Download Targeting of Proteins to the Outer Envelope Membrane Uses a

The Plant Cell, Vol. 3, 709-717, July 1991 O 1991 American Society of Plant Physiologists
Targeting of Proteins to the Outer Envelope Membrane
Uses a Different Pathway than Transport into
Chloroplasts
Hsou-min Li," Thomas Moore,b and Kenneth Keegstra".'
a
Department of Botany, University of Wisconsin, Madison, Wisconsin 53706
Department of Vegetable Crops, University of California, Davis, California 95616
The chloroplasticenvelope is composed of two membranes, inner and outer, each with a distinct set of polypeptides.
Like proteins in other chloroplastic compartments, most envelope proteins are synthesized in the cytosol and posttranslationally imported into chloroplasts. Considerable knowledge has been obtained concerning protein import
into most chloroplastic compartments. However, very little is known about the biogenesis of envelope membrane
proteins. We isolated a cDNA clone from pea that encodes a 14-kilodalton outer envelope membrane protein. The
precursor form of this protein does not possess a cleavable transit peptide and its import into isolated chloroplasts
does not require either ATP or a thermolysin-sensitive component on the chloroplastic surface. These findings,
together with similar observations made with a spinach chloroplastic outer membrane protein, led us to propose
that proteins destined for the outer membrane of the chloroplastic envelope follow an import pathway distinct from
that followed by proteins destined for other chloroplastic compartments.
INTRODUCTION
Most proteins present in chloroplasts are encoded by the
nuclear genome and synthesized on cytosolic ribosomes
(Chua and Schmidt, 1979). The transport of these cytosolically synthesized proteins to chloroplasts has been
studied extensively. The outlines of this transport process
are well described although the mechanistic details are still
poorly understood. The structural complexity of chloroplasts adds to the challenge of understanding targeting to
this organelle. Chloropiasts consist of three distinct membranes: the inner and outer membranes of the envelope
and the thylakoid membrane. These three membranes in
turn enclose three aqueous spaces: the intermembrane
space of the envelope, the stroma, and the thylakoid
lumen. Thus, cytosolically synthesized proteins not only
must be targeted to chloroplasts but also must be directed
to the proper compartment within chloroplasts.
Most chloroplastic proteins are synthesized as precursor
proteins with N-terminal extensions called transit peptides.
Transit peptides are necessary and sufficient to direct the
import of proteins into chloroplasts. Protein import to the
inside of chloroplasts is initiated by an energy-dependent
binding of precursors to the envelope, followed by an
energy-dependent translocation across the envelope.
Once in the stroma, precursor proteins are either processed to their mature size or further sorted to the thylakoid membrane or the thylakoid lumen (for a review, see
' To whom correspondence should be addressed.
Keegstra, 1989). Targeting of envelope proteins to their
proper membrane locations is not yet well understood.
The chloroplastic envelope is the site where the organelle interacts with other cellular compartments. The envelope not only regulates the transport of metabolites
between the stroma and the cytosol but also mediates the
import of nuclear-encodedchloroplastic proteins into chloroplasts, as described above. The envelope plays a major
role in the biosynthesis of various lipids including galactolipids, the predominant lipids in chloroplastic membranes
(Douce and Joyard, 1990). Therefore, knowledge about
the chloroplastic envelope, especially its protein constituents, is fundamental for understanding the function and
biogenesis of chloroplasts.
Despite the importance of chloroplastic envelope proteins, little is known about the biogenesisof these proteins,
especially at the molecular level. One reason for this is that
most envelope proteins are present in very low quantities
compared to other chloroplastic proteins. Only a few genes
encoding envelope proteins have been isolated. These
include the genes encoding two inner membrane proteins
from spinach chloroplasts: a 37-kD protein (Dreses-Werringloer et al., 1991) and the phosphate translocator, which
is the most abundant protein in the envelope (Flügge et
al., 1989). The import of these two proteins shows characteristics similar to the import of the stromal and the
thylakoid membrane proteins. A homologous gene for the
phosphate translocator was also identified in pea, but in
710
The Plant Cell
this case it was reported to encode the import receptor
for the small subunit of ribulose-1,5-bisphosphate carboxylase (SS), and was localized to the contact sites between
the two membranes of the envelope (Schnell et al., 1990).
Resolution of the controversy regarding the function and
the chloroplastic location of the protein encoded by this
gene will require further work.
Another spinach gene that has been isolated encodes a
6.7-kD outer membrane protein (Salomon et al., 1990).
The import of this protein is, however, very different from
other chloroplastic proteins. The protein is synthesized
without a cleavable transit peptide and its import into
chloroplasts is not ATP dependent. At present it is unclear
whether this distinct import mechanism is unique to this
protein or is a more general feature shared by other
chloroplastic outer membrane proteins. Also, because the
specificity of the insertion process was not demonstrated,
it is possible that the insertion into the chloroplastic outer
membrane occurred because chloroplasts were the only
organelle present in the experimental system.
To understand better the biogenesis of chloroplastic
envelope proteins, an effort was made to obtain cDNA
clones encoding chloroplastic envelope proteins. We report here the isolation of a pea cDNA clone encoding a
chloroplastic outer envelope membrane protein. The import of this protein into chloroplasts was investigated. The
results indicate that the import of this protein possesses
characteristics distinct from those of most chloroplastic
proteins but are in good agreement with what has been
observed with the 6.7-kD outer membrane protein.
RESULTS
Isolation and Characterization of a cDNA Clone Encoding a Chloroplastic Outer Envelope Membrane Protein
Monoclonal antibodies were prepared against total envelope proteins. As shown in Figure 1A, lane 2, one of the
antibodies recognized a 14-kD outer envelope membrane
protein. This antibody was used to screen a Xgt11 cDNA
expression library. A partial-length clone was isolated and
the cDNA insert was used to synthesize nucleic acid
probes to screen another Xgt11 cDNA library. Among the
positive clones, A14kom was chosen for further study
because it contained the largest insert.
The cDNA insert of X14kom was subcloned into the
expression vector pSP65 (Promega), resulting in the plasmid pSP14kom. When the cDNA insert in the plasmid was
subjected to sequential in vitro transcription and translation, it directed the synthesis of a protein that migrated
with an apparent molecular mass of 14 kD when analyzed
by SDS-polyacrylamide gel electrophoresis (PAGE) (Figure
1A, lane 3). This molecular mass is identical to that of the
protein recognized by the monoclonal antibody. Because
A 1
2 3
B
CL HS
.-18.4
9766-1
,-14.3
- 6.2
49-
29-I
14Figure 1. A14kom Represents a Full-Length Clone with Respect
to the Protein It Encodes.
(A) Size comparison between the protein recognized by the
monoclonal antibody and the protein encoded by A14kom. Pea
chloroplastic outer membrane proteins (lane 1) were probed with
a monoclonal antibody prepared against envelope proteins (lane
2). Lane 3, in vitro translation product from the cDNA insert of
A14kom in plasmid pSP14kom. Lane 1 was stained with Amido
Black. Lanes 2 and 3 were run on the same gel and blotted onto
one piece of membrane. The two lanes were then cut apart and
treated for antibody hybridization (lane 2) or fluorography (lane 3)
by incubating the membrane with 20% 2,5-diphenyloxazole in
toluene. Molecular mass markers in kilodaltons are indicated at
left.
(B) Hybrid selection of the mRNA corresponding to the cDNA
insert of A14kom. Pea-leaf poly(A)* RNA was incubated with
linearized plasmid pSP14kom. The hybrid-selected mRNA was
used to program an in vitro wheat germ translation system. CL,
translation product from the cDNA insert of pSP14kom; HS,
translation product from the hybrid-selected mRNA. Samples
were analyzed by SDS-PAGE. A fluorograph of the dried gel is
shown. Molecular mass markers in kilodaltons are indicated at
right.
nuclear-encoded chloroplastic proteins are usually synthesized as higher molecular weight precursors in the cytosol,
we were concerned that the cDNA insert of \14kom may
not encode a full-length precursor protein. To investigate
this possibility, the cDNA insert was used to hybrid-select
its corresponding mRNA from pea-leaf poly (A)+ RNA.
When the selected mRNA was translated in vitro, it directed the synthesis of a protein with a size identical to
Chloroplastic Envelope Protein Targeting
that of the protein translated from the cDNA insert (Figure
1B). This result indicates that the cDNA insert in A14kom
contains the entire protein coding region of the gene.
Figure 2 shows the DNA sequence of the cDNA insert
in X14kom. It contains an open reading frame of 82 amino
acids with a calculated molecular mass of 9.0 kD, even
though the translation products, both from the hybridselected mRNA and from the cDNA insert, migrated with
an apparent molecular mass of 14 kD on an SDS gel
(Figure 1B). No related sequences were found in the
GenBank and EMBL sequence data bases.
Localization of the Protein Encoded by \14kom
To examine whether the protein encoded by X14kom could
be imported into chloroplasts, the in vitro translation product from pSP14kom was incubated with isolated intact
chloroplasts under conditions that normally lead to the
import of Chloroplastic precursor proteins (see Methods).
As shown in Figure 3A, the in vitro translation product
associated with chloroplasts; however, no molecular
711
B
TR C
OM14-
r
S
E
T
TR C
S
E T
-SS
Figure 3. Localization of the Protein Encoded by X14kom
(OM14).
(A) Fractionation of chloroplasts after import of the protein encoded by A14kom. Chloroplasts were incubated with the in vitro
translation product from pSP14kom under standard import conditions. Intact chloroplasts were reisolated and subjected to further fractionation, as described in Methods. TR, in vitro translation
product; C, total chloroplasts after import; S, stroma; E, envelope;
T, thylakoid.
(B) Fractional of chloroplasts after import of prSS. The import and
fractionation conditions were the same as in (A) except the import
reaction was performed on ice instead of room temperature to
obtain enough envelope-bound precursor protein molecules. SS,
small subunit of ribulose-1,5-bisphosphate carboxylase.
GAATTCCAA
1
1
2
ATG GGA AAG GCG AAA GAA GCG GTT GTG GTG
M
G
K
A
K
E
A
V
V
V
GCG GGT GCC CTA GCA TTT GTC TGG CTC GCT
1
A
G
A
L
A
F
V
W
L
A
ATT GAA CTC GCT TTC AAA CCC TTC CTT TCT
1
I
E
L
A
F
K
P
F
L
S
CAG ACC CGT GAC TCC ATC GAC AAA TCC GAC
3
4
5
1
Q
T
R
D
S
I
D
K
S
D
CGA CCC GGG ATC CTG ACG ATG CTC CTC CTC
1
R
P
G
I
L
T
M
L
L
L
CTC CTC CTC CTG AAA CTG ACG CCG GAG ATG
1
L
L
L
L
K
L
T
P
E
M
CCG ACA AAG ACG ACT GAT GAT TTG AGC GCG
6
1
P
T
K
T
T
D
D
L
S
A
GTT GTT ACT ATT CCT TTC TTG CAT TCT GTA
7
1
V
V
T
I
P
F
L
H
S
V
TTT CGT TAA ATTGTTAAGTGAAATAACATTAACTAT
81
F
R
*
GTTCTTTGTTGTGTTTTCTGTTCTGATCTGATTTCTGGAA
TACTGTAATTTTAGGATTAGGATTGAATGCCAGGTTGTTC
ACTTCATACGTTGGACAATTGGTTTGTTAATTTGGTGTTT
GTCTCTTTAGCTATTGCAAATGCAATCGTGTTGTGAAAAT
AACAAAGCTTCTGAATCAAAAAAAAAAAAAGGAATTC
Figure 2. Nucleotide Sequence of the cDNA Insert in X14kom
and the Deduced Amino Acid Sequence.
Amino acid numbers are indicated at left. The standard one-letter
code for amino acids is used.
weight shift was observed after import. This result suggested that the protein encoded by X14kom was synthesized as a precursor protein without a cleavable transit
peptide.
Fractionation studies of the chloroplasts after import of
the translation product from pSP14kom were performed
to obtain information on the suborganellar localization of
the imported protein. A parallel experiment was performed
with the precursor to SS (prSS) because the imported,
mature-size SS can serve as a marker for the stromal
fraction and the prSS bound on the surface of chloroplasts
can serve as a marker for the envelope fraction. As shown
in Figure 3B, prSS associated mostly with the envelope
fraction, with a small portion associated with the thylakoid
fraction. Some association with thylakoids was expected
because the thylakoid fraction is always contaminated with
envelope membranes (Cline and Keegstra, 1983). The
same fractionation pattern as prSS was observed with the
protein encoded by X14kom, indicating that this protein
was directed to the Chloroplastic envelope during import
into chloroplasts. Furthermore, the result shown in Figure
4, lane 2, demonstrated that the protein was thermolysin
sensitive after import, indicating that it was located in the
outer membrane. Thermolysin at this concentration has
been shown to be unable to penetrate the outer membrane
(Cline et al., 1984). This protein was thus named OM14
(for outer membrane 14-kD protein).
712
The Plant Cell
Fluorography
1
2
Immunoblot
3
4
5
6
— 14.3
OM14
et al., 1985). Monospecific antibodies that reacted with
OM14 were eluted with a low-pH solution. When analyzed
on immunoblots, this eluted antibody recognized a single
protein in Chloroplasts (Figure 4, lane 3). This protein was
located in the outer membrane and had the same molecular
weight and the same thermolysin sensitivity as OM14
(Figure 4, lanes 4 and 5). When this antibody preparation
was used to probe cellular fractions enriched in mitochondria or microsomes, no cross-reactive protein was detected (data not shown). The same results were also
obtained with the monoclonal antibody (data not shown).
In addition, under the same condition that led to the import
of OM14 into Chloroplasts, OM14 could not be imported
into pea mitochondria (data not shown). From these studies, we concluded that OM14 is an authentic chloroplastic
protein.
Membrane Topology of OM14
protease
—
-f
—
+
Figure 4. Identification of the Authentic OM14 in Chloroplasts.
Chloroplasts after import of OM14 (lane 1) were treated with
thermolysin (lane 2), revealing that the imported OM14 was thermolysin sensitive. A protein with this same property and the same
molecular mass as OM14 was identified in Chloroplasts (lanes 3
to 5, see below). Lane 6 shows outer membrane proteins probed
with a polyclonal antibody against total outer membrane proteins.
This polyclonal antibody was incubated with the fusion protein
containing OM14, expressed from M 4kom, to affinity purify monospecific antibody reactive with OM14. The purified monospecific
antibody was then used to probe total chloroplastic protein (lane
3), Chloroplasts treated with thermolysin (lane 4), and outer membrane proteins (lane 5). Lanes 1 to 5 were run on the same gel
and blotted onto one piece of membrane. The membrane was
then cut into two parts and treated for fluorography or immunoblot
analysis as indicated. Molecular mass markers in kilodaltons are
indicated at right. Thermolysin treatment of samples are indicated
at bottom.
Identification of the Authentic OM14 in Chloroplasts
It is not surprising that a chloroplastic outer membrane
protein is susceptible to thermolysin digestion. However,
a hydrophobic protein that nonspecifically associated with
the surface of Chloroplasts might exhibit the same property. To verify that OM14 is a genuine chloroplastic protein,
we tested the ability of a polyclonal antibody, raised against
total outer membrane protein (Figure 4, lane 6), to react
with OM14. If OM14 could be recognized by this antibody,
it would provide independent evidence that OM14 is an
authentic chloroplastic outer membrane protein. The polyclonal antibody preparation was incubated with a fusion
protein containing OM14 that was immobilized on nitrocellulose membranes after expression of X14kom (Johnson
Imported OM14 could not be removed from the outer
membrane by alkaline or high salt extraction (data not
shown), suggesting that OM14 was an integral membrane
protein. Figure 5A shows the hydrophobicity analysis (Kyte
and Doolittle, 1982) of the deduced OM14 polypeptide
sequence. It predicts that the protein spans the outer
membrane at least twice (using the criterion that the hydrophobicity value exceeds 1.58 for at least 1 residue;
Jahnig, 1990) with a major hydrophilic domain connecting
two membrane spanning domains. The conformation of
the C-terminal end of the polypeptide is not clear; although
it is hydrophobic, its hydrophobicity and its length are
probably not sufficient for this region of the polypeptide to
span the membrane another time. To investigate the topology of OM14 within the membrane, i.e., to determine
whether the hydrophilic domain faces the cytosol or the
intermembrane space, we employed the protease chymotrypsin. Chymotrypsin cleaves peptide bonds predominantly after tyrosine, tryptophan, or phenylalanine residues. In OM14 polypeptide, two phenylalanines are located
in the hydrophilic domain with other target residues of
Chymotrypsin all located in the hydrophobic regions, i.e.,
possibly buried in the membrane (Figure 5A). If the hydrophilic domain is located on the cytosolic site of the outer
membrane so that the two target sites in the hydrophilic
domain are exposed on the surface of Chloroplasts, the
protein should be susceptible to Chymotrypsin digestion.
On the other hand, if the hydrophilic domain is located in
the intermembrane space, the protein should be relatively
Chymotrypsin resistant.
Digestion of translation products with Chymotrypsin revealed that the precursor form of OM14 was sensitive to
Chymotrypsin before import (Figure 5B, lane 2). After being
inserted into the outer membrane, OM14 was resistant to
Chymotrypsin digestion (Figure 5B, lane 4). The protein
Chloroplastic Envelope Protein Targeting
the outer membrane at least twice with the connecting
hydrophilic domain exposed to the intermembrane space.
However, because Chymotrypsin does sometimes have a
broader specificity, the possibility that OM14 has some
other membrane topology cannot be excluded.
A
+3-
713
iW
Hydrophobic 0
Hydrophilic Import Characteristics of OM14
-3|
20
I
I
I
I
I
I
I
I
I
40
I
I
60
I
I
I
I
80
Amino Acid Number
B
Chymotrypsin
Sonication
Thermolysin
— +
— —
— —
1 2
— +
— —
-—
3 4
CH
— + —
- — +
— — —
5 6 7
+ —
+ —
- +
8 9
OM
Figures. Membrane Topology of OM14.
(A) Hydrophobicity analysis of the deduced amino acid sequence
of OM14. The analysis was carried out using the method of Kyte
and Doolittle (1982) with a window of 19 residues as suggested
by Jahnig (1990). Positions of Chymotrypsin target sites in the
polypeptide are indicated. F, phenylalanine; W, tryptophan.
(B) Chymotrypsin sensitivity of OM14 under various conditions.
OM14 from the in vitro translation mixture (TR), chloroplasts after
import of OM14 (CH), or isolated outer membrane vesicles from
chloroplasts after the import reactions (OM) were treated with
Chymotrypsin, thermolysin, and/or sonication, as indicated on the
top of the figure.
was Chymotrypsin resistant even in outer membrane vesicles isolated from chloroplasts of import reactions (Figure
5B, lane 6), indicating that most of the isolated outer
membrane vesicles possessed a right-side-out orientation.
The resistance of the protein to Chymotrypsin was not due
to the inaccessibility of the protein in the isolated membrane vesicles because OM14 was still sensitive to thermolysin (Figure 5B, lane 9). Furthermore, the resistance to
Chymotrypsin was lost when the protease had access to
both sides of the outer membrane, i.e., after the membrane
vesicles were sonicated in the presence of the protease
(Figure 5B, lane 8). This result indicated that imported
OM14 in intact chloroplasts was Chymotrypsin resistant
because the protease target sites were located in the
intermembrane space and thus protected from the protease. The same results were obtained with the authentic
OM14 in chloroplasts by using immunoblot analysis (data
not shown). Accordingly, we propose that OM14 spans
Time course studies of the import of OM14 into chloroplasts revealed that the import process was time and
temperature dependent. The data in Figure 6 demonstrated that, at 25°C, the initial rate of import was rapid
and gradually reached a plateau. This process was influenced strongly by temperature because, at 4°C, not only
did import proceed at a lower rate but much less protein
was imported. The reason for this drastic change of import
by low temperature is unknown. It could be an effect of
the temperature on membrane fluidity, on the import competence of the protein, or on the association(s) of other
required protein(s) with OM14.
The energy requirement for the import of OM14 was
also investigated. The in vitro translation product was gel
25° C
400-
0
0
5
10
15
20
I
25
I
30
Time (minutes)
Figure 6. Import Time Course of OM14.
Import reactions were conducted at either 25°C or 4°C. At each
time point, 60 t^L of the reaction mixture was removed and the
reaction terminated as described (Theg et al., 1989). Samples
were analyzed by SDS-PAGE. Quantitation of samples in the gel
is shown.
714
The Plant Cell
filtered to remove most of the ATP in the translation
mixture (Olsen et al., 1989).As a control, prSS synthesized
in vitro and the translation mixture treated the same way
were tested in parallel experiments. No translocation of
prSS was observed when there was no ATP in the import
reaction (data not shown; Olsen et al., 1989). However, as
shown in Figure 7, the amount of OM14 imported was
essentially the same regardless of the amount of ATP
provided. Nigericin and valinomycin also had no effect on
the import of OM14. We concluded, therefore, that neither
ATP nor a proton-motive force was required for the import
of OM14.
It has been shown for several chloroplastic precursor
proteins that protein import into chloroplasts requires
some proteinaceous component(s) on the chloroplastic
surface. When chloroplasts are pretreated with thermolysin, the amount of protein imported is reduced greatly
(Cline et al., 1985). However, the same treatment had
almost no effect on the import of OM14 (data not shown).
Combining this result with the observation of an ATPindependent import, we concluded that the “import” of
OMI 4 to the chloroplastic outer membrane is very different
from the “import” of proteins into the inside of chloroplasts.
The former probably represents the integration of a protein
into a membrane without any translocation event. It is thus
more proper to refer the association of OM14 with chloroplasts as “insertion” instead of “import.”
DISCUSSION
Severa1 lines of evidence demonstrated that OM14 is a
chloroplastic outer membrane protein. A monospecific antibody preparation, affinity purified by reaction with OM14
derived from the cloned gene, recognized a protein in the
chloroplastic outer membrane that had the same molecular
mass, same thermolysin sensitivity, and same membrane
topology as OMI 4. In addition, proteins with cross-reactivity to this antibody could not be detected in other cell
fractions. These observations demonstrated that OM14 is
an authentic chloroplastic protein in vivo.
Protein insertion into the chloroplastic outer membrane
has now been studied with two proteins, OM14 of pea
chloroplasts reported here and a 6.7-kD protein of spinach
chloroplasts (Salomon et al., 1990). 60th proteins are
synthesized without cleavable transit peptides and, in both
cases, insertion into the outer membrane does not require
ATP. For both proteins, thermolysin pretreatment of chloroplasts has no effect on their insertion. Because of these
characteristics, it is important to demonstrate that the
insertion is specific because it is possible that such small
hydrophobic proteins might insert into any membrane.
Consequently, we demonstrated that in vitro synthesized
OM14 could be inserted into the outer envelope membrane
O
100
200
300
1OOO
Nig
Val
[ATP] (pM) & lonophores
Figure 7. ATP and Proton-Motive Force Requirements for the
lmport of OM14.
lrnport reactions for the ATP requirementexperiment were carried
out in the dark with the indicated amount of ATP added to each
reaction mixture. The ionophore experiment was carried out in
the light with each ionophore present at 2 wM. lmport reactions
were carried out for 6 min. Reisolated chloroplasts after import
were treated further with chymotrypsin in an attempt to remove
noninserted protein molecules. Quantitation of samples analyzed
by SDS-PAGE is shown. [ATP], ATP concentrations; Nig, nigericin; Val, valinomycin.
of isolated chloroplasts but not mitochondria, indicating
that the in vitro import of OM14 faithfully reflects the
organelle specificity of protein targeting in vivo.
The insertion of OM14 was not inhibited by synthetic
peptide analogues of the transit peptide of prSS (data not
shown). These peptides were shown to inhibit the binding
and translocation of several precursors destined for other
chloroplastic compartments (Perry et al., 1991). These
observations provide additional evidence that OMI 4 used
a different import receptor from that used by the majority
of chloroplastic proteins. Alternatively, it is possible that
OM14 interacted directly with the lipid components of the
outer membrane so that it did not utilize a proteinaceous
receptor.
Two different mechanisms have been described for the
insertion of proteins into mitochondrial outer membranes.
Porin of Neurospora crassa and monoamine oxidase B of
beef heart mitochondria require ATP and a trypsin-sensitive component on the mitochondrial surface for their
insertion (Zhuang et al., 1988; Pfaller et al., 1990). On the
other hand, insertion of porin into the Saccharomyces
cerevisiae mitochondrial outer membrane does not require
ATP, and a trypsin pretreatment of the mitochondria does
not inhibit this insertion (Gasser and Schatz, 1983). In
addition, cytochrome c of mitochondria, a protein present
in the intermembrane space of the envelope, also does not
require ATP or a protein on the mitochondrial surface for
Chloroplastic Envelope Protein Targeting
its translocation across the outer membrane (Nicholson et
al., 1988). It is unclear whether these differences represent
variations on a single pathway to the outer membrane or
whether they reflect two different pathways.
The specificity of OM14 insertion to the chloroplastic
outer membrane was shown by its exclusive presence in
the chloroplastic outer membrane in vivo and the failure to
insert into mitochondrial outer membrane in vitro. Because
OM14 does not possess a cleavable transit peptide, it is
uncertain where the targeting information that mediates
this specificity resides. A similar question arises with mitochondrial outer membrane proteins, which also lack
cleavable presequences(Hartl et al., 1989). This question
has been addressed with a 70-kD mitochondrial outer
membrane protein, where the first 12 amino acid residues
function as a matrix targeting sequence and the subsequent hydrophobic residues function as a “stop-transfer”
signal that anchors the protein in the outer membrane
(Nakai et ai., 1989). The situation with OM14 is more
complex because it is predicted to span the membrane at
least two times. Hypotheses for OM14 insertion can be
derived by drawing analogies with integral membrane proteins of the endoplasmic reticulum (Blobel, 1980; Lipp et
al., 1989). The first membrane-spanningdomain of OM14
may function as a signal-anchor sequence that initiates the
insertion of the protein into the chloroplastic outer membrane. The second membrane-spanningdomain may then
function as a stop-transfer sequence resulting in an Ni,-Ci,
topology of the protein (“in” refers to the cytosol). This
prediction is also in agreement with the “positive inside”
hypothesis (von Heijne and Gavel, 1988) because the
residues on the amino-terminal side of the first membranespanning domain has a net positive charge. Alternatively,
the two membrane-spanning domains could pair together
and spontaneously insert into the outer membrane, as
described by the “helical hairpin hypothesis” (Engelman
and Steitz, 1981).
Regardless of the mechanistic details, the current data
support the conclusion that chloroplastic outer membrane
proteins utilize an import pathway that is distinct from that
of protein transport to other chloroplastic compartments.
Outer membrane protein targeting involves a direct insertion from the cytosol with no need of an extra peptide
extension and its subsequent removal by way of processing. This feature is shared with proteins destined for the
outer membrane of mitochondria and seems to be a general feature of protein targeting to the outer membrane of
each organelle. The lack of an ATP requirement and the
apparent independence of a proteinaceous receptor that
have been observed with OM14 and E6.7 have also been
observed with some, but not all, mitochondrial outer membrane proteins. It remains to be determined whether these
features are general for all chloroplastic outer membrane
proteins.
715
METHODS
Antibody Preparations, cDNA Cloning, and Sequencing
For monoclonalantibody preparation,total envelope proteinswere
used to immunize 8-week-old Balb/c mice according to the
procedure described (Stahliet al., 1983). The spleen cells from an
immunized mouse were fused with NS-1 mouse myeloma cells,
an 8-azaguanine resistant, nonsecreting cell line. Supernatants
from cultured hybrid cells were assayed using ELISA, as described
(Voller et al., 1980), with envelope proteins as immobilized antigens. Positive cell lines were expanded and rescreened by ELISA
against both envelope and stromal proteins. Selected lines were
cloned by limiting dilution, and frozen. Those lines that reacted
only with envelope but not stromal proteins were analyzed further
on immunoblots. The polyclonal antibody against purified outer
membrane proteins was prepared as described in Marshall et al.
(1990). Monospecific antibody affinity purified by OM14 was prepared as described (Johnson et al., 1985).
cDNA libraries were made from pea-leaf poly(A)+RNA and were
gifts of Dr. S. Gantt (Gantt and Key, 1986) and Dr. G. Coruzzi
(Tingey et al., 1987).The screening process using antibodies was
performed as described (Huynh et al., 1985). Synthesis of nucleic
acid probes by in vitro transcription of a partia1 cDNA clone and
the screening process using these probes were performed as
described (Wahl et al., 1987).
For DNA sequencing, the cDNA insert from X14kom was subcloned in both orientations into the Phagescript vector (Stratagene). A series of nested deletions was made using exonuclease
111 and S1 nuclease according to the procedure of Henikoff (1987)
with modifications described by Greenler et al. (1989). Singlestranded DNA was isolated and sequenced using the dideoxy
chain termination method (Sanger et al., 1980) with the Klenow
fragment of DNA polymerase I and LP~*P-~ATP.
Overlapping
clones from the nested deletions were chosen by running
T-tracking reactions before the full sequencing. Both strands of
the cDNA were sequenced in their entirety. Sequence data analysis was carried out using the UWGCG software (Devereux et al.,
1984).
Hybrid selection of mRNA was performed as described (Maniatis et al., 1982). Pea-leaf poly(A)+ RNA was prepared as described (Cline et al., 1985).
Precursor Protein Synthesis and lmport into lsolated
Chloroplasts
The cDNA insert from X14kom was subcloned into the pSP65
vector (Promega), resulting in the plasmid pSPl4kom. Tritiumlabeled precursor proteins were synthesized from pSP14kom by
using in vitro transcription/translation systems as described
(Smeekenset al., 1986).Where indicated, ATP was removed from
the translation mixture by filtering the translation mixture through
a Sephadex G-25 column after the translation reactions (Olsen et
al., 1989).
lntact chloroplasts were isolated from 10- to 15-day old pea
(fisum sarivum cv Perfection) seedlings as described (Cline,
1986). lmport experiments were performed in import buffer (330
mM sorbitol/50 mM Hepes.KOH, pH 8.0) at room temperature
716
The Plant Cell
as described (Li et al., 1990) except that the amount of precursor
proteins was reduced to 5 x 105dpm for OM14 and 1 x 10' dpm
for prSS. After import, intact chloroplasts were reisolated by
centrifugation through a 40% Percoll cushion. Recovered chloroplasts were subjected to further fractionation or protease treatments. The experiment shown in Figure 6 was performed using
the silicone oil/perchloric acid method as described (Theg et al.,
1989) except that the oil volume was increased from 1O0 pL to
160 pL. Thermolysin pretreatment of chloroplasts was done as
described by Cline et al. (1985).
of monoclonal antibodies, Dr. Jerry Marshall for the polyclonal
antibody against outer membrane proteins, and Jim Sloan for
advice on DNA sequencing. This work was supported in part by
a grant to K.K. from the Office of Basic Energy Sciences at the
Department of Energy. The nucleotide sequence data reported in
this paper will appear in the GenBank Nucleotide Sequence
Database under the accession number M69105.
Received April 16, 1991; accepted May 15, 1991.
Post-lmport Treatments of Chloroplasts
For fractionation of chloroplasts, reisolated intact chloroplasts
from a 450-pL import reaction were hypotonically lysed in 450 pL
of 10 mM Tris.HCI, pH 7.5/2 mM EDTA (TE) by incubating on ice
for 1O min. Lysed chloroplasts were loaded onto a sucrose step
gradient with 1.2 mL of 1.2 M sucrose, 1.5 mL of 1 M sucrose,
and 1.5 mL of 0.46 M sucrose, and centrifuged in a Beckman SW
50.1 rotor at 47,000 rpm for 1 hr. Stromal, envelope(a mixture of
inner and outer membranes), and thylakoid fractions were retrieved from the supernatant, the 0.46 M/1 M sucrose interface,
and the pellet, respectively. Proteins in the stromal fraction were
concentratedby acetone precipitation. The envelopefraction was
diluted with TE buffer and pelleted by centrifugation in a Beckman
JA-20 rotor at 20,000 rpm for 45 min. The thylakoid fraction was
washed with TE buffer and pelleted by centrifugation in a microcentrifuge at 7,500 rpm for 5 min. A similar procedure was used
to isolate outer membrane vesicles except that the chloroplasts
were lysed hypertonically in 0.6 M sucrose by one cycle of freezing
and thawing (Keegstra and Yousif, 1986) and the sucrose step
gradient was made with 1.8 mL of 1 M sucrose, 1.6 mL of 0.8 M
sucrose, and 1.3 mL of 0.46 M sucrose. The outer membrane
fraction was retrieved from the 0.46 M/0.8 M sucrose interface.
All sucrose solutions were made in TE buffer.
Thermolysin treatment of chloroplasts or outer membrane vesicles was performed as described (Smeekens et al., 1986). Chymotrypsin treatment of chloroplasts or outer membrane vesicles
was performed in import buffer containing 10 mM CaCI2and 30
pg/mL tosyl-L-lysine chloromethyl ketone-treated chymotrypsin.
The reaction was incubated at room temperature for 30 min and
the digestion was terminated by adding phenylmethanesulfonyl
fluoride to 1 mM. Sonication of outer membrane vesicles was
done using a tip sonicator with six 2.5-sec bursts at 25 to 30
Watts.
All samples were analyzed by SDS-PAGE with buffer systems
described by Laemmli (1970) and a 10% to 15% polyacrylamide
gradient. After electrophoresis, gels were either fluorographed
and exposed to x-ray films, or prepared for immunoblots. Immunoblots were carried out with Immobilon-P membrane (Millipore,
Bedford, MA) and alkaline phosphatase-conjugated secondary
antibodies as described (Marshall et al., 1990). Quantitation of
each radiolabeled protein species in the gel was done by extracting proteins from gel slices as described (Olsen et al., 1989).
ACKNOWLEDGMENTS
We thank Dr. Stephen Gantt and Dr. Gloria Coruzzi for the
generous gifts of cDNA libraries, Beth Hammer for the preparation
REFERENCES
Blobel, G. (1980). Intracellular protein topogenesis. Proc. Natl.
Acad. Sci. USA 77,1469-1500.
Chua, N.-H., and Schmidt, G.W. (1979). Transport of proteins
into mitochondria and chloroplasts. J. Cell Biol. 81, 461-483.
Cline, K. (1986). lmport of proteins into chloroplasts: Membrane
'
integration of a thylakoid precursor protein reconstituted in
chloroplast lysates. J. Biol. Chem. 261, 14804-1481 O.
Cline, K., and Keegstra, K. (1983). Galactosyltransferases involved in galactolipid biosynthesis are located in the outer
membrane of pea chloroplast envelopes. Plant Physiol. 71,
366-372.
Cline, K., Werner-Washburne, M., Andrews, J., and Keegstra,
K. (1984). Thermolysin is a suitable protease for probing the
surface of intact pea chloroplasts. Plant Physiol. 75, 675-678.
Cline, K., Werner-Washburne, M., Lubben, T.H., and Keegstra,
K. (1985). Precursors to two nuclear-encodedchloroplast pro-
teins bind to the outer envelope membrane before being imported into chloroplasts. J. Biol. Chem. 260, 3691-3696.
Devereux, J., Haeberli, P., and Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucl.
Acids. Res. 12, 387-395.
Douce, R., and Joyard, J. (1990). Biochemistry and function of
the plastid envelope. Annu. Rev. Cell Biol. 6, 173-216.
Dreses-Werringloer, U., Fischer, K., Wachter, E., Link, T.A.,
and Flügge, U.4. (1991). cDNA sequence and deduced amino
acid sequence of the precursor of the 37-kDa inner envelope
membrane polypeptide from spinach chloroplasts: Its transit
peptide contains an amphiphilic a-helix as the only detectable
structural element. Eur. J. Biochem. 195, 361-368.
Engelman, D. M., and Steitz, T. A. (1981). The spontaneous
insertion of proteins into and across membranes: The helical
hairpin hypothesis. Cell 23,411-422.
Flügge, U . 4 , Fischer, K., Gross, A., Sebald, W., Lottspeich, F.,
and Eckerskorn, C. (1989). The triose phosphate-3-phosphoglycerate-phosphate translocator from spinach chloroplasts:
Nucleotide sequence of a full length cDNA clone and import of
the in vitro synthesized precursor protein into chloroplasts.
EM60 J. 8,39-46.
Gantt, J.S., and Key, J.L. (1986). lsolation of nuclear encoded
plastid ribosomal protein cDNAs. MOI. Gen. Genet. 202,
186-1 93.
Chloroplastic Envelope Protein Targeting
Gasser, S.M., and Schatz, G. (1983). lmport of protein into
mitochondria: In vitro studies on the biogenesis of the outer
membrane. J. Biol. Chem. 258, 3427-3430.
Greenler, J.M., Sloan, J.S., Schwartz, B.W., and Becker, W.M.
(1989). Isolation, characterization and sequence analysis of a
full-length cDNA clone encoding NADH-dependent hydroxypyruvate reductase from cucumber. Plant MOI.Biol. 13, 139-1 50.
Hartl, F., Pfanner, N., Nicholson, D.W., and Neupert, W. (1989).
Mitochondrial protein import. Biochim. Biophys. Acta 988,
1-45.
Henikoff, S. (1987). Unidirectionaldigestion with Exonuclease 111
in DNA sequence analysis. Methods Enzymol. 155, 156-165.
Huynh, T.V., Young, R.A., and Davis, R.W. (1985). Constructing
and screening cDNA libraries in XgtlO and Xgtll. In DNA
Cloning: A Practical Approach, Vol. 1, D.M. Glover, ed (Washington, DC: IRL Press), pp. 49-78.
Jahnig, F. (1990). Structure predictions of membrane proteins
are not that bad. Trends Biochem. Sci. 15, 93-95.
Johnson, L.M., Snyder, M., Chang, L.M.S., Davis, R.W., and
Campbell, J.L. (1985). lsolation of the gene encoding yeast
DNA polymerase I. Cell 43, 369-377.
Keegstra, K. (1989). Transport and routing of proteins into chloroplasts. Cell 56, 247-253.
Keegstra, K., and Yousif, A.E. (1986). lsolation and characterization of chloroplast envelope membranes. Methods Enzymol.
118,173-182.
Kyte, J., and Doolittle, R.F. (1982). A simple method for displaying
the hydropathic character of a protein. J. MOI. Biol. 157,
105-1 32.
Laemmli, U.K. (1970). Cleavage of structural protein during the
assembly of the head of bacteriophage T4. Nature 227,
680-685.
Li, H., Theg, S.M., Bauerle, C.M., and Keegstra, K. (1990).
Metal-ion-center assembly of ferredoxin and plastocyanin
in isolated chloroplasts. Proc. Natl. Acad. Sci. USA 87,
6748-6752.
Lipp, J., Flint, N., Haeuptl, M.-T., and Dobberstein, B. (1989).
Structural requirements for membrane assembly of proteins
spanning the membrane severa1 times. J. Cell Biol. 109,
2013-2022.
Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982). Hybridization selection using DNA bound to nitrocellulose. In Molecular
Cloning: A Laboratory Manual (Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory),pp. 330-333.
Marshall, J.S., DeRocher, A.E., Keegstra, K., and Vierling, E.
(1990). ldentificationof heat shock protein hsp70 homologues
in chloroplasts. Proc. Natl. Acad. Sci. USA 87, 374-378.
Nakai, M., Hase, T., and Matsubara, H. (1989). Precise determination of the mitochondrial import signal contained in a 70
717
kDa protein of yeast mitochondrial outer membrane. J.
Biochem. 105,513-519.
Nicholson, D.W., Hergersberg, C., and Neupert, W. (1988). Role
of cytochrome c heme lyase in the import of cytochrome c into
mitochondria. J. Biol. Chem. 263, 19034-19042.
Olsen, L.J., Theg, S.M., Selman, B.R., and Keegstra, K. (1989).
ATP is required for the binding of precursor proteins to chloroplasts. J. Biol. Chem. 264, 6724-6729.
Perry, S.E., Buvinger, W.E., Bennett, J., and Keegstra, K.
(1991). Synthetic analogues of a transit peptide inhibit binding
or translocation of chloroplastic precursor proteins. J. Biol.
Chem. 266, in press.
Pfaller, R., Kleene, R., and Neupert, W. (1990). Biogenesis of
mitochondrial porin: The import pathway. Experientia 46,
153-1 61.
Salomon, M., Fischer, K., Flügge, U.4, and Soll, J. (1990).
Sequence analysis and protein import studies of an outer chloroplast envelope polypeptide. Proc. Natl. Acad. Sci. USA 87,
5778-5782.
Sanger, F., Coulson, R., Barrell, B.G., Smith, A.J.H., and Roe,
B.A. (1980). Cloning in single-stranded bacteriophageas an aid
to rapid DNA sequencing. J. MOI.Biol. 143, 161-1 78.
Schnell, D.J., Blobel, G., and Pain, D. (1990). The chloroplast
import receptor is an integral membrane protein of chloroplast
envelope contact sites. J. Cell Biol. 111, 1825-1838.
Smeekens, S., Bauerle, C., Hageman, J., Keegstra, K., and
Weisbeek, P. (1986). The role of the transit peptide in the
routing of precursors toward different chloroplast compartments. Cell46, 365-375.
Stahli, C., Staehelin, T., and Miggiano, V. (1983). Spleen cell
analysis and optimal immunization for high-frequency production of specific hybridomas. Methods Enzymol. 92, 26-36.
Theg, S.M., Bauerle, C., Olsen, L.J., Selman, B.R., and Keegstra, K. (1989). Interna1ATP is the only energy requirement for
the translocation of precursor proteins across chloroplastic
membranes. J. Biol. Chem. 264,6730-6736.
Tingey, S.V., Walker, E.L., and Coruzzi, G.M. (1987). Glutamine
synthetase genes of pea encode distinct polypeptides which
are differentially expressed in leaves, roots and nodules. EM60
J. 6, 1-9.
Voller, A., Bidwell, D., and Bartlett, A. (1980). Enzyme-linked
immunosorbent assay. In Manual of Clinical Immunology, N.R.
Rose and H. Friedman, eds (Washington,DC: American Society
of Microbiology), pp. 359-371.
von Heijne, G., and Gavel, Y. (1988).Topogenic signals in integral
membrane proteins. Eur. J. Biochem. 174, 671-678.
Wahl, G.M., Meinkoth, J.L., and Kimmel, A.R. (1987). Northern
and Southern blots. Methods Enzymol. 152, 572-587.
Zhuang, Z.,Hogan, M., and McCauley, R. (1988). The in vitro
insertion of monoamine oxidase B into mitochondrial outer
membranes. FEBS Lett. 238, 185-1 90.
Targeting of proteins to the outer envelope membrane uses a different pathway than transport
into chloroplasts.
H M Li, T Moore and K Keegstra
Plant Cell 1991;3;709-717
DOI 10.1105/tpc.3.7.709
This information is current as of June 18, 2017
Permissions
https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw153229
8X
eTOCs
Sign up for eTOCs at:
http://www.plantcell.org/cgi/alerts/ctmain
CiteTrack Alerts
Sign up for CiteTrack Alerts at:
http://www.plantcell.org/cgi/alerts/ctmain
Subscription Information
Subscription Information for The Plant Cell and Plant Physiology is available at:
http://www.aspb.org/publications/subscriptions.cfm
© American Society of Plant Biologists
ADVANCING THE SCIENCE OF PLANT BIOLOGY