Download A genetic screen in zebrafish identifies the mutants

Development Advance Online Articles. First posted online on 6 July 2005 as 10.1242/dev.01918
Development
ePress
online publication date 6 July 2005
Access the
most recent version
at http://dev.biologists.org/lookup/doi/10.1242/dev.01918
Research article
Development and disease
3561
A genetic screen in zebrafish identifies the mutants vps18, nf2 and
foie gras as models of liver disease
Kirsten C. Sadler1,*, Adam Amsterdam1, Carol Soroka2, James Boyer2 and Nancy Hopkins1
1
Center for Cancer Research, Massachusetts Institute of Technology, Cambridge MA 02139, USA
Department of Internal Medicine and Yale Liver Center, Yale University School of Medicine, New Haven, CT 06520-8019, USA
2
*Author for correspondence (e-mail: [email protected])
Accepted 24 May 2005
Development 132, 3561-3572
Published by The Company of Biologists 2005
doi:10.1242/dev.01918
Development
Summary
Hepatomegaly is a sign of many liver disorders. To identify
zebrafish mutants to serve as models for hepatic
pathologies, we screened for hepatomegaly at day 5 of
embryogenesis in 297 zebrafish lines bearing mutations in
genes that are essential for embryonic development. Seven
mutants were identified, and three have phenotypes
resembling different liver diseases. Mutation of the class C
vacuolar protein sorting gene vps18 results in
hepatomegaly associated with large, vesicle-filled
hepatocytes, which we attribute to the failure of endosomallysosomal trafficking. Additionally, these mutants develop
defects in the bile canaliculi and have marked biliary
paucity, suggesting that vps18 also functions to traffic
vesicles to the hepatocyte apical membrane and may play
a role in the development of the intrahepatic biliary tree.
Similar findings have been reported for individuals
with arthrogryposis-renal dysfunction-cholestasis (ARC)
syndrome, which is due to mutation of another class C vps
gene. A second mutant, resulting from disruption of the
tumor suppressor gene nf2, develops extrahepatic
choledochal cysts in the common bile duct, suggesting that
this gene regulates division of biliary cells during
development and that nf2 may play a role in the
hyperplastic tendencies observed in biliary cells in
individuals with choledochal cysts. The third mutant is in
the novel gene foie gras, which develops large, lipid-filled
hepatocytes, resembling those in individuals with fatty liver
disease. These mutants illustrate the utility of zebrafish as
a model for studying liver development and disease, and
provide valuable tools for investigating the molecular
pathogenesis of congenital biliary disorders and fatty liver
disease.
Introduction
embryo survives on yolk for the first 3-4 days of development,
after which its digestive system is fully functional and the
embryonic fish begins feeding on day 5. Thus, not only is
embryogenesis rapid, but the development of a physiologically
functional liver occurs within the span of a few days. This
provides the opportunity to carry out an embryonic screen to
identify mutants that are defective in either liver development
or function, or both. Third, baring minor differences, the
anatomy, function, organization and cellular composition of
adult zebrafish and mammalian livers are virtually the same
(Hinton and Couch, 1998; Rocha et al., 1994; Wallace and
Pack, 2003), as is the histopathology of fatty liver (steatosis),
cholestasis and neoplasia (Amatruda et al., 2002; Spitsbergen
et al., 2000) (J. Glickman, personal communication), allowing
direct comparison between zebrafish and mammalian liver
disease processes. Indeed, recent work has demonstrated that
genes that underlie Alagille Syndrome, a pediatric disorder that
results in a paucity of intrahepatic bile ducts, among other
defects, play an important role in zebrafish biliary development
(Lorent et al., 2004). Finally, although the early stages of
hepatogenesis are relatively well understood and are similar in
mice and zebrafish (Duncan, 2003; Field et al., 2003; Ober et
al., 2003), less is known in either system about the final stage
of hepatogenesis – hepatic outgrowth. Therefore, the zebrafish
Chronic liver disease is responsible for over 27,000 deaths/year
in the USA (National Center for Health Statistics, 2004). This
number is predicted to rise because of the association of liver
disease with obesity: as the numbers of obese individuals in
the USA approaches one-third of the population, the incidence
of fatty liver has been estimated to affect ~25% of US citizens
(Neuschwander-Tetri and Caldwell, 2003). Several
hepatobiliary diseases are hereditary or result from
developmental defects, especially those presenting in children,
such as metabolic disorders and bile stasis (cholestasis)
resulting from paucity of bile ducts (Kelly and McKiernan,
1998; Pall and Jonas, 2005). However, with the exception of a
few well-known cases, there is a wide chasm between the
clinical and molecular understanding of these diseases.
The power of zebrafish to study vertebrate development is
well appreciated, and many disease models have emerged from
studies with this organism (Rubinstein, 2003). There are
several advantages to using zebrafish embryos to develop
models of liver diseases. First, in addition to the embryological
and genetic benefits of zebrafish, the liver is not the site of
embryonic hematopoiesis as it is in mammals, and therefore
mutants in liver size or structure will not have the confounding
phenotype of hematopoietic dysfunction. Second, the zebrafish
Key words: Hepatomegaly, Biliary paucity, Choledochal cyst,
Steatosis, Hepatogenesis, Zebrafish
Development
3562 Development 132 (15)
is an excellent system in which to screen for embryonic
mutants with large livers (hepatomegaly), for it holds the
potential of uncovering both developmental and pathological
processes that contribute to this phenotype.
Our laboratory has used insertional mutagenesis to generate
over 400 lines of zebrafish bearing mutations in 315 genes that
are essential for embryonic development, and the mutated gene
has been cloned for each line (Amsterdam et al., 2004; Golling
et al., 2002). We calculate that this represents ~22% of the total
number of zygotic genes that are essential, as determined
genetically, between days 1 and 5 of development (Amsterdam
et al., 2004).
We developed a tool to screen day 5 embryos for
abnormalities in liver size. Seven mutants with hepatomegaly
were identified out of the 297 lines screened. Although several
of the mutants may be defective in the regulation of hepatic
outgrowth, three of them [vps18, neurofibromatosis 2 (nf2) and
foie gras (fgr; flj12716l – Zebrafish Information Network)]
demonstrate signs of hepatic pathology. Mutation in the vps18
gene (which is required for endosomal trafficking to acidic
organelles) results in albinism and hepatomegaly associated
with enlarged hepatocytes, malformation of the bile canaliculi
(which is the site of bile secretion at the hepatocyte apical
membrane) and biliary paucity. Whereas the pigmentation
defect and hepatocyte enlargement can be attributed to the
failure to traffic endosomes to the correct intracellular
compartment, the canalicular defect probably reflects a defect
in the formation of the hepatocyte apical membrane. The
hepatobiliary phenotypes seen in this mutant resemble the
hepatic signs of individuals with arthrogryposis-renal
dysfunction-cholestasis (ARC) syndrome, which is caused by
mutation of vps33B (Gissen et al., 2004), a gene that interacts
with vps18 (Kim et al., 2001; Peterson and Emr, 2001; Sriram
et al., 2003). Second, mutation of nf2 results in hepatomegaly
associated with choledochal cyst formation, and we
hypothesize that this results from deregulated biliary cell
proliferation. Third, fgr mutants develop severe steatosis and
we propose this mutant as the first non-mammalian model of
a fatty liver disease.
Materials and methods
Animal husbandry and embryo collection
The collection of mutants used in this study were generated,
maintained and bred as described (Amsterdam and Hopkins, 1999;
Amsterdam et al., 2004). At least five wild-type and five mutant
embryos from clutches containing healthy embryos were fixed in
formalin overnight at 4°C, washed with PBST (PBS + 0.1% Tween
20) and dehydrated in methanol.
CY3-SA labeling
The labeling protocol was modified from that developed by C. Semino
(Phylonix Pharmaceuticals). Embryos were rehydrated through a
graded series of methanol to PBST, bleached with 10% H2O2/0.5
SSC/0.5% formamide for 12 minutes and blocked with PBST/10%
BSA for 1 hour at room temperature. Embryos were incubated with
CY3-SA (Sigma; 1:500) in a dark chamber for 2 hours at room
temperature, washed with PBST and stored in 80% glycerol.
Embryos were viewed on a Leica MZFLIII stereomicroscope
equipped with a fluorescent attachment and scored for liver size,
shape, number of lobes as well as for labeling and morphology of the
gut. Mutants with hepatomegaly had a left lobe that was visually
Research article
estimated as greater than ~20% larger than that of their phenotypically
wild-type siblings. In each case, the general morphological phenotype
has been shown to be tightly linked to a single viral insertion (Golling
et al., 2002), and the liver phenotype was always associated with the
general morphological phenotype. The mutants were coded, scored
blind and only decoded after the phenotype had been observed in at
least four clutches. Images were obtained on a Zeiss Axioplan 2 using
OpenLab software (Improvision, Lexington, MA).
Morpholino injection
Approximately 0.5-2.0 nl of the following morpholinos at the
indicated concentrations were injected into one-cell embryos: vps18
(1 mM) ATTGATCCAGAATAGATGCCATTGC; nf2 (0.5 mM)
TCAGACCCAAATTGACATAGTGAC;
fgr
(0.05
mM)
GAGATCCCATTGCGCTGGACTCATG.
RT-PCR
Day 5 wild-type and mutant embryos from each line were collected
and RNA was extracted using the RNAEasy kit (Qiagen). Oligo dT
primed cDNA from the RNA equivalent of two embryos was created
using the SuperScript II RT Kit (Invitrogen). PCR reactions (30 μl)
contained 0.25% of the cDNA reaction, 1 buffer, 0.4 mM MgCl2,
0.2 μM dNTPs, 0.5 μl Taq polymerase (Invitrogen) and 0.4 μM of
each primer, and the reaction was carried out for 30 cycles. PCR
products were run on a 1.2% agarose gel containing 1 μg/ml ethidium
bromide. Primers sequences, 3′ to 5′: fgr-F CTTGCCCCATGAGGTATGAGCAC, fgr-R TGTTGAGCTGAGGGAGGACT; vps18-F
CTGGAGGTTGAACGTGGTTT, vps18-R GCAGGAGCAAGAAGTGGAAC; nf2-F CAACCCCACAACAAGCTGAGC, nf2-R
GAAGATCGGCTGTTTCCTCAGAG; Actin-F CATCAGCATGGCTTCTGCTCT, Actin R- GCAGTGTACAGAGACACCC.
Histology and electron microscopy
Embryos were fixed in 4% paraformaldehyde for 4 hours at room
temperature, washed and dehydrated as described above and
embedded in histogel (Richard-Allen Scientific) and then in paraffin.
Serial sections (4 μm) were cut and stained with Hematoxylin and
Eosin, photographed on a Leica DMRB microscope mounted with a
QImaging Retiga EXi digital camera and processed using Adobe
Photoshop 5.0.
Embryos for electron microscopy were fixed over night in
Karnovsky’s fixative (0.1 M cacodylate/2.5% gluteraldehyde/2%
formaldehyde/0.85 M CaCl2 pH 7.4) and processed by the Renal
Pathology Service at the Brigham and Woman’s Hospital (Boston,
MA).
Tissue immunolocalization
Day 5 and 7 embryos were anesthetized and embedded in OCT
Compound (Tissue Tek, Sakura Fintek), frozen on dry ice and 10 μm
sections were cut. Sections were thawed and fixed for 10 minutes with
acetone cooled to –20°C. Non-specific sites were blocked with 1%
BSA in PBS containing 0.05% Triton X100 and was incubated with
2 hours at room temperature with a 1:100 dilution of monoclonal
antibody to P-glycoprotein (Mdr1 and 3, clone C219; Signet
laboratories, Dedham, MA). Sections were washed and incubated
with Cy3-SA (1:250; Sigma) and Alexa 488 anti-mouse IgG (1:1000;
Molecular probes, Eugene, OR) for 1 hour at room temperature.
Images were acquired on a Zeiss LSM 510 confocal microscope and
processed using Adobe Photoshop.
PED-6 labeling
Day 7 embryos were bathed in 0.3 μg/ml PED6 (Molecular Probes)
for 2 hours at 28°C and imaged on a Ziess Axioplan 2. Over 30
mutant, wild-type and morphant embryos were scored for
incorporation of the dye into the gallbladder and for the size of the
common bile duct.
Development and disease
Liver disease models in zebrafish embryos 3563
Histological measurements
Lysosomes and nuclei were counted in 5 thin (1 μm), Toluidine Blue
stained Epon sections through the liver of day 5 vps18 mutant
embryos and their phenotypically wild-type siblings.
For each line with hepatomegaly, the hepatocyte internuclear
distance was determined from Hematoxylin and Eosin sections. Ten
images at 1000 magnification from at least two wild-type and three
mutant embryos from the same clutch were collected and the distance
between adjacent cell nuclei was measured for 125-175 hepatocytes
using Openlab. T-tests were performed on each wild-type-mutant pair;
P-values <0.001 were considered to be significant.
Development
Results
The hepatomegaly screen
Our laboratory has used viral insertional mutagenesis to
generate a collection of over 400 zebrafish lines that are
mutated in 315 recessive embryonic lethal genes. The gene
bearing the mutagenic insert has been cloned for each line and
we estimate that we have achieved ~22% saturation
(Amsterdam et al., 1999). As many human genetic diseases are
attributed to mutation of one allele of an essential gene that,
when homozygously deleted, results in embryonic or neonatal
mortality, we envisioned our collection as a pool of potential
models for human genetic diseases. Indeed, a recent screen of
our collection for mutants that develop kidney cysts has
revealed a number of genes that may be important in this
disease in humans (Sun et al., 2004).
Hepatomegaly is one of the most common and obvious signs
of liver disease. Therefore, hepatomegaly in day 5 zebrafish
embryos could be a sign of liver pathology. Alternatively,
hepatomegaly could develop from a deregulated liver growth
during hepatic outgrowth, and such mutants would be valuable
for understanding this final phase of liver development.
We developed a technique to specifically label the liver so
as to carry out a large scale screen using fixed material. As
biotin serves as a cofactor for a number of liver enzymes (Moss
and Lane, 1971), it is found at high levels in hepatocytes. We
found that streptavidin conjugated to the fluorophore CY3
(CY3-SA) labels the liver in day 5 embryos (Fig. 1A,B).
Additionally, CY3-SA labels the intestinal epithelia and yolk
because of a high concentration of biotin in these tissues (Fig.
1A,B).
We used CY3-SA to screen nearly all of the lines of our
collection to identify those which develop hepatomegaly on
day 5 of development. Out of the 297 lines that were available
to be screened, seven mutants with hepatomegaly were
identified (Fig. 1B; Table 1), representing 2.4% of all mutants
screened. Given that our collection represents ~22% of all
embryonic essential genes, and that this screen covered 94%
of our collection (i.e. ~21% of all embryonic essential genes),
we estimate that a total of ~33 of the essential genes could
result in this phenotype. The genes underlying hepatomegaly
each appear to function in different cellular processes, although
two (fgr and pté) have no defined cellular or biochemical
function (i.e. ‘novel’; Table 1).
Hepatomegaly in each mutant was confirmed by in situ
hybridization with the liver-specific marker, fatty acid binding
protein 1 (K.C.S., unpublished) (Her et al., 2003).
Morphological and histological analysis did not reveal
organomegaly in any other tissue (K.C.S., unpublished). The
yolk is consumed by day 5 in most wild-type embryos;
Fig. 1. Seven mutants develop hepatomegaly by day 5 of
development. (A) CY3-SA specifically labels the liver and gut in day
5 wild-type embryos. Scale bar: 100 μm. (B) Live images (left) and
CY3-SA-labeled livers of wild-type and mutant embryos. The liver is
outlined in red. The gut is indicated in each embryo, except fgr,
which has an underdeveloped gut that does not label with CY3-SA.
Scale bars: 50 μm.
3564 Development 132 (15)
Research article
Table 1. Zebrafish mutants with embryonic hepatomegaly
Line
hi2499A
Gene
vps18
Mutant name
vps18
hi3332
nf2
nf2
hi1532B
hi3237
foie gras
thoc2
foie gras (fgr)
thoc2
hi3785
γ-tubulin
γ-tub
hi1134
sox9a
jelly fish (jef)
hi 1858A
paté
paté (pté)
Gene ontogeny and function
Conserved to yeast; vacuolar
sorting protein
Conserved in metazoa; tumor
suppressor
Conserved in metazoa; novel
Conserved to yeast; couples mitotic
recombination, transcription and
RNA export
Conserved to yeast; centrosome
protein
Conserved in metazoa; tissue
specific transcription factor
Conserved to yeast; novel
Cell size
Large
Extracellular space
Expanded
Wild type
Expanded
Large
Large
Wild type
Wild type
Pathology
ARC syndromelike
Choledochal cysts
type I and II
Steatosis
None observed
Large
Wild type
None observed
Wild type
Wild type
None observed
Wild type
Wild type
None observed
Development
The cellular phenotype and deduced hepatic pathology is indicated.
however, we observe that most of the mutant embryos in our
collection, including the embryos identified by this screen, do
not fully use the yolk (Fig. 1B). CY3-SA also labels the
intestinal epithelia and we used this to score gut morphology
for each mutant. The gut develops normally in sox9a, vps18
and nf2, is slightly underdeveloped in pté, thoc2 and γ-tub, and
is severely abnormal in fgr.
Diagnosis of liver disease relies upon clinical presentation,
biochemical measurement of liver function and assessment of
the pathology from a liver biopsy. We used histological analysis
to identify signs of pathology in each mutant, and to assess the
hepatic architecture, cell composition and cell size. The cellular
phenotype of each mutant is described in Table 1. Four mutants
(vps18, fgr, γ-tub and thoc2) were identified as having enlarged
hepatocytes, which was confirmed by a quantitative measure of
cell size (Fig. 2). Two mutants (vps18 and nf2) contained large
spaces in the extracellular hepatic matrix (Fig. 2A; see Fig. 5).
Further analysis suggested that this is associated with biliary
defects in both cases (see below). In two mutants (sox9a and
pté), the hepatocytes are the same size as wild type (Fig. 2B)
and there is no evidence of expansion of the extracellular space;
in these cases, hepatomegaly may develop due to unregulated
proliferation of hepatocytes. Signs of hepatobiliary pathology
were detected in three mutants (vps18, nf2 and fgr), and we
further characterized each of these.
vps18 is required for pigmentation, endosomal
transport in hepatocytes, formation of the bile
canaliculi and intrahepatic biliary development: a
model for the hepatic signs of ARC syndrome
Mutants from hi2499A contain an insertion in the vps18 gene
following nucleotide 2236 (Fig. 3A). This insertion results in
an abrogation of the vps18 message in mutant embryos (Fig.
3B). vps18 message is present in oocytes (i.e. immature and
unfertilized eggs) and in embryos on days 1-5 of development
(K.C.S., unpublished), and only the zygotically transcribed
message is affected in the hi2499A mutants. Injecting high
concentrations of a morpholino directed against the start site
of the vps18 gene to knock-down the translation of the maternal
message results in pigmentation defects (Fig. 3A) and, in some
embryos, causes global developmental defects early in
development (K.C.S., unpublished). Lower concentrations of
the morpholino do not interfere significantly with pigmentation
or development, but do cause hepatomegaly (Fig. 4A). These
data indicate that the pigmentation defects and hepatomegaly
observed in mutants from hi2499A can be attributed to the loss
of vps18 function. Thus, we hereafter refer to the hi2499A
mutants as vps18.
vps18 is a class C vacuolar protein sorting gene (Raymond
Fig. 2. Four mutants with hepatomegaly have increased internuclear
distance. (A,B) The internuclear distance between adjacent
hepatocytes (white arrows) illustrated in wild-type (A) and vps18 (B)
hepatocytes. Cells separated by sinusoids (s) or large extracellular
gaps (*) were excluded. Scale bar: 50 μm. (C) The hepatocyte
internuclear distance was measured for wild-type and mutant embryos
from each line and plotted in box and whisker plots. The 25th, 50th
(median) and 75th percentiles are indicated as the horizontal lines of
the box, with the 10th and 90th percentiles shown as cross bars on
lines extending from the boxes. Measurements falling outside of the
10th and 90th percent were considered outliers and are shown as open
circles. *P<0.001, as determined by Student’s t-test..
Development and disease
Liver disease models in zebrafish embryos 3565
Development
Fig. 3. hi2499A mutants contain a mutagenic insertion in the vps18 gene. (A) Viral insertion in the vps18 gene at nucleotide 2236. Grey boxes
indicate exons, horizontal lines indicate introns. Triangle represents virus. (B) cDNA prepared from day 5 phenotypically wild-type embryos
and their mutant siblings from hi2499A was amplified with vps18 and actin primers. (C) Unrooted phylogenetic tree for vps18. Bootstrap numbers
are indicated. (D) Percent identity matrix for the Vps18 protein.
et al., 1992). The products of the class C genes (vps11, vps16,
vps18 and vps33) direct the targeting, docking and SNAREmediated fusion of vesicles to the yeast vacuole and animal
lysosome (Kim et al., 2001; Peterson and Emr, 2001; Poupon
et al., 2003; Raymond et al., 1992; Sato et al., 2000; Srivastava
et al., 2000). We carried out a detailed analysis to determine
whether this function of the vps18 gene could account for the
two prominent phenotypes displayed by vps18 mutants:
albinism and hepatomegaly.
Fig. 4. vps18 is required for pigment formation. (A) Day 2 hi2499A
mutants and vps18 are not pigmented. (B-E) The day 5 epithelium of
the skin (B,C) and the retina (D,E) is darkly pigmented in wild-type
embryos (B,D), whereas vps18 mutants (C,E) have sparse pigment
granules (arrows). Scale bar: 5 μm.
vps18 is well conserved and has an orthologs in every
eukaryotic species examined (Fig. 3C). There is 66% identity
between the human and zebrafish, and 33% between zebrafish
and Drosophila proteins (Fig. 3D), suggesting that the function
of vps18 is conserved between species. Abnormalities in eye
pigmentation in the Drosophila vps18 mutant, deep orange
(dor) (Puckett and Petty, 1980; Sevrioukov et al., 1999) are due
to a defect in endosomal trafficking and fusion with the
pigment granule (Sevrioukov et al., 1999; Sriram et al., 2003).
Although dense pigment granules are seen in the pigmented
epithelia of the epidermis and retina of wild-type zebrafish
embryos (Fig. 4B,D), vps18 mutant embryos have only a few
irregularly distributed pigment granules in these tissues (Fig.
4C-E). This phenotype resembles the pigmentation defect
observed in dor mutants, suggesting that the function of vps18
in pigment granule maturation, which is analogous to lysosome
biogenesis, is conserved in these two distantly related animals.
Given that loss of vps18 function disrupts the trafficking of
late endosomes in yeast and mammals (Huizing et al., 2001;
Poupon et al., 2003; Srivastava et al., 2000) we examined vps18
mutant livers to determine whether this same function could
account for hepatomegaly that is observed in vps18 mutants
and morphants (Fig. 5A).
Livers in day 5 wild-type embryos consist primarily of
hepatocytes, which have a lacey, eosinophilic cytoplasm (Fig.
2A; Fig. 5B). Although sinusoids can be easily identified, bile
ducts are never observed in embryonic livers using standard
histological methods. Hepatocytes in vps18 mutant embryos
are enlarged (Fig. 2) and contain large cytoplasmic structures
resembling vesicles or vacuoles (Fig. 5D). There is less
eosinophic material in the vps18 mutant hepatocytes compared
with wild type, and this may reflect the decreased levels of
stored glycogen in the vps18 mutant hepatocytes (K.C.S.,
unpublished).
We used transmission electron microscopy (TEM) to
determine the nature of the cytoplasmic structures seen in
vps18 mutant hepatocytes (Fig. 5E,F). Hepatocytes from wild-
3566 Development 132 (15)
Research article
Development
type day 5 embryos contain copious glycogen, which causes
the cytoplasm to have a homogeneous, grainy appearance. By
contrast, little glycogen is seen in the vps18 mutant
hepatocytes. Instead, large, membrane-bound structures
containing proteinacious material and debris were observed
(Fig. 5F). These are similar to the aberrant structures seen in
yeast and Drosophila cells that lack vps18 (Sevrioukov et al.,
1999; Sriram et al., 2003; Srivastava et al., 2000). A failure to
deliver endosomal cargo to the lysosome prevents lysosome
biogenesis; we found that vps18 mutant hepatocytes have onequarter the number of lysosomes of wild type (Fig. 4G). Taken
together, these data suggest that vps18 acts in zebrafish to target
endosomes to the pigment granule in melanocytes and to the
lysosome in hepatocytes. We conclude that the failure of
endosomal-lysosomal targeting causes transport intermediates
to build up in the hepatocytes, resulting in hepatocyte
enlargement and hepatomegaly.
ARC syndrome is an autosomal recessive disease that affects
the liver, kidneys, platelets and neurogenic muscular function
(Eastham et al., 2001). Typical hepatic defects include
hepatomegaly, intrahepatic biliary paucity and cholestasis
associated with mislocalization of canalicular markers (Gissen
et al., 2004; Horslen et al., 1994). Recently, Gissen et al. have
shown that this disease is due to mutation in another class C
vps gene, vps33B (Gissen et al., 2004). Given that Vps18 and
Vps33B function in the same complex (Huizing et al., 2001;
Kim et al., 2001; Peterson and Emr, 2001; Poupon et al., 2003;
Raymond et al., 1992; Subramanian et al., 2004), we asked
whether biliary defects similar to ARC syndrome occur in
vps18 zebrafish mutants.
vps18 mutant livers contain large spaces in between
hepatocytes (Fig. 2A). The spaces are devoid of nucleated red
blood cells and were not lined by endothelial cells. We
concluded that they were not part of the hepatic
microvasculature (sinusoids). In order to determine whether
these spaces reflected a defect in the intrahepatic biliary
system, we undertook a detailed histological, immunological
and ultrastructural examination of the embryonic biliary tree.
Bile is secreted at the hepatocyte apical membrane
in a specialized structure called the bile canaliculi
(Ujhazy et al., 2001). Bile transporters, such as
MDR1, are specifically localized to the canaliculi in
mammals (Trauner et al., 1997; Trauner and Boyer,
2003) and in fish (Hemmer et al., 1995; Lorent et al.,
2004). In day 5 wild-type zebrafish embryos, MDR1
is localized exclusively to the tube-shaped canaliculi
(Fig. 6B,C). By contrast, MDR1 localization in vps18
mutant livers is punctate (Fig. 6E,F) and the
canaliculi are large and round (Fig. 6F, arrows).
Importantly, we found MDR1 labeling in the
cytoplasm of some vps18 hepatocytes (box in Fig.
6F), suggesting that it is not trafficked properly to the
apical canalicular domain.
In mammals, bile flows from bile canaliculi to bile
ducts through the canal of Hering. Teleosts do not
appear to have a canal of Hering, but instead the
canaliculi empty directly into the lumen of preductules, which are formed by biliary pre-ductal
epithelial cells (PDEC), a specialized cell of the
intrahepatic biliary tree in teleosts (Hinton and Pool,
1976; Rocha et al., 1994). PDECs form the lumen of
the pre-ductule by wrapping around themselves,
analogous to capillary formation by endothelial cells
(Hinton and Couch, 1998; Hinton and Pool, 1976;
Rocha et al., 1994). Although PDECs are reported to
express cytokeratin 19 (Lorent et al., 2004; Matthews
et al., 2004), a classic marker of biliary epithelial
cells, they are not columnar, they lack a basal lamina
(Rocha et al., 1994) and they appear less
differentiated than the cholangiocytes that form the
Fig. 5. Mutation of vps18 results in vesicle accumulation and lysosome depletion in
hepatocytes. (A) hi2499A mutants and vps18 morphants develop hepatomegaly. Scale bar: 100
μm. (B-D) Hematoxylin and Eosin staining of day 5 wild-type (B) and vps18 mutant (C,D)
livers. Hepatocytes in mutant embryos are large and accumulate vacuoles (arrows in D).
Boxed area in C is enlarged in D. Scale bar: 5 μm. (E,F) TEM of day 5 wild-type (E) and
vps18 (F) hepatocytes shows large, membrane-bound structures proteinacious material and
debris, indicative of vacuoles (v) in the mutants. n, nucleus. (G) vps18 mutation reduces the
number of lysosomes in hepatocytes. Error bars indicate standard error of the mean.
Development and disease
Liver disease models in zebrafish embryos 3567
Development
Fig. 6. Mutation in vps18 results in biliary
defects. (A-F) Confocal images of livers from
wild-type (top) and vps18 mutant (bottom)
embryos from day 5 (A,B,D,E) and day 7 (C,F)
labeled with CY3-SA (A,D) and anti-MDR
(B,C,E,F). Some hepatocytes in the mutant
embryos retain some MDR in the cytoplasm (box
in F). Scale bars: 10 μm. (G-I) TEM of day 5
embryos identifies PDECs as cells adjacent to
hepatocytes that collect bile from the canaliculi of
neighboring hepatocytes and transport it through
their lumen (arrows in I). (H,J) vps18 mutant
livers contain virtually no PDECs, and those that
are found do not establish contacts with
hepatocytes, are shrunken and have condensed
DNA (H). PDEC, pre-ductal epithelial cell;
c, canaliculi; c?, putative aberrant canaliculi;
L, lumen. Scale bars: 20 μm G,H; 500 nm in I,J.
hepatic duct, gallbladder and common bile
duct (Fig. 7G).
We could not identify PDECs by
histological or immunological methods, but
could readily identify them by TEM as small
cells that contain a prominent, multi-lobed
nucleus, and are sandwiched between
hepatocytes (Fig. 6G). The bile canaliculi in
day 5 zebrafish embryos are formed at the
apical membrane of 1-4 hepatocytes and are
flanked by tight junctions between adjacent
hepatocytes (K.C.S., unpublished) and
between hepatocytes and PDECs (Fig. 6I). We
found that the entire intrahepatic biliary tree
in day 5 zebrafish embryos comprises
preductules that coalesce at the hepatic duct.
TEM was used to determine whether vps18
mutants have a defect in PDECs and the bile
canaliculi. The number of PDECs in day 5
vps18 mutant livers is drastically reduced, and
those we could identify were shrunken, did not
maintain tight junctions with the surrounding
hepatocytes and their nuclei contained
condensed DNA (Fig. 6H), suggestive of
apoptosis. The space seen to surround PDECs
in vps18 mutants may represent the large
extracellular spaces observed on histological
sections. As in ARC syndrome patients (P.
Gissen, personal communication) the
extrahepatic biliary tree is not affected in
vps18 mutants (K.C.S., unpublished).
Consistent with the abnormal MDR1 labeling seen in vps18
mutant livers, there are dramatic defects in the bile canaliculi.
Canaliculi in wild-type zebrafish embryos are packed with
regularly spaced and evenly shaped microvilli (Fig. 6I), and
ultrastructurally appear very similar to canaliculi in mammals.
Canaliculi in vps18 mutants have sparse, blunted microvilli and
are distended and contain debris (Fig. 6C,D). This morphology
is typically seen in individuals with cholestasis and is identical
to those seen in sea lamprey which develop cholestasis during
metamorphosis (Sidon and Youson, 1983), suggesting
cholestasis may also develop in vps18 mutants.
Our analysis of vps18 mutants indicates that the
pigmentation defects and hepatomegaly can be attributed to the
well characterized function for this gene in endosomallysosomal trafficking. In addition, this study has identified a
new role for vps18 in trafficking to the hepatocyte apical
plasma membrane and formation of the bile canaliculi.
Canalicular malformation (Gissen et al., 2004) and biliary
paucity (P. Gissen, personal communication) is an abnormality
shared between vps18 mutants in zebrafish and mutation of the
vps33B gene in individuals with ARC syndrome. Taken
together, these data are consistent with the hypothesis that class
C VPS genes are required in trafficking to the bile canaliculi
at the hepatocyte apical plasma membrane.
3568 Development 132 (15)
Development
nf2 mutants as a model for choledochal cysts
Choledochal cyst formation is a congenital disorder that is
most often detected in childhood, although an increased
incidence in adults has recently been reported (Soreide et al.,
2004). Cyst classification is based on the site of the cyst and
whether both intrahepatic and extrahepatic involvement is
detected (Soreide et al., 2004). The etiology of cyst formation
is not known. Although most cases are the result of
Research article
developmental defects, a genetic component is suggested by
the occurrence of some familial cases (Behrns et al., 1998;
Iwama, 1998; Iwama et al., 1985; Iwata et al., 1998).
Choledochal cysts carry a greatly elevated risk for developing
cholangiocarcinoma, and although cyst excision diminishes
this risk, it is not eliminated (Soreide et al., 2004). This
suggests that that cholangiocytes in individuals with
choledochal cysts may be predisposed to hyperproliferation
and malignant transformation.
The Nf2 gene in mammals is a tumor suppressor (Lekanne
Deprez et al., 1994; McClatchey et al., 1998; Ruttledge et al.,
1994; Sanson et al., 1993). Mutants from hi3332 contain a single
viral insertion within the intron preceding the first coding exon
of the nf2 gene (Fig. 7A). This insertion causes a complete
abrogation of the nf2 message in mutant embryos (Fig. 7B).
The nf2 gene has been duplicated in zebrafish to create nf2a
(subsequently called nf2) and nf2b genes, which are over 60%
identical at the nucleotide level (A.A., unpublished). The nf2
gene is expressed in oocytes and in embryos through day 5 of
development, while the nf2b message is detected only in
oocytes (K.C.S., unpublished). Injecting embryos with a
morpholino that is specific for the nf2 message phenocopies
the biliary phenotype observed in mutants from hi3332 (see
below). Thus, it is unlikely that nf2b significantly affects the
phenotype of mutants bearing an insertion in the nf2 gene and
we refer to the mutants from hi3332 as nf2.
Mouse embryos homozygously deleted for the nf2 gene
arrest before gastrulation (McClatchey et al., 1997). Our screen
indicates that the nf2 gene is also essential for embryogenesis
in zebrafish, although nf2 mutants have only modest
Fig. 7. Mutation of the nf2 gene results in choledochal cyst
formation. (A) hi3332 mutants contain an insertion in the intron
upstream of the start site of the nf2 gene. Grey boxes indicate exons,
lines indicate introns; ATG is the start codon. (B) cDNA prepared
from day 5 phenotypically wild-type embryos and their mutant
siblings from hi3332 was amplified nf2 and actin primers.
(C-I) Hematoxylin and Eosin-stained histological sections through
wild-type (D,E,G) and mutant (D,F,H,I) liver (C-F), gallbladder and
common bile duct (G-I). Other than the large spaces in the mutant
livers (asterisk in D), the wild-type and mutant livers appear similar
(E,F). The common bile duct is cystic in nf2 mutant embryos (H,I).
The section in I illustrates the gallbladder-ductal junction, and the
formation of a diverticuli (asterisk) in the common bile duct of this
embryo. Scale bars: 50 μm in C,D; 5 μm in E-I. (J-N) PED6 labeling
of wild-type (J,L) and nf2 mutant (K,M,N) day 7 embryos. The
gallbladder is a brightly labeled oblong or spherical organ in wildtype embryos, whereas it is always oblong in mutant embryos. The
common bile duct (arrows) is dilated and diverticuli (asterisk in N)
form in nf2 mutant embryos.
(O) Quantification of ductal
morphology in wild-type, mutant
and nf2 morphant day 7 embryos
fed PED6. P<0.003 for the
comparison of the number of
embryos with dilated bile ducts in
wild-type and mutant embryos
(not shown). Some mutant and
morphant embryos do not
accumulate any PED6 in their
gallbladder (no label). gb,
gallbladder; cbd, common bile
duct.
Development
Development and disease
morphological defects on day 5 of development, including a
small forebrain and hepatomegaly (Fig. 1B). We attribute this
difference to the presence of maternal nf2 message, as injecting
a high concentration of a morpholino designed against the nf2
start site arrests embryos at the one- to two-cell stage.
There is no dramatic hepatocellular phenotype in nf2 mutant
livers, and the size of the hepatocytes are equivalent to wildtype embryos (Fig. 2C, Fig. 7B-E). In some regions of the liver,
however, there are large spaces between hepatocytes (Fig. 7D
and Table 1). These spaces do not appear to be sinusoids, but
may reflect a biliary defect.
The most striking phenotype of nf2 mutants is the dilated
common bile duct (Fig. 7G-N). On histological sections, both
the gallbladder and the common bile duct are enlarged
compared with wild-type sections through the same plane (Fig.
7G-I), indicating the formation of a type Ic (solitary, cystic)
choledochal cyst. In some nf2 mutant embryos, diverticuli are
observed in the cystic ducts (Fig. 7I), indicating the formation
of Type II (supraduodenal diverticuli) choledochal cysts. Both
of these abnormalities are not accompanied by any obvious
morphological or dysplastic change in the cholangiocytes, but
there does appear to be an increase in the number of cells
forming the duct.
The fluorphor-linked phospholipid, PED6, has been used in
zebrafish to visualize the gut and gallbladder in live embryos
(Farber et al., 2001). We used PED6 to examine the common
hepatic duct in live embryos. All wild-type day 7 embryos
incubated in PED6 demonstrate robust fluorescence in the gut
and gallbladder, as do the majority of the nf2 mutants (Fig.
7J,K), although some of the mutants and nf2 morphants fail to
transfer any PED6 to the gallbladder (i.e. ‘no label’ in Fig. 7O)
The common bile duct can barely be detected as a string of
fluorescence connecting the gallbladder and the gut in wild-type
embryos (Fig. 7M,O), while 80% of the nf2 mutant embryos
have a markedly distended bile duct (Fig. 7N,O). Roughly half
of the mutant embryos also form a diverticuli from the common
bile duct (Fig. 7N), confirming the histological phenotype (Fig.
7I). Obstruction can result in biliary dilation; however, serial
sectioning through the common bile duct nf2 embryos as well
as pulse chase experiments with PED6 did not reveal any
obstruction distal to the cyst (K.C.S., unpublished). Taken
together, these histological and physiological data indicate that
the nf2 gene in zebrafish is involved in bile ductogenesis, and
that loss of nf2 function results the formation of type I and type
II choledochal cysts.
Fgr mutants as a model for steatosis
Steatosis is a common cause of hepatomegaly (NeuschwanderTetri and Caldwell, 2003). Approximately 10% of individuals
with steatosis that have no history of alcohol abuse progress
to develop the severe fatty liver disease non-alcoholic
steatohepatitis (NASH), characterized by hepatomegaly,
deranged liver function and steatosis, resulting in hepatocyte
death and inflammation that can develop into cirrhosis (Diehl,
2001). It is not clear why only a subset of individuals progress
from simple steatosis to NASH, but genetic predisposition may
play an important role. Indeed, while steatosis and NASH are
usually associated with obesity, there are well documented
cases of familial NASH (Neuschwander-Tetri and Caldwell,
2003; Struben et al., 2000; Willner et al., 2001), indicating a
genetic component to this disease.
Liver disease models in zebrafish embryos 3569
hi1532B mutants develop massive hepatomegaly, a failure of
gut development and abnormalities lower jaw and the fin
morphology (Fig. 1). hi1532B mutants contain an insertion in the
intron between exons 11 and 12 of a novel gene which we
named foie gras (fgr). The virus contains a 172 bp gene-trap
cassette and in hi1532B mutant embryos, the gene-trap is spliced
in frame following bp 1287 of the fgr-coding sequence (Fig.
8A). This results in a frame shift that creates a stop codon
immediately following the gene trap (Fig. 8A). Thus, mutant
embryos from hi1532B contain only transcript that encodes the
allele with the gene trap (Fig. 8B, mutant band), while
phenotypically wild-type siblings from the same clutch, of
which two-thirds of these embryos are heterozygotes, have
transcript encoding the wild-type allele as well as a small
amount of the mutant allele (Fig. 8B). Injection of a
morpholino designed against the start codon of the fgr message
phenocopies the hi1532B mutants (K.C.S., unpublished), leading
us to conclude that the viral insertion in this gene results in a
loss of fgr function. Henceforth, we refer to mutants from
hi1532B as fgr.
Histological analysis of fgr mutant livers revealed enlarged
hepatocytes which are filled with large, clear vesicles (Fig. 8CD), suggestive of fat accumulation. Cells with fragmented
nuclei and cell corpses, indicative of cell death, were frequently
seen in fgr mutant livers (Fig. 8D), but never in wild type.
Using the lipid stain, oil red O, we found a substantial amount
of lipid accumulation in fgr mutant livers (Fig. 8E,F). Thus,
some of the hallmark signs of NASH – hepatocytes
enlargement, steatosis and an increase in hepatocyte death –
were all observed in fgr mutants. The exception is the
conspicuous absence of inflammation in fgr mutant livers,
despite the marked cell death. We attribute this to the
incomplete maturation of the zebrafish immune system at this
stage of development. Nevertheless, mutation of the fgr gene,
for which the function has not yet been determined in any
organism, results in hepatomegaly associated with a phenotype
that resembles NASH, and may serve as a non-mammalian
model for studying this widespread and important disease.
Discussion
We have undertaken a forward genetic screen in zebrafish to
identify mutants which develop hepatomegaly – a common
sign of many liver pathologies – in an effort to develop
zebrafish models of liver diseases. This study has not only
identified three such models, but also demonstrated important
roles for several new genes in liver development, physiology
and pathology. We found signs of hepatic pathology in three
mutants, and propose vps18 as a model for the hepatobiliary
defects observed in ARC syndrome, nf2 as a model for
choledochal cysts and fgr as a model for fatty liver disease.
The role of vps18 in vesicle trafficking to the vacuole in
yeast (Peterson and Emr, 2001; Sato et al., 2000; Srivastava et
al., 2000), to the pigment granule and synapse in Drosophila
(Narayanan et al., 2000; Sevrioukov et al., 1999; Shestopal et
al., 1997) and to the lysosome in mammals (Huizing et al.,
2001; Kim et al., 2001; Poupon et al., 2003) has been well
defined. Although data from Drosophila (Counce, 1956) and
our morpholino experiments suggest an essential role for vps18
early in development, we believe the maternal contribution of
RNA, protein and nutrients in zebrafish enables the vps18
Development
3570 Development 132 (15)
Research article
mutants, and others (such as γ-tub) that bear mutation
in a cell-essential gene, to survive the first few days
of development.
We found that the two prominent morphological
phenotypes of the vps18 mutant zebrafish embryo –
pigmentation and hepatomegaly – could both be
attributed to the well characterized role for the Vps18
protein in trafficking to the pigment granule or
lysosome. It is likely that hepatomegaly develops in
these embryos due to the accumulation of prelysosomal vesicles in the hepatocyte cytoplasm
causing cell enlargement. Further analysis of this
mutant, however, suggests that this protein also
functions in trafficking to the hepatocyte apical
membrane and formation of the canaliculi, and is
required for development of the intrahepatic biliary
tree. Alternatively, biliary paucity in these mutants
could develop because of damage and death of the
PDECs (i.e. biliary atresia), possibly as a result of
cholestasis which may develop in these mutants.
Biliary paucity and canalicular defects are also seen
in individuals who suffer from ARC syndrome (P.
Gissen, personal communication), which is due to
homozygous mutation of the vps33B gene (Gissen et
al., 2004). Given that the Vps18 and Vps33B proteins
act as part of the same complex in yeast and in
animals (Huizing et al., 2001; Kim et al., 2001;
Peterson and Emr, 2001; Sato et al., 2000) in
trafficking to the vacuole and lysosome, and that
vesicle targeting and fusion with the apical
membrane in hepatocytes involves a SNAREFig. 8. Mutation of fgr causes hepatomegaly and steatosis. (A) The viral
dependent process that requires other VPS genes
insertion (white box) in the intron between exons 11 and 12 of the fgr gene in
(Tuma and Hubbard, 2001,), our data support the
hi1532B mutants results in a gene trap cassette of 172 bp (gt, dark green)
hypothesis that vps18 and vps33B are also required
following bp 1286 of the fgr-coding sequence (grey box). The resulting
for trafficking to the apical membrane.
transcript encodes a message that is frame shifted so that a stop codon is
Interestingly, morpholino knock down of vps33B
created following the gene trap sequence. (B) cDNA prepared from wild-type
message in zebrafish embryos reportedly results in
appearing embryos and their mutant siblings from a hi1532B was amplified with
primers that span the trap (arrows on the mRNA diagram in A). As two-thirds
cholestasis and biliary paucity (M. Pack, personal
of the wild-type appearing embryos from a hi1532B clutch are heterozygous for
communication). Given that the phenotypes of vps18
the mutant allele, both transcripts from the trapped allele (green arrow) in
mutants, vps33B morphants and individuals with
addition to transcripts the wild-type allele (black arrow) are amplified in these
ARC syndrome are not identical [i.e. vps18 mutants
embryos. The mutant embryos only contain transcripts encoding the trap.
do not have signs of arthrogryposis or renal
Histology from wild-type (C) and mutant (D) day 5 embryos illustrates the
dysfunction (K.C.S., unpublished)] and vps33B
large hepatocytes that are filled with vesicles. Several acidophilic bodies
zebrafish morphants and individuals with ARC
(asterisks) representing dead cells as well as those with condensed DNA and
syndrome are normally pigmented (M. Pack and P.
nuclear fragmentation (arrow) are evident in mutant livers, but are never
Gissen, personal communication), we propose that
observed in wild-type embryos. (E,F) ORO staining of wild-type (E) and
vps18 and vps33B may take on tissue specific roles
mutant (F) livers from day 5 embryos reveals substantial steatosis in fgr mutant
hepatocytes. Scale bar: 50 μm.
or that functional redundancy exists in some tissues
but not in others. Our data suggest, however, that the
hepatic phenotype of vps18 mutants and individuals
with ARC syndrome are very similar, and that this is due to
hyperproliferative (K.C.S., unpublished). Indeed, the fact that
the interruption of the same molecular complex involved in two
intrahepatic bile ducts are often hyperproliferative in
trafficking pathways in hepatocytes. We thus propose the vps18
individuals with extrahepatic choledochal cysts (Nambirajan et
zebrafish mutant as a model for studying the hepatic signs of
al., 2000) and choledochal cysts carry a predisposition to
ARC syndrome.
cholangiocarcinoma (Soreide et al., 2004) indicates a strong
The other mutant we identified to have hepatomegaly
link between cyst formation and proliferation control. It is
associated with a biliary defect bears an inactivating mutation
possible that in the absence of nf2, there may be unregulated
in the nf2 gene. These mutants develop type Ic and type II
proliferation of a bi-potential cell that can give rise to both
choledochal cysts. Although there are signs of intrahepatic
hepatocytes and biliary cells, analogous to an oval cell
biliary pathology in nf2 mutants, unlike vps18, the PDECs in
(Newsome et al., 2004). This could account for both the
nf2 mutants are not atretic, but on the contrary, may be
increase in biliary cells and hepatomegaly observed in nf2
Development
Development and disease
mutant zebrafish embryos, and is consistent with the finding
that heterozygous deletion of nf2 in mice leads to the formation
of hepatocellular carcinomas following loss of heterozygosity
at the nf2 locus (McClatchey et al., 1998) and with what is
observed in a liver-specific deletion of nf2 in mice (M., Curto
and A. McClatchey, personal communication).
The Nf2 protein merlin is a member of the ERM (ezrinradixin-moesin) family, which serve as membrane-cytoskeletal
linkers. Merlin is thought to be required for contact-mediated
inhibition of growth through stabilization of adherens junctions
(Lallemand et al., 2003) and also through the inhibition of Pak1
(Kissil et al., 2003). Our preliminary studies indicate that tight
junctions are not disrupted in nf2 mutant livers (K.C.S.,
unpublished). It is interesting that using RNAi to knock down
the levels of a C. elegans ERM gene, erm-1, results in the
formation of cyst in every tubular epithelial organ in which the
gene is normally expressed (Gobel et al., 2004), although
junctions are not affected in this model. It will be of interest to
examine the structure of the cytoskeleton, junctions and the
proliferative index of biliary cells and hepatocytes in nf2
mutant zebrafish.
Although ARC syndrome and choledochal cysts are
relatively rare, steatosis is found in ~25% of the population of
the USA, and nearly 1-2% of US citizens have fatty liver
disease (Neuschwander-Tetri and Caldwell, 2003), which
places it among the most common hepatic pathologies in the
developed world (Clark et al., 2002; Neuschwander-Tetri and
Caldwell, 2003). Although obesity and excessive alcohol
intake are the greatest contributing factors to steatosis and
NASH, the clustering of NASH within some families (Struben
et al., 2000; Willner et al., 2001) and the numerous mouse
models that develop NASH points to a considerable yet varied
genetic component to this disease.
We therefore predicted that we might uncover a model of
steatosis through a screen for hepatomegaly, but were surprised
to find that fgr so closely resembles NASH, with the noted
exception that there is no inflammation in this mutant.
Moreover, as the well-conserved fgr gene has no identifiable
domains or motifs, it represents a truly novel factor regulating
fat accumulation. Multiple molecular pathways, including
those controlled by SREBP1-c, PPARγ and insulin are
important regulators of hepatic steatosis (Browning and
Horton, 2004), and it will be of interest to see whether fgr plays
a role in any of these pathways.
In summary, by screening for zebrafish mutants with
hepatomegaly, novel and physiologically relevant genes
underlying embryonic hepatomegaly have been uncovered. We
have identified three mutant lines that can serve as valuable
models of diseases of lysosomal trafficking, choledochal cyst
formation and fatty liver disease. Additionally, several mutants
may also provide insight onto the processes that control liver
growth and size during development.
This work would not have been possible without the expert
assistance of our fish staff, especially S. Farrington and J. Davenport,
and the histology core, especially A. Caron. We also thank H. Rennke
and C. Ford for their excellence in electron microcopy. The
bioinformatics support provided by C. Whittaker and the consultation
with the talented pathologists R. Bronson, M. McLaughlin and J.
Glickman were invaluable. We are indebted to C. Ukomadu, P. Gissen,
A. McClatchy and members of the Hopkins’ laboratory for helpful
discussions, and to K. Haddix for help with statistics. We are
Liver disease models in zebrafish embryos 3571
particularly grateful for guidance from J. Lees. K.C.S. was supported
by a Ruth L. Kirschstein fellowship from the NICHD
(1F32HD042920-01).
References
Amatruda, J. F., Shepard, J. L., Stern, H. M. and Zon, L. I. (2002).
Zebrafish as a cancer model system. Cancer Cell 1, 229-231.
Amsterdam, A. and Hopkins, N. (1999). Retrovirus-mediated insertional
mutagenesis in zebrafish. Meth. Cell Biol. 60, 87-98.
Amsterdam, A., Burgess, S., Golling, G., Chen, W., Sun, Z., Townsend, K.,
Farrington, S., Haldi, M. and Hopkins, N. (1999). A large-scale
insertional mutagenesis screen in zebrafish. Genes Dev. 13, 2713-2724.
Amsterdam, A., Nissen, R. M., Sun, Z., Swindell, E. C., Farrington, S. and
Hopkins, N. (2004). Identification of 315 genes essential for early zebrafish
development. Proc. Natl. Acad. Sci. USA 101, 12792-12797.
Behrns, K. E., Shaheen, N. J. and Grimm, I. S. (1998). Type I choledochal
cyst in association with familial adenomatous polyposis. Am. J.
Gastroenterol. 93, 1377-1379.
Browning, J. D. and Horton, J. D. (2004). Molecular mediators of hepatic
steatosis and liver injury. J. Clin. Invest. 114, 147-152.
Clark, J. M., Brancati, F. L. and Diehl, A. M. (2002). Nonalcoholic fatty
liver disease. Gastroenterology 122, 1649-1657.
Counce, S. J. (1956). Studies on female-sterility genes in Drosophila
melanogaster. I. The effects of the gene deep orange on embryonic
development. Z. Indukt. Abstamm. Vererbungsl. 87, 443-461.
Diehl, A. (2001). Alcoholic and non-alcoholic steatohepatitis. In The Liver:
Biology and Pathophysiology (ed. I. Arias), pp. 738-753. Philadelphia:
Lipincott Williams and Wilkins.
Duncan, S. A. (2003). Mechanisms controlling early development of the liver.
Mech. Dev. 120, 19-33.
Eastham, K. M., McKiernan, P. J., Milford, D. V., Ramani, P., Wyllie, J.,
van’t Hoff, W., Lynch, S. A. and Morris, A. A. M. (2001). ARC syndrome:
an expanding range of phenotypes. Arch. Dis. Child. 85, 415-420.
Farber, S. A., Pack, M., Ho, S. Y., Johnson, I. D., Wagner, D. S., Dosch,
R., Mullins, M. C., Hendrickson, H. S., Hendrickson, E. K. and Halpern,
M. E. (2001). Genetic analysis of digestive physiology using fluorescent
phospholipid reporters. Science 292, 1385-1388.
Field, H. A., Ober, E. A., Roeser, T. and Stainier, D. Y. (2003). Formation
of the digestive system in zebrafish. I. Liver morphogenesis. Dev. Biol. 253,
279-290.
Gissen, P., Johnson, C. A., Morgan, N. V., Stapelbroek, J. M., Forshew, T.,
Cooper, W. N., McKiernan, P. J., Klomp, L. W., Morris, A. A., Wraith,
J. E. et al. (2004). Mutations in VPS33B, encoding a regulator of SNAREdependent membrane fusion, cause arthrogryposis-renal dysfunctioncholestasis (ARC) syndrome. Nat. Genet. 36, 400-404.
Gobel, V., Barrett, P. L., Hall, D. H. and Fleming, J. T. (2004). Lumen
morphogenesis in C. elegans requires the membrane-cytoskeleton linker
erm-1. Dev. Cell 6, 865-873.
Golling, G., Amsterdam, A., Sun, Z., Antonelli, M., Maldonado, E., Chen,
W., Burgess, S., Haldi, M., Artzt, K., Farrington, S. et al. (2002).
Insertional mutagenesis in zebrafish rapidly identifies genes essential for
early vertebrate development. Nat. Genet. 31, 135-140.
Hemmer, M. J., Courtney, L. A. and Ortego, L. S. (1995).
Immunohistochemical detection of P-glycoprotein in teleost tissues using
mammalian polyclonal and monoclonal antibodies. J. Exp. Zool. 272, 6977.
Her, G. M., Chiang, C. C., Chen, W. Y. and Wu, J. L. (2003). In vivo studies
of liver-type fatty acid binding protein (L-FABP) gene expression in liver
of transgenic zebrafish (Danio rerio). FEBS Lett. 538, 125-133.
Hinton, D. and Pool, C. (1976). Ultrastructure of the liver in channel catfish
Ictalurus punctatus (Rafinesque). J. Fish Biol. 8, 209-219.
Hinton, D. and Couch, J. (1998). Architectural pattern, tissue and cellular
morphology in livers of fishes: relationship to experimentally-induced
neoplastic responses. In Fish Ecotoxicology (ed. T. Braunbeck, D. Hinton
and B. Streit), pp. 141-164. Basel: Birkhauser Verlag.
Horslen, S. P., Quarrell, O. W. and Tanner, M. S. (1994). Liver histology
in the arthrogryposis multiplex congenita, renal dysfunction, and cholestasis
(ARC) syndrome: report of three new cases and review. J. Med. Genet. 31,
62-64.
Huizing, M., Didier, A., Walenta, J., Anikster, Y., Gahl, W. A. and Kramer,
H. (2001). Molecular cloning and characterization of human VPS18, VPS
11, VPS16, and VPS33. Gene 264, 241-247.
Development
3572 Development 132 (15)
Iwama, T. (1998). Familial case of choledochocele. J. Gastroenterol. Hepatol.
13, 237.
Iwama, T., Iwata, S., Murakami, S., Ishida, H. and Mishima, Y. (1985).
Congenital bile duct dilatation–possibly an hereditary condition. Jpn J. Surg.
15, 501-505.
Iwata, F., Uchida, A., Miyaki, T., Aoki, S., Fujioka, T., Yamada, J., Joh,
T. and Itoh, M. (1998). Familial occurrence of congenital bile duct cysts.
J. Gastroenterol. Hepatol. 13, 316-319.
Kelly, D. A. and McKiernan, P. J. (1998). Metabolic liver disease in the
pediatric patient. Clin. Liver Dis. 2, 1-30.
Kim, B. Y., Kramer, H., Yamamoto, A., Kominami, E., Kohsaka, S. and
Akazawa, C. (2001). Molecular characterization of mammalian
homologues of class C Vps proteins that interact with syntaxin-7. J. Biol.
Chem. 276, 29393-29402.
Kissil, J. L., Wilker, E. W., Johnson, K. C., Eckman, M. S., Yaffe, M. B.
and Jacks, T. (2003). Merlin, the product of the Nf2 tumor suppressor gene,
is an inhibitor of the p21-activated kinase, Pak1. Mol. Cell 12, 841-849.
Lallemand, D., Curto, M., Saotome, I., Giovannini, M. and McClatchey,
A. I. (2003). NF2 deficiency promotes tumorigenesis and metastasis by
destabilizing adherens junctions. Genes Dev. 17, 1090-1100.
Lekanne Deprez, R. H., Bianchi, A. B., Groen, N. A., Seizinger, B. R.,
Hagemeijer, A., van Drunen, E., Bootsma, D., Koper, J. W., Avezaat, C.
J., Kley, N. et al. (1994). Frequent NF2 gene transcript mutations in
sporadic meningiomas and vestibular schwannomas. Am. J. Hum. Genet. 54,
1022-1029.
Lorent, K., Yeo, S. Y., Oda, T., Chandrasekharappa, S., Chitnis, A.,
Matthews, R. P. and Pack, M. (2004). Inhibition of Jagged-mediated Notch
signaling disrupts zebrafish biliary development and generates multi-organ
defects compatible with an Alagille syndrome phenocopy. Development
131, 5753-5766.
Matthews, R. P., Lorent, K., Russo, P. and Pack, M. (2004). The zebrafish
onecut gene hnf-6 functions in an evolutionarily conserved genetic pathway
that regulates vertebrate biliary development. Dev. Biol. 274, 245-259.
McClatchey, A. I., Saotome, I., Ramesh, V., Gusella, J. F. and Jacks, T.
(1997). The Nf2 tumor suppressor gene product is essential for
extraembryonic development immediately prior to gastrulation. Genes Dev.
11, 1253-1265.
McClatchey, A. I., Saotome, I., Mercer, K., Crowley, D., Gusella, J. F.,
Bronson, R. T. and Jacks, T. (1998). Mice heterozygous for a mutation at
the Nf2 tumor suppressor locus develop a range of highly metastatic tumors.
Genes Dev. 12, 1121-1133.
Moss, J. and Lane, M. D. (1971). The biotin-dependent enzymes. Adv.
Enzymol. Relat. Areas Mol. Biol. 35, 321-442.
Nambirajan, L., Taneja, P., Singh, M. K., Mitra, D. K. and Bhatnagar, V.
(2000). The liver in choledochal cyst. Trop. Gastroenterol. 21, 135-139.
Narayanan, R., Kramer, H. and Ramaswami, M. (2000). Drosophila
endosomal proteins hook and deep orange regulate synapse size but not
synaptic vesicle recycling. J. Neurobiol. 45, 105-119.
National Center for Health Statistics (2004). Health, United States, 2004
With Chartbook on Trends in the Health of Americans. Hyattsville, MD: US
Department of Health and Human Services, Center for Disease Control and
Prevention.
Neuschwander-Tetri, B. A. and Caldwell, S. H. (2003). Nonalcoholic
steatohepatitis: summary of an AASLD Single Topic Conference.
Hepatology 37, 1202-1219.
Newsome, P. N., Hussain, M. A. and Theise, N. D. (2004). Hepatic oval cells:
helping redefine a paradigm in stem cell biology. Curr. Top. Dev. Biol. 61,
1-28.
Ober, E. A., Field, H. A. and Stainier, D. Y. (2003). From endoderm
formation to liver and pancreas development in zebrafish. Mech. Dev. 120,
5-18.
Pall, H. and Jonas, M. M. (2005). Pediatric hepatobiliary disease. Curr. Opin.
Gastroenterol. 21, 344-347.
Peterson, M. R. and Emr, S. D. (2001). The class C Vps complex functions
at multiple stages of the vacuolar transport pathway. Traffic 2, 476-486.
Poupon, V., Stewart, A., Gray, S. R., Piper, R. C. and Luzio, J. P. (2003).
The role of mVps18p in clustering, fusion, and intracellular localization of
late endocytic organelles. Mol. Biol. Cell 14, 4015-4027.
Puckett, L. and Petty, K. (1980). Temperature sensitivity of deep orange:
effects on eye pigmentation. Biochem. Genet. 18, 1221-1228.
Raymond, C. K., Howald-Stevenson, I., Vater, C. A. and Stevens, T. H.
(1992). Morphological classification of the yeast vacuolar protein sorting
mutants: evidence for a prevacuolar compartment in class E vps mutants.
Mol. Biol. Cell 3, 1389-1402.
Research article
Rocha, E., Monteiro, R. A. and Pereira, C. A. (1994). The liver of the brown
trout, Salmo trutta fario: a light and electron microscope study. J. Anat. 185,
241-249.
Rubinstein, A. L. (2003). Zebrafish: from disease modeling to drug discovery.
Curr. Opin. Drug Discov. Dev. 6, 218-223.
Ruttledge, M. H., Sarrazin, J., Rangaratnam, S., Phelan, C. M., Twist, E.,
Merel, P., Delattre, O., Thomas, G., Nordenskjold, M., Collins, V. P. et
al. (1994). Evidence for the complete inactivation of the NF2 gene in the
majority of sporadic meningiomas. Nat. Genet. 6, 180-184.
Sanson, M., Marineau, C., Desmaze, C., Lutchman, M., Ruttledge, M.,
Baron, C., Narod, S., Delattre, O., Lenoir, G., Thomas, G. et al. (1993).
Germline deletion in a neurofibromatosis type 2 kindred inactivates the NF2
gene and a candidate meningioma locus. Hum. Mol. Genet. 2, 1215-1220.
Sato, T. K., Rehling, P., Peterson, M. R. and Emr, S. D. (2000). Class C Vps
protein complex regulates vacuolar SNARE pairing and is required for
vesicle docking/fusion. Mol. Cell 6, 661-671.
Sevrioukov, E. A., He, J. P., Moghrabi, N., Sunio, A. and Kramer, H.
(1999). A role for the deep orange and carnation eye color genes in
lysosomal delivery in Drosophila. Mol. Cell 4, 479-486.
Shestopal, S. A., Makunin, I. V., Belyaeva, E. S., Ashburner, M. and
Zhimulev, I. F. (1997). Molecular characterization of the deep orange (dor)
gene of Drosophila melanogaster. Mol. Gen. Genet. 253, 642-648.
Sidon, E. W. and Youson, J. H. (1983). Morphological changes in the liver
of the sea lamprey, Petromyzon marinus L., during metamorphosis. II.
Canalicular degeneration and transformation of the hepatocytes. J. Morphol.
178, 225-246.
Soreide, K., Korner, H., Havnen, J. and Soreide, J. A. (2004). Bile duct
cysts in adults. Br. J. Surg. 91, 1538-1548.
Spitsbergen, J. M., Tsai, H. W., Reddy, A., Miller, T., Arbogast, D.,
Hendricks, J. D. and Bailey, G. S. (2000). Neoplasia in zebrafish (Danio
rerio) treated with 7,12-dimethylbenz[a]anthracene by two exposure routes
at different developmental stages. Toxicol. Pathol. 28, 705-715.
Sriram, V., Krishnan, K. S. and Mayor, S. (2003). deep-orange and carnation
define distinct stages in late endosomal biogenesis in Drosophila
melanogaster. J. Cell Biol. 161, 593-607.
Srivastava, A., Woolford, C. A. and Jones, E. W. (2000). Pep3p/Pep5p
complex: a putative docking factor at multiple steps of vesicular transport
to the vacuole of Saccharomyces cerevisiae. Genetics 156, 105-122.
Struben, V. M., Hespenheide, E. E. and Caldwell, S. H. (2000).
Nonalcoholic steatohepatitis and cryptogenic cirrhosis within kindreds. Am.
J. Med. 108, 9-13.
Subramanian, S., Woolford, C. A. and Jones, E. W. (2004). The
Sec1/Munc18 protein, Vps33p, functions at the endosome and the vacuole
of Saccharomyces cerevisiae. Mol. Biol. Cell 15, 2593-2605.
Sun, Z., Amsterdam, A., Pazour, G. J., Cole, D. G., Miller, M. S. and
Hopkins, N. (2004). A genetic screen in zebrafish identifies cilia genes as
a principal cause of cystic kidney. Development 131, 4085-4093.
Trauner, M. and Boyer, J. L. (2003). Bile salt transporters: molecular
characterization, function, and regulation. Physiol. Rev. 83, 633-671.
Trauner, M., Arrese, M., Soroka, C. J., Ananthanarayanan, M., Koeppel,
T. A., Schlosser, S. F., Suchy, F. J., Keppler, D. and Boyer, J. L. (1997).
The rat canalicular conjugate export pump (Mrp2) is down-regulated in
intrahepatic and obstructive cholestasis. Gastroenterology 113, 255-264.
Tuma, P. and Hubbard, A. (2001). The hepatocyte surface: dynamic polarity.
In The liver: biology and pathophysiology (ed. I. Arias, J. L. Boyer, F.
Chisari, N. Fausto, D. Schachter and D. Shafritz), pp. 96-117. Philadelphia:
Lippincot Williams and Wilkins.
Ujhazy, P., Kipp, H., Misra, S., Wakabasyasi, Y. and Arias, I. M. (2001).
The biology of the bile canaliculus. In The Liver: Biology and Pathobiology
(ed. I. M. Arias, J. L. Boyer, F. Chisari, N. Fausto, D. Schachter and D.
Shafritz), pp. 360-372. Philadelphia: Lippincott Williams and Wilkins.
Wallace, K. N. and Pack, M. (2003). Unique and conserved aspects of gut
development in zebrafish. Dev. Biol. 255, 12-29.
Willner, I. R., Waters, B., Patil, S. R., Reuben, A., Morelli, J. and Riely,
C. A. (2001). Ninety patients with nonalcoholic steatohepatitis: insulin
resistance, familial tendency, and severity of disease. Am. J. Gastroenterol.
96, 2957-2961.