 5A), where fluorescence is concentrated in small
spots that are highly regularly arranged over the cell
surface (Figure 5A, inset, C, enlargement in D). In dividing
cells (Figure 5C), the GFP signal seems to be enriched
especially in regions of extensive vesicle traffic underlying
the plasma membrane (Figure 5A, inset), including early
endosomes (terminal cisternae) near the developing
Figure 2: Sequence alignment of
the SNARE domain. The sequence
analysis was adapted to the 16 layers
(yellow) of the four helix bundle in the
synaptic fusion complex (10), includ
ing seven layers up stream and eight
layers down stream of the ionic layer
(layer 0). The conserved glutamine
residue forming the ionic 0 layer is
indicated in blue. Deviations are
shown either in red (layer 0) or in
green (other layers).
5
Traffic 2007; 8: 523–542
Figure 3: Evolutionary relationships of the Paramecium syntaxins with other syntaxins. Predictions from multiple sequence
alignments are shown in a neighbour joining tree (with 1000 bootstrap replicates) for an analysis generated with the MEGA version 3.0
program. Besides the Paramecium specific SNARE domain coding sequences of syntaxins (PtSyx1 1, PtSyx1 2, PtSyx2 1, PtSyx2 2,
PtSyx3 1, PtSyx3 2, PtSyx4 1, PtSyx4 2, PtSyx5 1, PtSyx5 2, PtSyx6 1, PtSyx7 1, PtSyx7 2, PtSyx8 1, PtSyx8 2, PtSyx9 1, PtSyx9 2,
PtSyx10 1, PtSyx10 2, PtSyx11 1, PtSyx12 1, PtSyx14 1, PtSyx14 2 and PtSyx15 1) labelled with a filled circle, other syntaxin SNARE
domain coding sequences were from Entamoeba histolytica (EhSyx5, AAR06581), Mus musculus (MmSyx1A, NP 058081; MmSyx5,
NP 062803; MmSyx8, NP 061238; MmSyx12, NP 598648; MmSyx16, NP 766263 and MmSyx18, AAH21362), Plasmodium falciparum
(PfSyx5, CAD52459), Saccharomyces cerevisiae (ScBet1p, P22804; ScBos1p, AAB67582; ScGos1p, NP 011832; ScPep12p, AAB38370;
ScSed5p, NP 013126; ScSec9p, NP 011523; ScSec20p, NP 010786; ScSft1p, NP 012919; ScSpo20p, NP 013730; ScSso1p,
CAA47959; ScSyn8p, NP 009388; ScTlg2p, NP 014624; ScUfe1p, AAB50196; ScUse1p, NP 011417; ScVam3p, AAC49737; ScVam7p,
NP 011303 and ScVti1p, AAC49745) and Tetrahymena thermophila (Tt2546, Tt3126, Tt19785, Tt28413). Syntaxin orthologues with
characteristic localizations are boxed in red (mouse) or green (yeast). Note that within the Qa SNAREs, there are two clades of protozoan
specific syntaxins which seem to have no counterparts in mammalian or other metazoan cells and which may be relevant for phagocytosis
and transcytosis, respectively. In contrast, Paramecium seems to have neither orthologues assignable to the clades of endosome/Golgi nor
any clear Qb syntaxin homologues. Bootstrap support values for the nodes are shown and evolutionary distances are indicated by the scale
bar below.
527
Figure 4: Structure
analysis
of
‘plasma membrane-associated’ type
of PtSyx protein subfamilies. A) Pre
dicted secondary structure of PtSyx
proteins; colored bars represent PtSyx
sequences. Red and orange represent
regions predicted to form a helical
structures with higher (>5) and lower
confidence (<5), respectively. Blue,
predicted beta strands; black, pre
dicted loops. Secondary structure pre
diction and confidence levels were
assigned by PSIPRED. B) Ribbon repre
sentation of PtSyx3 2 modelled via
SWISS MODEL 3 5 in ‘first approach align
ment’ mode. The supposed Habc
domain is shown in yellow, the Habc/
H3 linker in green and the H3 region in
red. (C). Electrostatic potentials of
PtSyx3 2 SNARE domain region mod
elled via SWISS MODEL 3 5 in ‘first
approach alignment’ mode. Red, neg
ative potential; grey or white, neutral;
blue, positive potential. Q242 (yellow)
represents the glutamine of the so
called ‘zero layer.’
cleavage furrow (between arrowheads). There are also
some other specialized regions, such as the most internal
part of the cytostome (Figure 5A, enlargement in B) that
are brightly stained and from which labelled strings emanate into the cytoplasm, which are quite mobile in living
cells. We observed no effect on cell morphology or other
physiological aspects by overexpression of GFP-PtSyx1-1.
To support the data from the in vivo localization experiments with GFP, we raised a polyclonal antibody against
a heterologously expressed PtSyx1-1 peptide and used it in
affinity-purified form for several immunoapplications. In
Western blots of subcellular fractions from Paramecium
cells, PtSyx1 can be detected in the 100 000 g pellet and
in isolated cortex fractions (Figure 6A). Similarly, a strong
immunofluorescence signal occurs in the membranes of
isolated cortex fractions (Figure 6B,C). It is especially
enriched in the membranes along the outlines of surface
fields (kinetids), especially near the intersections of longitudinal and transverse ridges (Figure 6B), however, absent
from underlying compartments like alveolar sacs (Figure 6
C). This is further corroborated by immunoelectron microscopic (EM) analysis (Figure 7A–C). Label occurs not only
along the cell membrane and on vesicles associated with
terminal cisternae (Figure 7A,B) but also on the membranes of discoidal vesicles (Figure 7C), thus being com528
patible with the in vivo localization data obtained with GFP
(Figure 5A–D).
PtSyx2-1-GFP is targeted exclusively to the contractile
vacuole complex (Figure 5E–H). The protein seems to be
present in most membranes of the contractile vacuole
system including contractile vacuole, ampullae, radial arms
and the ‘smooth spongiome’ surrounding them. It may act
in several fusion and fission events during the pumping
cycle, including reversible fusion of the radial arms with the
contractile vacuole and of the contractile vacuole with the
plasma membrane (Figure 5F,G). Interestingly, when new
contractile vacuole complexes are formed at the anterior
side of the existing ones during cell division (Figure 5H),
these also contain PtSyx2-1-GFP and pulsate.
PtSyx3-1-GFP staining also yields a regular, punctate
staining close to the cell surface, resembling that produced
by GFP-Syx1-1 (Figure 5I, enlargement in J). Again, the
fluorescence signal occurs slightly below the plasma
membrane (Figure 5K), where ‘terminal cisternae’ were
suggested to be structures homologous to early endosomes (16). Fluorescence is particularly abundant in the
uppermost region of the cytostome (Figure 5L), where
parasomal sacs and probably early endosomes are even
more concentrated (16).
Figure 5: In vivo labelling of PtSyx1-1, PtSyx2-1 and PtSyx3-1. A) In a median section through a cell GFP PtSyx1 1 is enriched at the
cell surface (arrowheads). Staining of blisters (A, top) suggests localization in the plasma membrane and underlying terminal cisternae
(A, inset; enlargement from area between arrowheads). Some specialized sites of the cytostome (indicated with an arrow) as well as
structures associated with fibers emanating from the cytopharynx (enlarged in B) are also stained. C) At the cell surface, GFP PtSyx1 1
fluorescence is concentrated in patches that are regularly arranged along the surface. Staining is most abundant near the fission region
(arrowheads), enlargement in (D) of dividing cells. E H) Localization of PtSyx2 1 GFP. The fusion protein is targeted to the contractile
vacuole complex where it localizes to the radial arms and the associated spongiome, the ampullae and the contractile vacuole. F) The
contractile vacuole before and G) after fluid discharge. H) At an early stage of cell division, when two old contractile vacuole complexes
have already doubled, both newly formed complexes contain PtSyx2 1 GFP. I L) Fluorescence of PtSyx3 1 GFP (I, enlarged in K) produces
a punctate pattern resembling that of GFP PtSyx1 1, although PtSyx3 1 GFP does not stain the plasma membrane (K). The labelled
structures appear to be localized in the cell cortex at a small distance from the plasma membrane (K, arrowheads). In median sections,
labelling of the cytopharynx is also visible (L, arrow), suggesting labelling of terminal cisternae. Bars 10 mm.
PtSyx4-1-GFP yields a strong diffuse fluorescence signal in
the cytoplasm (Figure 8A,B) and occurs in the membranes
of small vesicles that are attached to cytoskeletal elements, along which they are transported. Because the
vesicles are very abundant near the cytoproct and along
the oral cavity, they may represent discoidal vesicles that
retrieve the membranes of spent phagosomes from the
cytoproct (14). As vesicles are endocytosed at the cytoproct, transported through the cytoplasm and finally fuse
with the plasma membrane at the cytopharynx, the process strongly resembles transcytosis. This trafficking
pathway is known to involve syntaxins in epithelial cells
(39,40).
GFP-PtSyx5-1 appears in several hundred, 1- to 1.5 mmlong and <1 mm wide, rod- or banana-shaped organelles
per cell (Figure 9A,B), that are enriched in the cell cortex in
non-dividing cells (compare Figure 9A, surface, and C,
median section). However, in dividing cells, these struc-
tures are more equally distributed throughout the cell
(Figure 9D). A similar pattern of fluorescence label was
found in cells expressing a GFP fusion of the R-SNARE
PtSec22 (Figure 9E–H). Because Sec22 is known to shuttle in different SNARE complexes between ER and Golgi
(41,42), a less distinct pattern of 1 mm particles compared to GFP-PtSyx5-1 was found (Figure 9F). Like for
GFP-PtSyx5-1, those structures were also enriched in the
cortical regions of non-dividing cells (Figure 9G) and assumed an even distribution during cytokinesis (Figure 9H).
Immuno-gold EM analysis of GFP-PtSyx5-1-expressing
cells identified these structures as Golgi elements (Figure 10A) and a similar labelling associated with Golgi
cisternae was found for GFP-PtSec22 (Figure 10B). However, in the immuno-EM analysis of GFP-PtSec22 cells, the
Golgi cisternae appeared to be expanded, possibly as
a result of overexpression of the GFP-fused Sec22 protein,
which could interfere with ER–Golgi trafficking. Because
PtSyx5-1 and PtSyx5-2 cluster in the phylogenetic analysis
529
Figure 6: Immunolocalization of the PtSyx1 subfamily using affinity-purified antibodies against PtSyx1. A). Western blot analysis
of the subcellular distribution of PtSyx1. In lanes 1 5 aliquots (50 mg) of cell homogenates, 100 000 g pellet, 100 000 g supernatant,
microsomes and isolated cell cortices were processed for immunoprobing using either preimmune serum (PIS, top) or affinity purified
antibodies against a recombinant peptide representing the region between I82 I210 of PtSyx1 1 (bottom). Members of the PtSyx1
subfamily occur in the pellet fraction (lane 2), especially in the cortex of a Paramecium cell (lane 5). B) Immunofluorescence analysis of
PtSyx1. Isolated cortices were incubated with antibodies against PtSyx1, followed by fluorescein isothiocyanate coupled goat anti rabbit
IgGs. By using the same polyclonal antibody as in (A), a strong fluorescence signal occurs in the membrane along the outlines of surface
fields (kinetids), predominantly near the intersections of longitudinal and transverse ridges. C) Double labelling of PtSyx1 and tubulin in
isolated cortices. These were processed for PtSyx1 staining (green) as in (B) and co incubated with a monoclonal anti tubulin antibody (red)
that predominantly stains basal bodies. Note that PtSyx1 label is located slightly above basal bodies (between arrowheads), suggesting its
localization at the plasma membrane. Bar 10 mm.
with Golgi-specific syntaxins of other organisms (Figure 3)
and GFP labelling of PtSyx5-1 is compatible with a localization in the Golgi apparatus of Paramecium (Figure 9), we
asked whether the GFP-labelled structures in Paramecium
can be disassembled by Brefeldin A (BFA), as would be
expected from the results of other systems (43). Therefore, BFA was applied to GFP-PtSyx5-1-transfected cells
and the effect on the fluorescence signal was monitored at
varying time points (Figure 11). Indeed, the rod- or bananashaped, cortically enriched organelles disappeared upon
treatment with BFA, and instead brightly labelled patches
appeared (compare Figure 11A with B and C). This process
was reversible, as shown by washout of BFA, leading to
the reassembly of the original organelles (Figure 11D).
Figure 7: Immuno-gold EM localization of PtSyx1-1-GFP. Sections
labelled with anti GFP antibodies,
followed by pA Au5. A) Note label
along the cell membrane (arrow
heads) particularly along a ‘grazing’
section part between arrowheads,
as well as labelling of vesicles asso
ciated with a terminal cisterna (tc)
within the framed area. B) Labelling
associated with a tc below the cell
surface (cs) inside framed area. C)
Labelling of discoidal vesicles
(circles). bb, basal body; t, trichocyst.
Bars 0.1 mm.
530
Figure 8: In vivo labelling of PtSyx4-1. PtSyx4 1 GFP brightly stains cytoplasmic elements, presumably membranes of very small
vesicles travelling along cytoskeletal elements (A,B) according to movies (data not shown). A) Enlargements. These vesicles are enriched
near the cytoproct (arrow) as well as along the oral cavity (B, enlargement), where vesicles are faintly visible (arrowheads). Note that the
anterior pole of the cells (bottom in A, top in B) is devoid of any label. Bars 10 mm.
However, higher concentrations than described for animal
cells had to be used for prolonged periods, probably
because of differing penetration and pharmacological
sensitivity. For comparison, in plant cells BFA had to be
applied at a concentration of 50 mg/mL for 30 min to
achieve the redistribution of Arabidopsis thaliana AtSec22
and AtMembrin from Golgi bodies to the ER membranes
(44). We obtained similar results when we treated GFPPtSec22-transfected cells (Figure 11E) with the same
concentration of BFA, i.e. upon treatment a complete
redistribution of label to an ER-like pattern was found
(Figure 11F). Again, this effect was reversible and after
washout of BFA the staining assumed a cortically enriched
particulate pattern again (Figure 11G). This experiment
demonstrates that the integrity of these organelles and
distribution of marker proteins is clearly affected by BFA
and this further argues for presence of PtSyx5 and
PtSec22 in and near the Golgi apparatus, respectively.
This effect is specific for the Golgi-localized PtSyx5 and
PtSec22 because other syntaxins, like PtSyx2 of the
contractile vacuole system, are not affected in their
localization by treatment with BFA (Figure S1).
For unknown reasons, neither N- nor C-terminal GFP
fusion constructs of PtSyx6-1 gave fluorescence signals
in living or fixed cells (not shown), although we found that
PtSyx6-1 is expressed according to the presence of its
cDNA (Table 1).
PtSyx8-2-GFP mainly stains reticular structures in the
cytoplasm (Figure 12A). By focussing on the cell cortex,
the labelled structure appears to be ER, as it resembles the
pattern after ER affinity staining with DiOC6 or DiOC18
(45,46). Furthermore, the PtSyx8-2-GFP staining overlaps
with the ER-localized synaptobrevin PtSyb3 (26) as shown
by confocal imaging of co-staining with the respective
antibody (Figure 12B–E). This co-staining occurs especially
in the cortical regions of ER.
PtSyx7-2-GFP is transported to phagosomes, but it also
stains the cytoplasm, probably because of its presence in
the membranes of small vesicles (Figure 13A,B). Only
a small fraction of phagosomes contain PtSyx7-2 in their
membranes, suggesting that food vacuoles at different
stages of maturation differ in their membrane composition, as discussed by Allen and Fok (14) and therefore
possibly also in their set of SNAREs.
GFP-PtSyx9-1 is also localized in small vesicles dispersed
throughout the cytoplasm (Figure 13C,D). Interestingly, in
the case of PtSyx9-1-GFP, where the GFP tag was C-terminal
and exposed to the lumen of the vesicle, the fusion protein
does not produce any fluorescence signal in the living cell.
However, fluorescence appears after fixation with formaldehyde, leading to fields of fluorescent vesicles (not
shown). Because the enhanced version of GFP we used
[eGFP, (37)] does not fluoresce at pH < 5 (47) and
becomes visible only after fixation, it is most likely that
vesicles containing PtSyx9-1-GFP are acidic.
PtSyx10-1-GFP resides in vesicles with a size range of
1–2 mm (Figure 13E,F) that are travelling rapidly with the
cyclosis stream (data not shown). PtSyx11-1-GFP is present in the membranes of most food vacuoles (Figure 13
G,H), while PtSyx12-1-GFP fluorescence is concentrated in
‘large patches’ and only occasionally occurs on the membranes of food vacuoles (Figure 13I,J).
As a predicted Qc-SNARE, PtSyx14-1-GFP is localized
within the ampullae and the radial arms of the contractile
vacuole complex (Figure 14A,B) as was observed also for
PtSyx15-1-GFP (Figure 14C,D). However, both constructs also
produce a diffuse signal in the cytoplasm (Figure 14A–D),
probably because of their presence in the membranes of
numerous small vesicles.
Functional studies on individual syntaxins of the
secretory pathway
To investigate the function of individual syntaxins, e.g. of
the secretory pathway, we have performed gene silencing
using an RNAi approach by feeding transformed bacteria
(48). If the nucleotide identity between the pairs of one
531
Figure 9: Green fluorescent protein labelling of PtSyx5-1 and
PtSec22. GFP PtSyx5 1 stains 1 to
1.5 mm long, straight or banana
shaped organelles (A, arrowheads in
enlargement B). In exponentially
growing cells, these are most abun
dant in the cortical region (C), while in
dividing cells they assume a more
even distribution throughout the cyto
plasm (D). GFP PtSec22 appears in
similar 1 to 2 mm sized structures,
but irregular shaped structures (E,
enlarged in F) that are enriched in
the cortex region (G) and distribute
evenly in dividing cells (H). Because of
the shuttling of Sec22 in small vesi
cles between ER and cis Golgi, the
staining appears less distinct com
pared to GFP PtSyx5 1. Bars 10 mm.
subfamily is high enough (85%), one can expect cosilencing of isoforms (49). In most cases, we constructed
a silencing plasmid specific for just one of the two isoforms (Table 2). For silencing more than one isoform, we
used a novel strategy by cloning the complete open
reading frame of each isoform in tandem between the T7
promoters of the same feeding plasmid (see ‘Materials
and Methods’ section). As a control for successful gene
silencing, we used the established construct targeting nd7
that results in a non-lethal exocytosis-minus phenotype
(49). For mock silencing, either the empty vector pPD or
pPD-gfp was used. Unfortunately, most of our gene
532
silencing constructs that were targeting only one of the
isoforms gave rise to normal phenotypes (Table 2). This
argues for a functional overlap between isoforms of the
syntaxin subfamilies. For instance, when we used a 300
bp fragment of genomic DNA for silencing of Ptsyx1-1 or
Ptsyx1-2, no phenotypic defects were observed (Table 2).
In cells silenced with a construct containing the entire
open reading frame of Ptsyx1-1, an inhibition of stimulated
exocytosis to varying extent was found. Only when we
used a double silencing construct containing the full-length
open reading frames of both genes (pPD-syx1-1ORF-syx12ORF), we could observe phenotypic defects (Figure 15;
Figure 10: Immuno-gold EM localization of GFP-PtSyx5-1 and GFP-PtSec22. A) Section of a GFP PtSyx5 1 expressing cell, labelled
with anti GFP antibodies, followed by pA Au5 gold particles (5 nm; encircled). Note labelling of Golgi associated vesicles. B) Same immuno
gold anti GFP labelling of pA Au3 3 nm (circles) in a GFP PtSec22 expressing cell. Note that Golgi stacks appear slightly enlarged possibly
as a cause of overexpression of PtSec22. Bars 0.1 mm.
Table 2). Down-regulation of Ptsyx1-1 in Syntaxin1-RNAi
cells could be shown by reverse transcriptase–polymerase
chain reaction (RT–PCR) using a primer pair with one primer
lying outside the open reading frame contained in the
silencing construct (Figure 15A). The growth rate of Syntaxin1-RNAi cells was strongly reduced, without the appearance of cells arrested in certain division stages (Figure 15B).
Compared to mock-silenced control cells (Figure 15C), the
stimulated exocytosis of trichocysts is inhibited in Syntaxin1-RNAi cells (Figure 15D). This effect does not seem to be
caused by a defect in trichocyst synthesis or lack of docking
because docked trichocysts could be found in controls as
well as in Syntaxin1-RNAi cells. However, the inhibition of
stimulated exocytosis was never as complete as seen for
control nd7-RNAi cells. Further analysis showed that Syntaxin1-RNAi cells are smaller and possess altered proportions as seen as a decreased width:length ratio
(Figure 15E,F). Note that the observed reduced exocytosis
rate in Syntaxin1-RNA1 cells was not an effect of the
reduced cell size because it was measured as percentage
of exocytosis per cell and not per surface area.
In PtSyx2-RNAi cells, only a transient reduction of growth
rate during the first 24 h of feeding was observed (Table 2).
Because PtSyx2 was found in the contractile vacuole
complex (Figure 5E–H), it is conceivable that this was an
effect on osmo- and/or ion regulation because at the
beginning of feeding cells are transferred into a different
medium and fed with a different type of bacteria. This
finding requires further investigation for instance under
osmotic stress conditions.
Discussion
General aspects
Here, we describe 26 syntaxin genes in P. tetraurelia, of
which 23 should represent the entire set of Qa-SNAREs;
the remaining three represent Qc-SNAREs. Most remarkably, no syntaxins of the Qb type were found, which are
present in all other systems where the full set of
Q-SNAREs is known (11,13,50–52). This function may be
performed solely by a SNAP-like Qb/c SNARE, which we
also identified (data not shown). The number of syntaxins
is much smaller in other unicellular eukaryotes, such as
Plasmodium falciparum (http://www.plasmodb.org), Leishmania major (52), Giardia, Trypanosoma and some lessstudied protozoan parasites (50,53). The Saccharomyces
cerevisiae and Drosophila melanogaster genomes contain
only seven Qa-SNARE genes (11,13), while the Caenorhabditis elegans genome comprises nine (11), the human
twelve (11), and A. thaliana 18 Q-SNAREs of the syntaxin
type (51). The large number of Qa-SNAREs in the Paramecium genome may be explained by a recent global
genome duplication event (27) and by the complex membrane trafficking pathways (Figure 16). Mammalian systems increase the number of isoforms by alternative
splicing of syntaxins (30,54), with either differential expression or localization (55,56), whereas alternative splicing is
not known from Paramecium.
Most of the Paramecium Qa-SNAREs contain the typical
features of syntaxins (Figures 1 and 2), with a SNARE
motif for four-helix bundle formation (7,8,33) and a conserved glutamine for NSF-mediated disassembly (57).
However, PtSyx11 does not contain the typical glutamine
of Q-SNAREs (Figure 3). Such deviations have been
described for the equally AT-rich genomes of Plasmodium
and Eimeria (50). Some of the PtSyx, especially the plasma
membrane-associated ones, also reveal an autonomously
folding N-terminal domain (Figure 4) - a characteristic feature within this clade of syntaxins (36,37). This domain may
regulate SNARE assembly by forming a three-helix bundle
(Habc) which folds back onto the SNARE domain (58,59).
The N-terminal Habc domain may also bind auxiliary
proteins like the Sec1/Munc-18 proteins (60,61).
PtSyx1-1 as an exocytosis-relevant Qa-SNARE
We suggest PtSyx1-1 to be the Qa-SNARE relevant for
constitutive and stimulated exocytosis for the following
reasons. (i) In our phylogenetic analysis, not only PtSyx1-1
and PtSyx1-2 but also PtSyx2 and PtSyx3 can clearly be
533
Figure 11: Effect of Brefeldin A on
GFP-PtSyx5-1- and GFP-PtSec22transfected cells. A) Before BFA
treatment, GFP PtSyx5 1 cells show
distinct distribution of 1 mm large,
rod to banana shaped organelles. B)
After BFA treatment, the number of
those small organelles drastically de
creases, while strongly stained
patches arise in the cytoplasm (C) until
eventually none of the original organ
elles remain. Instead, labelled strings
occur in addition to the large patches.
D) After washout of BFA, the pattern
of the original organelles has
reformed. E) Before BFA treatment,
GFP PtSec22 cells show a distinct
distribution of mostly 1 mm large,
irregular shaped structures. F) After
BFA treatment, the staining appears
in a diffuse, ER like pattern. G) This
effect was reversible: after washout
of BFA, the pattern of the original
organelles could be restored. Bars
10 mm.
assigned to the clade of syntaxins associated with the
plasma membrane (Figure 3). Their close relationship
(Table 1) also becomes evident from secondary structure
predictions, all showing features of plasma membraneassociated syntaxins (Figure 4A,B). This includes possible
intermolecular interaction of the Habc domain with the
membrane-proximal SNARE domain (H3 domain), as described for other exocytotic syntaxins. (ii) PtSyx1 subfamily
members are found in the cell cortex and some specialized
regions at the cytopharynx (Figure 16). (iii) Only silencing of
Ptsyx1 gene family showed an effect on stimulated exo534
cytosis (Table 2, Figure 15D). Those Syntaxin1-RNAi cells
furthermore showed a reduced growth rate and cell size,
which is in agreement with the localization we found for
the GFP-tagged PtSyx1-1 at the fission zone (Figure 5C).
In Paramecium, the sites for constitutive exocytosis and
endocytosis are at the same place (14,18). The so-called
parasomal sacs are permanent omega-shaped indentations of the plasma membrane regularly arranged over
the somatic surface of the cell (16) with extensive membrane trafficking to the underlying ‘terminal cisternae’
Figure 12: Green fluorescent protein labelling of PtSyx8-2
and colocalization with PtSyb3. A) PtSyx8 2 GFP shows cyto
plasmic staining in a ‘patchy’ manner, with some more distinct
structures, e.g. in a tubular form in the cell cortex, all suggesting
localization to the ER. (B E) Confocal image slice (1 mm) of
a PtSyx8 2 GFP expressing cell co stained with an antibody rec
ognizing the established ER resident protein PtSyb3. E) Especially
in the cortical regions, there is a high level of colocalization of the
two markers. Note that autofluorescence of food particles in
food vacuoles produced a background signal in the green channel.
Bars 10 mm.
(14,17,18). For specific membrane recognition, each of
these compartments in correspondence may have to be
equipped with a unique Qa-SNARE (Figure 5). Immunostaining techniques (Western blots, immunofluorescence,
and immuno-EM) independently confirmed the localization
of PtSyx1-1 as a GFP fusion protein (Figures 6 and 7).
So far, all data strongly suggest PtSyx1-1 being the best
candidate for an exocytosis-relevant Qa-SNARE in Paramecium. Its function seems to include other pathways
originating from the plasma membrane, e.g. the formation
Figure 13: In vivo labelling of PtSyx7-2, PtSyx9-1, PtSyx10-1,
PtSyx11-1 and PtSyx12-1. (A,B) PtSyx7 1 GFP labels some, but
not all food vacuoles (fv) and produces diffuse labelling of the
cytoplasm. (C,D) GFP PtSyx9 1 stains small vesicles throughout
the cytoplasm, which in some regions are grouped around food
vacuoles (see inset, D). (E,F) PtSyx10 1 GFP localizes to vesicles
(arrows, F) of 1 2 mm size that rapidly travel with the cyclosis
stream (not shown). (G,H) PtSyx11 1 GFP localizes to membranes
of food vacuoles, but, like PtSyx7 1 GFP, it is not associated with
all of them. Also note staining of the cytoplasm. (I,J) PtSyx12 1
GFP is found on food vacuole membranes (arrowhead) but also in
patches in the cytoplasm. Bars 10 mm.
of the nascent food vacuole (Figure 5A,B; Figure 16).
Because GFP fluorescence is absent at later phagosomal
stages, a recycling pathway can be assumed, involving the
535
Figure 14: In vivo labelling of
PtSyx14-1 and PtSyx15-1. Both,
PtSyx14 1 GFP and PtSyx15 1 GFP,
localize to membranes of the contrac
tile vacuole complex, i.e. contractile
vacuole (cv), specifically to ampullae
(am) and radial arms (ra). Also note
some diffuse cytoplasmic staining
and brighter patches that might rep
resent crystalline inclusions of the
cell. Bars 10 mm.
cytopharyngeal ribbons to transport the vesicles back to
the cytostome (14). The staining of PtSyx1-1 associated
with terminal cisternae in Figure 5A (inset) and in the
immuno-EM (Figure 7B) suggests an additional role of
PtSyx1 in the endocytic pathway. PtSyx1 may also operate
at the contractile vacuole–plasma membrane interface,
where it is in recurring contact with the plasma membrane
(23). In contrast, paralogues of the PtSyx2 subfamily occur
predominantly in the contractile vacuole complex and
those of the PtSyx3 subfamily at the early endosome
(Figure 16). The localization of putative plasma membraneassociated syntaxins in these organelles may give rise to
speculation about their molecular identity and biogenesis.
All these data agree with the presence of plasma membrane-associated syntaxins in intracellular compartments
in mammalian systems (62–64).
Table 2: Effects of RNAi of individual syntaxin members on cell morphology and various physiological aspects
Constructa
Stimulated exocytosis
Morphology
Division rate
Identity to sister
isoform (%)
pPD Ptsyx1 1256–566
pPD Ptsyx1 1ORF
pPD Ptsyx1 281–337
pPD Ptsyx1 1ORF Ptsyx1 2ORF
pPD Ptsyx2 1264–526
pPD Ptsyx2 1ORF
pPD Ptsyx2 1ORF Ptsyx2 238-897
pPD Ptsyx3 1251–550
pPD Ptsyx4 1569–782
pPD Ptsyx5 1362–664
pPD Ptsyx8 1286–583
pPD nd7
pPD (empty vector)
pPD gfp (mock silencing)
Normal
Partially inhibitedb
Normal
Inhibited
Normal
Normal
Normal
Normal
Normal
Normal
Normal
Inhibited
Normal
Normal
Normal
Normal
Normal
Smaller
Normal
Normal
Normal
Normal
Normal
Normal
Normal
Normal
Normal
Normal
Normal
Normal
Normal
Reduced
Normal
Normal
Delayed (within the first 24 h)
Normal
Normal
Normal
Normal
Normal
Normal
Normal
73.3
76.9
66.1
100
89.0
90.4
100
78.3
63.1
85.1
51.7
a
Numbers refer to the base pairs of the macronuclear DNA from which the fragment was created; ORF designates the entire open reading
frame was used.
b
n 40 cells; 10 cells were 100% inhibited, 12 cells were 50 75% inhibited and 6 cells 25 50% inhibited; 12 cells were not inhibited.
536
Figure 15: Effects of PtSyx1-RNAi. A)
Polymerase chain reaction of Ptsyx1 1 with
a pair of primers with one primer lying
outside and the other inside the open
reading frame from control macronuclear
DNA (lane 1), control cDNA library (lane 2),
the silencing plasmid pPD syx1 1ORF syx1
2ORF (lane 3), not DNAse treated cDNA of
pPD gfp mock silenced (lane 4) and syx1
silenced cells (lane 5). No Ptsyx1 1 could be
amplified from the silencing plasmid con
trol (lane 3). Ptsyx1 1 genomic DNA
(gDNA), but no cDNA of Ptsyx1 1 could
be amplified from Syntaxin1 RNAi cells
(lane 3), whereas a control gene (arrow
head) was amplified from all samples
except the plasmid (lane 3). Note that the
600 bp control gene only contains a sin
gle 25 bp insert and hence the molecular
weight difference between the genomic
DNA and the cDNA copy is minimal. B)
Syntaxin1 RNAi cells showed a significant
reduction of the growth rate expressed as
the number of cell divisions within 24 h.
Bars standard deviations. C) Stimulated
exocytosis of control cells (n 50) and (D)
Syntaxin1 RNAi cells (n 102) of a typical
experiment. A picture of a typical cell is
shown for each experiment. Stimulated
exocytosis of trichocysts is inhibited in
Syntaxin1 RNAi cells with most cells show
ing no trichocyst discharge. The extent of
stimulated trichocyst exocytosis was mea
sured per cell and cells of each category
were scored; hence, no error bars are
shown. Size bar
10 mm. E) Effect of
Syntaxin1 RNAi on cell shape. Silenced
cells appear smaller and thinner, with the
width/length ratio significantly affected (F).
Bars standard deviations.
PtSyx5—a candidate Golgi marker
The Golgi apparatus in Paramecium consists of several
hundreds of dictyosomes, each 1 mm in size, scattered
throughout the cell (65,66). Yet no molecular data were
known. We now identified PtSyx5 as a putative marker of
the Golgi apparatus of Paramecium for the following
reasons. (i) Phylogenetic analysis clearly allocates PtSyx5
to the clade of the syntaxin 5 family that mediate transport
into and across the Golgi (67–69), the transport from the
early recycling endosome to the TGN (70) and the reassembly of Golgi cisternae from mitotic fragments (71). (ii)
The fluorescence signal observed in cells transfected with
GFP-PtSyx5-1 (Figure 9A–D) is compatible with size and
distribution of the Golgi fields in Paramecium (65,66). (iii)
Treatment with BFA, a well-established inhibitor of Golgi
dynamics (43), causes the complete, but reversible breakdown of the distinct GFP-labelled structures (Figure 11B–
D). Similar observations were made for the R-SNARE
PtSec22 that is involved in ER-Golgi transport (Figure 11
E–G). Because of the evolutionary distant position of
Paramecium compared to animals, it is not at all surprising
that the pharmacology differs and higher doses of BFA had
to be used in accordance with findings in plants (44).
It still has to be examined whether the two putative Golgi
paralogues in Paramecium, PtSyx5-1 and PtSyx5-2, may
serve differential functions. For instance, in the rat liver,
a second syntaxin 5 isoform contains an N-terminal ER
537
Figure 16: Paramecium trafficking network [based mainly on work by Allen and Fok, (14)] superimposed with syntaxin
distribution (this article). As there is no indication of a functional or topological diversification within subfamily members at the
moment, only the syntaxin subfamily number is indicated. Dotted lines mark the path of organelles, whereas continuous arrows mark
vesicle delivery pathways. ‘?’ Indicates putative trafficking pathways for which syntaxin involvement has not been demonstrated so far. For
comparison, the localization of PtSec22 is also indicated. as, acidosome; ci, cilium; cp, cytoproct; cph, cytopharynx; cs, cytostome; cvc,
contractile vacuole complex; ds, decorated spongiome of the cvc; dv, discoidal vesicle; ee, early endosome (terminal cisterna); er,
endoplasmic reticulum; fv, food vacuole; ga, golgi apparatus; gh, ghost; pm, plasma membrane; ps, parasomal sac (coated pit); ss, smooth
spongiome of the cvc; tr, trichocyst; trp, trichocyst precursor.
retrieval signal (55) and in A. thaliana several Qa-SNAREs
occur in the Golgi apparatus and TGN (51,72).
Phagocytosis-associated syntaxins appear to be
a unique clade of Q-SNAREs
According to the evolutionary relationship tree, a large
group of Paramecium syntaxins, the members of the
subfamilies PtSyx7, PtSyx9, PtSyx10, PtSyx11 and
PtSyx12, seem to represent a unique clade of Q-SNAREs
without having any orthologues in metazoan cells (Figure 3). Because the Tetrahymena genome does contain
close orthologues, it can be assumed that the syntaxins of
this clade may have a role in a more specialized pathway of
ciliates and other free-living cells, e.g. in their phagosomal
system for food uptake (14,73,74). In Paramecium, this is
a membrane trafficking system of great complexity (14),
where phagosomes sequentially fuse with a series of
endomembrane compartments to acquire degradative
properties, before their indigestible waste material is
expelled. Because this includes acidification and neutralization, fusion with lysosomes and retrieval of membranes,
it had to be expected that a high number of syntaxin
paralogues might be required. Our in vivo GFP localization
data clearly support this hypothesis insofar as different QaSNAREs are present in different stages of phagosome
maturation (Figures 13 and 16). With the identification and
assignment of individual syntaxins to this pathway, it will
be possible in the future to dissect and analyse individual
steps of this pathway in more detail.
Conclusions
The present study enabled us to assign most of the
identified syntaxins to different trafficking pathways in
538
the Paramecium cell. A promising candidate for exocytosis, a process we are most interested in, could be
identified and will be investigated in more detail in future
work. Another interesting topic will be to define the
targeting signals in Paramecium syntaxins and to compare
them with proposed localization signals in other systems
(75–77). To refine such analysis, Paramecium appears
appropriate because of its complex membrane trafficking
system.
Materials and Methods
Cell culture
Wild type strains of P. tetraurelia used were stocks 7S and d4 2, derived
from stock 51S (78). Cells were cultivated in a bacterized medium as
described previously (79).
Annotation and characterization of Ptsyx genes
In order to identify new syntaxin genes in Paramecium (Ptsyx) by homology
searches, the developing Paramecium database (http://aiaia.cgm.cnrs gif.fr)
was screened by using the nucleotide and amino acid sequence of
syntaxins either from other organisms or from already annotated Parame
cium Ptsyx genes. Positive hits were further analysed by performing blast
searches at the National Centre for Biotechnology Information database
(80). Conserved motif searches were performed with either PROSITE (81)
or with BLAST RPS using pfam entries of the corresponding Conserved
Domain Database (82,83). We also used PSIPRED (84) and MEMSAT 2 (85,86),
two methods for secondary structure and transmembrane topology pre
diction, respectively, included at the server at http://bioinf.cs.ucl.ac.uk/
psipred/(87). Phylogenetic and molecular evolutionary analyses were
performed with either CLUSTALW or the MEGA version 3 program (88).
Polymerase chain reaction of genomic DNA and
cDNAs
Total wild type DNA from strain 7S for PCR was prepared from log phase
cultures as published by Godiska et al. (89). The open reading frames of
individual Ptsyx genes were amplified by RT PCR using total RNA prepared
according to Haynes et al. (90). Reverse transcriptase polymerase chain
reaction was performed in a programmable thermocycler T3 (Biometra,
Göttingen, Germany) using 30 oligo dTT primer and the SuperScriptä III
reverse transcriptase (Invitrogen, Karlsruhe, Germany) for first strand cDNA
synthesis. 30 oligo dTT primer: 50 AACTGGAAGAATTCGCGGCCGCG
GAATTTTTTTTTTTTTT 30 . The subsequent PCR (50 mL) was performed
with the Advantage 2 cDNA polymerase mix (Clontech, Palo Alto, CA, USA)
using Ptsyx specific oligonucleotides (Table S1) with or without artificial
restriction sites added at their ends. In general, amplifications were
performed with one cycle of denaturation (958C, 1 min), 40 42 cycles of
denaturation (958C, 30 seconds), annealing (54 588C, 45 seconds) and
extension (688C, 3 min), followed by a final extension step at 688C for 5 min.
Polymerase chain reaction products were sub cloned into the plasmid
pCR2.1 by using the TOPO TATM Cloning Kit (Invitrogen) according to the
manufacturer’s instructions. After transformation into Escherichia coli (DH5
cells or TOP10F’ cells), positive clones were sequenced as described
below.
Sequencing
Sequencing was performed by MWG Biotech (Martinsried, Germany)
custom sequencing service. DNA sequences were aligned by the CLUSTALW
feature integrated in the DNASTAR LASERGENE software package (Madison,
WI, USA).
Expression of a PtSyx1-1-specific peptide in E. coli
For heterologous expression of a PtSyx specific peptide, we selected a part
of the coding region of PtSyx1 1 (I82 I210; accession number CR855934).
After changing all deviating Paramecium glutamine codons (TAA and TAG)
into universal glutamine codons (CAA and CAG) by PCR methods (97) (for
primers, see Table S3), this region of Ptsyx1 1 was cloned into the NcoI/
XhoI restriction sites of the pRV11 expression vector (98), a derivate of the
pET System from Novagen (Madison, WI, USA) which adds a 10 amino acid
peptide to the C terminus of the selected sequence including a His6 tag for
purification of the recombinant peptides.
Purification of a recombinant PtSyx1-1 peptide and
preparation of polyclonal antibodies
The recombinant PtSyx peptide, PtSyx1 1I82 I210, was purified by affinity
chromatography on Ni2þ nitrilotriacetate agarose under denaturing condi
tions, as recommended by the manufacturer (Novagen). The recombinant
peptide was eluted with a buffer at pH 4.5 containing 100 mM NaH2P04,
10 mM Trizma base supplemented with 8 M urea and 1 M imidazole. The
collected fractions were analysed on SDS polyacrylamide gels, and those
containing the recombinant peptides were pooled, dialyzed against PBS
and used for immunization of a rabbit. After several boosts, positive sera
were taken and affinity purified by two subsequent chromatography steps
as described previously (79).
Cell fractionation
Construction and microinjection of GFP expression
plasmids
Ptsyx and Ptsec22 specific PCR products obtained with the oligonucleotides
listed in Table S2 were cloned into the eGFP expression plasmid pPXV GFP
(38) either in front of the egfp gene, as described by Wassmer et al. (91) or at
the end of the egfp gene between one of the restriction sites NheI, SpeI or
PstI, and the XhoI site, respectively, of the plasmid using conventional
cloning procedures (92). For microinjection of cells, the pPXV GFP fusion
plasmids were linearized with SfiI, which cuts in between the T. thermophila
inverted telomeric repeats, thus helping to stabilize the DNA in the
macronucleus after injection (93). DNA to be injected was isopropanol
precipitated and resuspended to a concentration of 1 5 mg/mL in MilliQ
water. For microinjection, we used post autogamous cells, which were
allowed to grow for 3 4 generations in bacterized salad medium. To avoid
any disturbances of the transformation process, cells were also treated with
0.02% aminoethyldextran (to remove trichocysts) and equilibrated in Dryls
buffer [2 mM sodium citrate, 1 mM NaH2PO4, 1 mM Na2HPO4, 1.5 mM CaCl2,
pH 6.8; (94)] supplemented with 0.2% BSA. DNA microinjections were made
with glass microcapillaries under an Axiovert 100TV phase contrast micro
scope (Zeiss, Oberkochen, Germany). Expression of GFP fusion proteins in
clonal descendants of microinjected cells was analysed after 16 48 h, either
by epifluorescence microscopy in a Axiovert 100TV microscope equipped
with GFP filter set 13, a plan Neofluar 40 oil immersion objective (numeric
aperture 1.30) and with a ProgRes C10 plus camera system from Jenoptik
(Jena, Germany), or by a conventional LM Axiovert 200M microscope
equipped with GFP filter set 38, an alpha plan Neofluar 40 objective, and
with a AxioCam MR camera system (all microscopical equipment from
Zeiss). Excitation light was produced by a 100W HBO lamp. Images were
processed either with the AXIOVISION software (Zeiss) or with ADOBE PHOTOSHOP
(Adobe Systems, San Jose, CA, USA).
For subcellular fractionation, cells were grown in an axenic culture medium
at 258C and harvested at the late logarithmic phase as previously described
(99). Whole cell homogenates were prepared in 20 mM phase buffer (20 mM
Tris maleate, 20 mM NaOH, 20 mM NaCl and 250 mM sucrose, pH 7.0) as
described (79). Soluble and particulate fractions were separated by
centrifugation at 100 000 g for 60 min at 48C. Cell surface complexes
(cortices) were prepared according to Lumpert et al. (100), and enriched
microsomes according to Kissmehl et al. (101). A protease inhibitor cock
tail containing 15 mM pepstatin A, 100 mU/mL aprotinin, 100 mM leupeptin,
0.26 mM Na (p toluene sulfonyl) L arginine methyl ester, 28 mM E64 and
0.2 mM Pefabloc SC was used throughout.
SDS–PAGE and immunoblotting
Protein samples were denatured by boiling for 5 min in SDS sample buffer,
subjected to electrophoresis in 10% SDS polyacrylamide gels using
a discontinuous buffer system described before (25). Electroblotting onto
nitrocellulose membranes and immunobinding was carried out as described
(79) by using affinity purified antibodies against PtSyx1 1. Bound antibodies
were detected with a peroxidase conjugated secondary antibody (anti
rabbit IgG) (Dianova, Hamburg, Germany) using the Amersham enhanced
chemiluminescence detection system.
Brefeldin A treatment of Paramecium cells
A stock solution of 5 mg/mL BFA (Molecular Probes, Eugene, OR, USA) was
made in dimethyl sulphoxide (DMSO). Paramecia were incubated in glass
depression wells with BFA dilutions ranging in the concentration from 50 ng/
mL to 150 ng/mL for 0 5 h. Control cells were incubated with the same
concentration of DMSO. At various time points, living cells were analysed for
GFP fluorescence. To show reversibility of the effect, cells were washed in
buffer, transferred back to bacterized medium and re analysed after 16 h.
Gene silencing by feeding
Immuno-LM analysis
The coding sequences of individual Ptsyx genes, either as 300 bp isoform
specific fragments from genomic DNA or as full length cDNA sequence,
were amplified by PCR using Ptsyx specific oligonucleotides (Table S3) and
cloned into the double T7 promotor plasmid pL4440 (95) via the XbaI/XhoI
or HindIII/XhoI restriction sites. Plasmids were introduced in the Escher
ichia coli Ht115 strain and Paramecium cells were fed with these strains as
described in detail by Wassmer et al. (91). The Paramecium cells were
analysed after 36 48 h of feeding. Capability of trichocyst exocytosis was
routinely tested with a saturated solution of picric acid (96).
Immuno light microscopic analyses were performed either with permeabi
lized cells or with isolated cortices. Cells suspended in Pipes/HCl buffer
(5 mM, pH 7.2) with 1 mM KCl and 1 mM CaCl2 were fixed in 8% (wt/v)
freshly depolymerized formaldehyde in the same buffer solution plus 0.5%
digitonin (Sigma, Taufkirchen, Germany), 30 min, 208C, washed in PBS
and then incubated twice in PBS supplemented with 50 mM glycine and
finally in PBS plus 1% BSA. The same was performed with isolated corti
ces, but without digitonin. Samples were then exposed to affinity purified
anti PtSyx1 1 antibodies (1:50), followed by AlexaFluorÒ 488 conjugated
539
anti rabbit antibodies (Molecular Probes), the latter diluted 1:100 in
PBS þ 1% BSA. For controls, either preimmune serum was used or
primary antibodies were omitted. Samples were mounted with Mowiol
supplemented with n propylgallate to reduce fading. Fluorescence was
analysed in a confocal laser scanning microscope LSM 510 Meta (Zeiss)
equipped with a Plan Apochromat 63 oil immersion objective (NA 1.4) or
in a conventional epifluorescence microscope described above. Images
acquired with the LSM 510 software were processed with PHOTOSHOP
software (Adobe Systems).
Immuno-EM analysis
Paramecium cells transformed with GFP PtSyx1 1, GFP PtSyx5 1 or GFP
PtSec22 were fixed in 4% formaldehyde plus 0.15% glutaraldehyde in 100 mM
cacodylate buffer pH 7.0 for 2.5 h at room temperature, followed by two
washes with the same buffer. Cells were dehydrated in ethanol series
and embedded in LR Gold resin (Agar Scientifique, Stansted, UK) according
to standard protocols. Sections were incubated with anti GFP antibodies
(102), followed by protein A bound to colloidal gold particles of 3 or 5 nm
size (pA Au3/5), and stained with aqueous uranyl acetate and analysed, all as
previously described (79).
Acknowledgments
We would like to thank Genoscope (Paris) as well as Drs L. Sperling and
J. Cohen (Gif sur Yvette) for access to the server with the sequencing data,
Drs C. Stuermer and N. Kasielke for access to and operating the Axiovert
200M, Dr E. May of the Bürkle lab for access to LSM 510 Meta as well as
Dr J. Hentschel and D. Bliestle for electronic image processing. This work
has been supported by Deutsche Forschungsgemeinschaft (grants to H. P.
and R. K. and project C4 of TR SFB11, grant to H. P.)
Supplementary Materials
Figure S1: Treatment of cells with Brefeldin A had no effect on the
subcellular localization of PtSyx2 in the contractile vacuole system.
Cells were treated with brefeldin, fixed and permeabilized as described in
‘Materials and Methods’ section. Immunostaining was performed with an
affinity purified anti PtSyx2 rabbit antibody and secondary AlexaFluor 488
coupled goat anti rabbit (Molecular Probes). No difference in the staining
pattern of PtSyx2 was found between control cells treated with the same
concentration of solvent and brefeldin A treated cells. Bar ¼ 10 mm.
Table S1: Oligonucleotides used to study syntaxin gene expression
(cDNA).
Table S2: Oligonucleotides used to amplify syntaxin for GFP tagging
at the C-terminus (C) or N-terminus (N).
Table S3: Oligonucleotides for heterologous expression of His-tagged
PtSyx1-1 peptide I82–I210 in Escherichia coli.
Supplemental materials are available as part of the online article at http://
www.blackwell synergy.com
References
1. Chen YA, Scheller RH. SNARE mediated membrane fusion. Nat Rev
Mol Cell Biol 2001;2:98 106.
2. Ungar D, Hughson FM. SNARE protein structure and function. Annu
Rev Cell Dev Biol 2003;19:493 517.
3. Hong W. SNAREs and traffic. Biochim Biophys Acta 2005;1744:
120 144.
540
4. Söllner T, Bennett MK, Whiteheart SW, Scheller RH, Rothman JE. A
protein assembly disassembly pathway in vitro that may correspond
to sequential steps of synaptic vesicle docking, activation, and fusion.
Cell 1993;75:409 418.
5. Weber T, Zemelman BV, McNew JA, Westermann B, Gmachl M,
Parlati F, Söllner TH, Rothman JE. SNAREpins: minimal machinery for
membrane fusion. Cell 1998;92:759 772.
6. Hanson PI, Heuser JE, Jahn R. Neurotransmitter release four years
of SNARE complexes. Curr Opin Neurobiol 1997;7:310 315.
7. Sutton RB, Fasshauer D, Jahn R, Brunger AT. Crystal structure of
a SNARE complex involved in synaptic exocytosis at 2.4 A resolution.
Nature 1998;395:347 353.
8. Poirier MA, Xiao W, Macosko JC, Chan C, Shin YK, Bennett MK. The
synaptic SNARE complex is a parallel four stranded helical bundle.
Nat Struct Biol 1998;5:765 769.
9. Katz L, Brennwald P. Testing the 3Q:1R ‘‘rule’’: mutational analysis of
the ionic ‘‘zero’’ layer in the yeast exocytic SNARE complex reveals
no requirement for arginine. Mol Biol Cell 2000;11:3849 3858.
10. Fasshauer D, Sutton RB, Brunger AT, Jahn R. Conserved structural
features of the synaptic fusion complex: SNARE proteins reclassi
fied as Q and R SNAREs. Proc Natl Acad Sci U S A 1998;95:
15781 15786.
11. Bock JB, Matern HT, Peden AA, Scheller RH. A genomic perspective
on membrane compartment organization. Nature 2001;409:839 841.
12. Fukuda R, McNew JA, Weber T, Parlati F, Engel T, Nickel W, Rothman
JE, Sollner TH. Functional architecture of an intracellular membrane
t SNARE. Nature 2000;407:198 202.
13. Burri L, Lithgow T. A complete set of SNAREs in yeast. Traffic
2004;5:45 52.
14. Allen RD, Fok AK. Membrane trafficking and processing in Parame
cium. Int Rev Cytol 2000;198:277 318.
15. Plattner H, Kissmehl R. Molecular aspects of membrane trafficking in
Paramecium. Int Rev Cytol 2003;232:185 216.
16. Allen RD, Schroeder CC, Fok AK. Endosomal system of Paramecium:
coated pits to early endosomes. J Cell Sci 1992;101:449 461.
17. Elde NC, Morgan G, Winey M, Sperling L, Turkewitz AP. Elucidation of
clathrin mediated endocytosis in TETRAHYMENA reveals an evolu
tionarily convergent recruitment of dynamin. PLoS Genet 2005;1:e52.
18. Flötenmeyer M, Momayezi M, Plattner H. Immunolabeling analysis of
biosynthetic and degradative pathways of cell surface components
(glycocalyx) in Paramecium cells. Eur J Cell Biol 1999;78:67 77.
19. Vayssié L, Skouri F, Sperling L, Cohen J. Molecular genetics of
regulated secretion in Paramecium. Biochimie 2000;82:269 288.
20. Plattner H, Kissmehl R. Dense core secretory vesicle docking and
exocytotic membrane fusion in Paramecium cells. Biochim Biophys
Acta 2003;1641:183 193.
21. Allen RD. Food vacuole membrane growth with microtubule associ
ated membrane transport in Paramecium. J Cell Biol 1974;63:
904 922.
22. Allen RD, Naitoh Y. Osmoregulation and contractile vacuoles of
protozoa. Int Rev Cytol 2002;215:351 394.
23. Allen RD. The contractile vacuole and its membrane dynamics.
Bioessays 2000;22:1035 1042.
24. Froissard M, Kissmehl R, Dedieu JC, Gulik Krzywicki T, Plattner H,
Cohen J. N ethylmaleimide sensitive factor is required to organize
functional exocytotic microdomains in Paramecium. Genetics 2002;
161:643 650.
25. Kissmehl R, Froissard M, Plattner H, Momayezi M, Cohen J. NSF
regulates membrane traffic along multiple pathways in Paramecium.
J Cell Sci 2002;115:3935 3946.
26. Schilde C, Wassmer T, Mansfeld J, Plattner H, Kissmehl R. A
multigene family encoding R SNAREs in the ciliate Paramecium
tetraurelia. Traffic 2006;7:440 455.
27. Aury JM, Jaillon O, Duret L, Noel B, Jubin C, Porcel BM, Segurens B,
localization, biogenesis of cortical calcium stores and functional
Daubin V, Anthouard V, Aiach N, Arnaiz O, Billaut A, Beisson J, Blanc I,
aspects. Mol Microbiol 2000;37:773 787.
47. Kneen M, Farinas J, Li Y, Verkman AS. Green fluorescent protein as
Bouhouche K, et al. Global trends of whole genome duplications
revealed by the ciliate Paramecium tetraurelia. Nature 2006;444:
171 178.
28. Russell CB, Fraga D, Hinrichsen RD. Extremely short 20 33 nucleo
a noninvasive intracellular pH indicator. Biophys J 1998;74:1591 1599.
48. Galvani A, Sperling L. RNA interference by feeding in Paramecium.
tide introns are the standard length in Paramecium tetraurelia. Nucleic
Trends Genet 2002;18:11 12.
49. Ruiz F, Vayssié L, Klotz C, Sperling L, Madeddu L. Homology depend
Acids Res 1994;22:1221 1225.
29. Sperling L, Dessen P, Zagulski M, Pearlman RE, Migdalski A,
ent gene silencing in Paramecium. Mol Biol Cell 1998;9:931 943.
50. Dacks JB, Doolittle WF. Molecular and phylogenetic characterization
Gromadka R, Froissard M, Keller AM, Cohen J. Random sequencing
of syntaxin genes from parasitic protozoa. Mol Biochem Parasitol
of Paramecium somatic DNA. Eukaryot Cell 2002;1:341 352.
30. Teng FY, Wang Y, Tang BL. The syntaxins. Genome Biol 2001;2:
2004;136:123 136.
51. Uemura T, Ueda T, Ohniwa RL, Nakano A, Takeyasu K, Sato MH.
REVIEWS3012.
31. Salaun C, James DJ, Greaves J, Chamberlain LH. Plasma membrane
Systematic analysis of SNARE molecules in Arabidopsis: dissection of
targeting of exocytic SNARE proteins. Biochim Biophys Acta 2004;
the post Golgi network in plant cells. Cell Struct Funct 2004;29:49 65.
52. Besteiro S, Coombs GH, Mottram JC. The SNARE protein family of
1693:81 89.
32. Misura KM, Bock JB, Gonzalez LC Jr, Scheller RH, Weis WI.
Leishmania major. BMC Genomics 2006;7:250.
53. Dacks JB, Doolittle WF. Novel syntaxin gene sequences from Giardia,
Three dimensional structure of the amino terminal domain of syntaxin
Trypanosoma and algae: implications for the ancient evolution of the
6, a SNAP 25 C homolog. Proc Natl Acad Sci U S A 2002;99:
eukaryotic endomembrane system. J Cell Sci 2002;115:1635 1642.
54. Bennett MK, Garcia Arraras JE, Elferink LA, Peterson K, Fleming AM,
9184 9189.
33. Antonin W, Fasshauer D, Becker S, Jahn R, Schneider TR. Crystal
structure of the endosomal SNARE complex reveals common struc
tural principles of all SNAREs. Nat Struct Biol 2002;9:107 111.
34. Subramaniam VN, Loh E, Horstmann H, Habermann A, Xu Y, Coe J,
Griffiths G, Hong W. Preferential association of syntaxin 8 with the
early endosome. J Cell Sci 2000;113:997 1008.
35. Jahn R, Lang T, Südhof TC. Membrane fusion. Cell 2003;112:519 533.
36. Fernandez I, Ubach J, Dulubova I, Zhang X, Sudhof TC, Rizo J.
Three dimensional structure of an evolutionarily conserved N terminal
domain of syntaxin 1A. Cell 1998;94:841 849.
37. Misura KM, Scheller RH, Weis WI. Self association of the H3 region of
syntaxin 1A. Implications for intermediates in SNARE complex
assembly. J Biol Chem 2001;276:13273 13282.
38. Hauser K, Haynes WJ, Kung C, Plattner H, Kissmehl R. Expression of
the green fluorescent protein in Paramecium tetraurelia. Eur J Cell
Biol 2000;79:144 149.
39. Apodaca G, Cardone MH, Whiteheart SW, DasGupta BR, Mostov KE.
Hazuka CD, Scheller RH. The syntaxin family of vesicular transport
receptors. Cell 1993;74:863 873.
55. Hui N, Nakamura N, Sonnichsen B, Shima DT, Nilsson T, Warren G.
An isoform of the Golgi t SNARE, syntaxin 5, with an endoplasmic
reticulum retrieval signal. Mol Biol Cell 1997;8:1777 1787.
56. Quinones B, Riento K, Olkkonen VM, Hardy S, Bennett MK. Syntaxin
2 splice variants exhibit differential expression patterns, biochemical
properties and subcellular localizations. J Cell Sci 1999;112:
4291 4304.
57. Scales SJ, Yoo BY, Scheller RH. The ionic layer is required for efficient
dissociation of the SNARE complex by alpha SNAP and NSF. Proc
Natl Acad Sci U S A 2001;98:14262 14267.
58. Dulubova I, Yamaguchi T, Wang Y, Sudhof TC, Rizo J. Vam3p
structure reveals conserved and divergent properties of syntaxins.
Nat Struct Biol 2001;8:258 264.
59. Antonin W, Dulubova I, Arac D, Pabst S, Plitzner J, Rizo J, Jahn R. The
N terminal domains of syntaxin 7 and vti1b form three helix bundles
Reconstitution of transcytosis in SLO permeabilized MDCK cells:
that differ in their ability to regulate SNARE complex assembly. J Biol
existence of an NSF dependent fusion mechanism with the apical
Chem 2002;277:36449 36456.
60. Yang B, Steegmaier M., Gonzalez LC Jr, Scheller RH. nSec1 binds
surface of MDCK cells. EMBO J 1996;15:1471 1481.
40. Low SH, Chapin SJ, Weimbs T, Komuves LG, Bennett MK, Mostov
KE. Differential localization of syntaxin isoforms in polarized Madin
a closed conformation of syntaxin1A. J Cell Biol 2000;148:247 252.
61. Schütz D, Zilly F, Lang T, Jahn R, Bruns D. A dual function for Munc 18
Darby canine kidney cells. Mol Biol Cell 1996;7:2007 2018.
41. Newman AP, Shim J, Ferro Novick S. BET1, BOS1, and SEC22 are
in exocytosis of PC12 cells. Eur J Neurosci 2005;21:2419 2432.
62. Tagaya M, Toyonaga S, Takahashi M, Yamamoto A, Fujiwara T,
members of a group of interacting yeast genes required for transport
Akagawa K, Moriyama Y, Mizushima S. Syntaxin 1 (HPC 1) is asso
from the endoplasmic reticulum to the Golgi complex. Mol Cell Biol
ciated with chromaffin granules. J Biol Chem 1995;270:15930 15933.
63. Walch Solimena C, Blasi J, Edelmann L, Chapman ER, von Mollard
1990;10:3405 3414.
42. Lewis MJ, Pelham HR. SNARE mediated retrograde traffic from the
Golgi complex to the endoplasmic reticulum. Cell 1996;85:205 215.
43. Klausner RD, Donaldson JG, Lippincott Schwartz J. Brefeldin A:
insights into the control of membrane traffic and organelle structure.
J Cell Biol 1992;116:1071 1080.
44. Moreau P, Brandizzi F, Hanton S, Chatre L, Melser S, Hawes C,
GF, Jahn R. The t SNAREs syntaxin 1 and SNAP 25 are present on
organelles that participate in synaptic vesicle recycling. J Cell Biol
1995;128:637 645.
64. Band AM, Kuismanen E. Localization of plasma membrane t SNAREs
syntaxin 2 and 3 in intracellular compartments. BMC Cell Biol 2005;
Satiat Jeunemaitre B. The plant ER Golgi interface: a highly structured
6:26.
65. Esteve JC. [Golgi apparatus in ciliates. Ultrastructure, with special
and dynamic membrane complex. J Exp Bot 2007;58:49 64.
45. Ramoino P, Diaspro A, Fato M, Beltrame F, Robello M. Changes in the
reference to Paramecium]. J Protozool 1972;19:609 618.
66. Allen RD. Cytology. In: Görtz HD, editor. Paramecium. Berlin: Springer
endoplasmic reticulum structure of Paramecium primaurelia in rela
Verlag; 1988, pp. 4 40.
67. Rowe T, Dascher C, Bannykh S, Plutner H, Balch WE. Role of
tion to different cellular physiological states. J Photochem Photobiol B
2000;54:35 42.
46. Hauser K, Pavlovic N, Klauke N, Geissinger D, Plattner H. Green
vesicle associated syntaxin 5 in the assembly of pre Golgi intermedi
fluorescent protein tagged sarco(endo)plasmic reticulum Ca2þ
ates. Science 1998;279:696 700.
68. Roy L, Bergeron JJ, Lavoie C, Hendriks R, Gushue J, Fazel A, Pelletier
ATPase overexpression in Paramecium cells: isoforms, subcellular
A, Morre DJ, Subramaniam VN, Hong W, Paiement J. Role of p97 and
541
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
81.
82.
83.
542
syntaxin 5 in the assembly of transitional endoplasmic reticulum.
Mol Biol Cell 2000;11:2529 2542.
Volchuk A, Ravazzola M, Perrelet A, Eng WS, Di Liberto M, Varlamov O,
Fukasawa M, Engel T, Sollner TH, Rothman JE, Orci L. Countercurrent
distribution of two distinct SNARE complexes mediating transport
within the Golgi stack. Mol Biol Cell 2004;15:1506 1518.
Tai G, Lu L, Wang TL, Tang BL, Goud B, Johannes L, Hong W.
Participation of the syntaxin 5/Ykt6/GS28/GS15 SNARE complex in
transport from the early/recycling endosome to the trans Golgi
network. Mol Biol Cell 2004;15:4011 4022.
Rabouille C, Kondo H, Newman R, Hui N, Freemont P, Warren G.
Syntaxin 5 is a common component of the NSF and p97 mediated
reassembly pathways of Golgi cisternae from mitotic Golgi fragments
in vitro. Cell 1998;92:603 610.
Sanderfoot AA, Kovaleva V, Bassham DC, Raikhel NV. Interactions
between syntaxins identify at least five SNARE complexes within the
Golgi/prevacuolar system of the Arabidopsis cell. Mol Biol Cell
2001;12:3733 3743.
Hackam DJ, Rotstein OD, Bennett MK, Klip A, Grinstein S, Manolson
MF. Characterization and subcellular localization of target membrane
soluble NSF attachment protein receptors (t SNAREs) in macro
phages. Syntaxins 2, 3, and 4 are present on phagosomal mem
branes. J Immunol 1996;156:4377 4383.
Gotthardt D, Warnatz HJ, Henschel O, Bruckert F, Schleicher M,
Soldati T. High resolution dissection of phagosome maturation re
veals distinct membrane trafficking phases. Mol Biol Cell 2002;13:
3508 3520.
Tang BL, Hong W. A possible role of di leucine based motifs in
targeting and sorting of the syntaxin family of proteins. FEBS Lett
1999;446:211 212.
Kasai K, Akagawa K. Roles of the cytoplasmic and transmembrane
domains of syntaxins in intracellular localization and trafficking. J Cell
Sci 2001;114:3115 3124.
Watson RT, Pessin JE. Transmembrane domain length determines
intracellular membrane compartment localization of syntaxins 3, 4,
and 5. Am J Physiol Cell Physiol 2001;281:C215 C223.
Sonneborn TM. Paramecium aurelia. In: Kung RC, editor. Handbook of
Genetics. New York: Plenum Press; 1974, pp. 469 594.
Kissmehl R, Sehring IM, Wagner E, Plattner H. Immunolocalization of
actin in Paramecium cells. J Histochem Cytochem 2004;52:
1543 1559.
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W,
Lipman DJ. Gapped BLAST and PSI BLAST: a new generation of
protein database search programs. Nucleic Acid Res 1997;25:
3389 3402.
Bairoch A, Bucher P, Hofmann K. The PROSITE database, its status in
1997. Nucleic Acids Res 1997;25:217 221.
Marchler Bauer A, Anderson JB, Cherukuri PF, DeWeese Scott C,
Geer LY, Gwadz M, He S, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ,
Liebert CA, Liu C, Lu F, Marchler GH, et al. CDD: a Conserved Domain
Database for protein classification. Nucleic Acids Res 2005;33:
D192 D196.
Bateman A, Coin L, Durbin R, Finn RD, Hollich V, Griffiths Jones S,
Khanna A, Marshall M, Moxon S, Sonnhammer EL, Studholme DJ,
Yeats C, Eddy SR. The Pfam protein families database. Nucleic Acids
Res 2004;32:D138 D141.
84. Jones DT. Protein secondary structure prediction based on position
specific scoring matrices. J Mol Biol 1999;292:195 202.
85. Jones DT, Taylor WR, Thornton JM. A model recognition approach to
the prediction of all helical membrane protein structure and topology.
Biochemistry 1994;33:3038 3049.
86. Jones DT. Do transmembrane protein superfolds exist? FEBS Lett
1998;423:281 285.
87. McGuffin LJ, Bryson K, Jones DT. The PSIPRED protein structure
prediction server. Bioinformatics 2000;16:404 405.
88. Kumar S, Tamura K, Nei M. MEGA3: Integrated software for
Molecular Evolutionary Genetics Analysis and sequence alignment.
Brief Bioinform 2004;5:150 163.
89. Godiska R, Aufderheide KJ, Gilley D, Hendrie P, Fitzwater T, Preer LB,
Polisky B, Preer JR Jr. Transformation of Paramecium by microinjec
tion of a cloned serotype gene. Proc Natl Acad Sci U S A 1987;84:
7590 7594.
90. Haynes WJ, Vaillant B, Preston RR, Saimi Y, Kung C. The cloning by
complementation of the pawn A gene in Paramecium. Genetics
1998;149:947 957.
91. Wassmer T, Froissard M, Plattner H, Kissmehl R, Cohen J. The
vacuolar proton ATPase plays a major role in several membrane
bounded organelles in Paramecium. J Cell Sci 2005;118:2813 2825.
92. Sambrook J, Fritch E, Maniatis T. Molecular Cloning: A Laboratory
Manual. Cold Spring Harbor: Cold Spring Harbor Laboratory Press; 1989.
93. Haynes WJ, Ling KY, Saimi Y, Kung C. Induction of antibiotic
resistance in Paramecium tetraurelia by the bacterial gene APH 30 II.
J Eukaryot Microbiol 1995;42:83 91.
94. Dryl S. Effect of adaptation to the environment on chemotaxis of
Paramecium caudatum. Acta Biol Exp 1959;19:83 93.
95. Timmons L, Court DL, Fire A. Ingestion of bacterially expressed
dsRNAs can produce specific and potent genetic interference in
Caenorhabditis elegans. Gene 2001;263:103 112.
96. Pollack S. Mutations affecting the trichocysts in Paramecium aurelia.
I. Morphology and description of the mutants. J Protozool 1974;21:
352 362.
97. Dillon PJ, Rosen CA. Use of polymerase chain reaction for the rapid
construction of synthetic genes. Methods Mol Biol 1993;15:263 s269.
98. Wirsel SGR, Vögele R, Bänninger R, Mendgen KW. Cloning of
b tubulin and succinate dehydrogenase genes from Uromyces fabae
and establishing selection conditions for their use in transformation.
Eur J Plant Pathol 2004;110:767 777.
99. Kissmehl R, Treptau T, Hofer HW, Plattner H. Protein phosphatase
and kinase activities possibly involved in exocytosis regulation in
Paramecium tetraurelia. Biochem J 1996;317:65 76.
100. Lumpert CJ, Kersken H, Plattner H. Cell surface complexes (‘corti
ces’) isolated from Paramecium tetraurelia cells as a model system for
analysing exocytosis in vitro in conjunction with microinjection
studies. Biochem J 1990;269:639 645.
101. Kissmehl R, Huber S, Kottwitz B, Hauser K, Plattner H. Subplasma
lemmal Ca stores in Paramecium tetraurelia. Identification and char
acterisation of a sarco(endo)plasmic reticulum like Ca(2þ) ATPase by
phosphoenzyme intermediate formation and its inhibition by caffeine.
Cell Calcium 1998;24:193 203.
102. Wassmer T, Kissmehl R, Cohen J, Plattner H. Seventeen a subunit
isoforms of Paramecium V ATPase provide high specialization in
localization and function. Mol Biol Cell 2006;17:917 930.