* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Class11 POGIL Translation Full Win17 KEY v1
Western blot wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Lipid signaling wikipedia , lookup
Gene regulatory network wikipedia , lookup
Paracrine signalling wikipedia , lookup
Peptide synthesis wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Signal transduction wikipedia , lookup
Evolution of metal ions in biological systems wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Polyadenylation wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Point mutation wikipedia , lookup
Gene expression wikipedia , lookup
Protein structure prediction wikipedia , lookup
Metalloprotein wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Proteolysis wikipedia , lookup
Messenger RNA wikipedia , lookup
Biochemistry wikipedia , lookup
Genetic code wikipedia , lookup
Epitranscriptome wikipedia , lookup
POGIL2 – Translation
KEY
(Developed by M. Schivell)
MODEL 1:
= "codon"
= "anticodon"
Critical Thinking Questions
7. a. How many nucleotides are there in a codon? 3 in an anticodon? 3
b. Do codons overlap? No
c. Which molecule contains codons? mRNA Which contains anticodons? tRNA
d. How many amino acids does each tRNA carry? 1
8. a. Define the term "codon":
The three bases on mRNA that bind to the anticodon on a tRNA
b. Define the term "anticodon":
The mRNA binding segment of the tRNA that is 3 bases long
9. Translation ALWAYS begins with a tRNA carrying the amino acid Met.
From the picture above, what is the sequence of the "Start Codon"?
Label with 5' and 3'. 5' AUG 3'
10. In which direction must the ribosome move ("translocate") along the mRNA?
Circle one: From 5' to 3'
or
from 3' to 5'?
1
POGIL2 – Translation
KEY
(Developed by M. Schivell)
MODEL 2:
Initiation of translation (from Freeman, 4e)
EPA
11. a. The ribosome contains a small segment of RNA that binds loosely to the ribosome
binding site (RBS) in the mRNA. Complementary sequence in the ribosome is not exact, but is
a pyrimidine-rich region. Circle the likely RBS in this mRNA.
a. Is the RBS closer to the 5' or 3' end of the mRNA? 5’
b. Which are more common in the RBS binding part of the mRNA, pyrimidines or purines?
c. What types of bonds hold the mRNA and small ribosomal subunit together?
Hydrogen bonds
d. Why might an RBS be useful for translation in the complex environment of the cell?
Helps the mRNA and the ribosome to find each other by binding
12. a. Does the first tRNA bind before or after the ribosome is completely formed? ____________
b. What is a name for the 3-base sequence that the first tRNA binds to? Start codon
13. a. How many nucleotides are there between...
... the RBS and the start codon? 4
... the 5' end of the mRNA's and the start codon? 14
b. Are either of your answers in "a" multiples of 3? No
c. What establishes the "frame" of triplet codons for translation?
The location of the start codon
14. In the mRNA sequence below, circle and label a likely RBS and the exact start codon.
5' UCUUAAGAAGGAUCUGUAAUGUCUGUAUGUCUGUAGUGUAUGUCUUGUAUCG 3'
2
POGIL2 – Translation
KEY
(Developed by M. Schivell)
MODEL 3:
The reaction catalyzed by the ribosome
is shown to the right.
amino acid
15. Which end of the tRNA is attached
to the amino acid, 5' or 3'?
tRNA with the
nucleotide at one
end shown much
larger than the rest
of the molecule
16. a. In the top half of the model, circle
the two atoms that will be connected by
a new bond. Then draw a slash through the
bond that will be broken.
b. In the bottom half of the model, circle
the newly formed bond.
Amino17. If all of the proteins portions are removed from a ribosome, were taken
away from the
terminus
ribosome, it can still catalyze the reaction shown above (although
much more slowly). What type of molecule must make up the crucial
parts of the active site for catalyzing the reaction?
RNA
18. The drawing to the right shows a short protein of 8 amino acids
that is complete, but is still in the ribosome.
a. Circle the bond that needs to be broken before the protein
can be used.
b. Label the amino terminus and the soon-to-be-carboxyl terminus
of the protein.
c. Draw a square around a peptide bond.
Carboxyterminus
3
POGIL2 – Translation
KEY
(Developed by M. Schivell)
MODEL 4:
Termination of translation (from Freeman, 4e)
"release
factor"
19. Compare the two tRNAs in this model with release factor. List two things that release
factor does NOT have that the tRNAs do have (or had at some point).
_________codon_______________
_______attached amino acid__________
20. Release factor is NOT a nucleic acid, yet it is capable of catalysis.
What is it most likely made of? ___protein______
21. One covalent bond is broken in the figure above.
a. What two things are held together by that covalent bond? ___amino acid and tRNA______
b. What is the catalyst that breaks that bond? ______release factor___________
22. What is the nucleotide sequence of the codon that binds release factor? __UAG______
(This is called a "stop codon".)
23. Using the codon table on page 7, list two different codons that a release factor can bind to:
(include 5' and 3' labels)
_____UAA_____
___UGA_______
24. Is release factor an enzyme? YES What is your reasoning for this answer (see question 17
for help.) It is an enzyme because it catalyzes the breaking of the bond between the last
tRNA and the completed protein.
4
POGIL2 – Translation
KEY
(Developed by M. Schivell)
MODEL 5:
This diagram shows an amino-acyl tRNA (top), and four different amino-acyl tRNA
synthetase enzymes. These enzymes are responsible for attaching the appropriate amino acid
to a tRNA.
tRNA (light gray)
amino acid
4 different
"amino-acyl
tRNA
synthetase"
enzymes
(dark gray)
www.pdb.org
25. Draw a square around the part of the tRNA (at the top) that contains the anti-codon.
26. a. Using the name "amino-acyl tRNA synthetases" as
a guide, name two different substrates of these enzymes: amino acid and tRNA
b. These enzymes also require ATP as a substrate. Explain.
Putting two molecules together is generally +ΔG, so ATP is needed to make it -ΔG
27. The aa-tRNA synthetases (an abbreviation) are a large family of enzymes found in every
living cell.
a. What parts of the enzymes must be different between different members of this family?
The amino acid R-group binding sites and the anticodon binding sites.
b. Are the reactions catalyzed by different members of this family the same or different?
How do you know?
The reactions are the same – they are adding the –COOH of the amino acid to the 3'
end of the tRNA (see in Model 3). This is the same for any tRNA or amino acid.
28. How many different aa-tRNA synthetase
enzymes are needed (at the very least) by a cell? 20
5
POGIL2 – Translation
On your own:
KEY
(Developed by M. Schivell)
1. This is the sequence of a complete mRNA from a bacterial cell:
5' UCAAGGAGGCGUUAGCAUGAAAUUUAUGGGGCGGGUAUAGCUAGCAUUUCAAG 3'
a. Write the protein sequence that is translated from this mRNA on the line below, and label
the amino (N) and carboxyl (C) termini of the protein.
N-Met-Lys-Phe-Met-Gly-Arg-Val-C
b. How many tRNAs will bind to the ribosome to make this protein? 7
c. Which of the following sequences within the mRNA most likely contains the ribosome
binding site? (Circle ONE)
5'UAGCUAGCA3'
5'UUAAUGG3'
6
5'AAGGAGGC3'
POGIL2 – Translation
KEY
(Developed by M. Schivell)
2. For each different mutant cell described below, assume that ONE specific molecule or part
of a molecule is mutated in that cell so that the molecule’s function has changed. Name as
many molecules that could result in the description (but remember that for the mutant
phenotype, you are considering each mutation by itself).
Cell 1: In many different types of proteins, there is the amino
acid Thr (threonine) where an Ala (alanine) should be.
the amino-acyl tRNA synthetase that normally binds alanine (is mutant so now it
binds threonine instead).
Cell 2: Many different types of proteins are much shorter than
in a normal cell, but have the correct sequence up to that
point. tRNA levels are normal in the cell.
release factor
Cell 3: mRNAs are bound to small ribosomal subunits, but
nothing else is attached. Large ribosomal subunits are
floating in the cytoplasm, and no proteins are made.
Met-tRNA is broken so its anticodon no longer binds 5'AUG3' (another possible
correct answer is "initiation factors" which are proteins involved in initiation, but we
did not cover these in class)
3. Should there be tRNAs in the cell that can base pair with a stop codon? Why or why not?
No, if there were, then if they bound to a stop codon before release factor, then the
protein would continue to be synthesized and the proteins would be too long.
7