* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Information flow within the cell
Expression vector wikipedia , lookup
Paracrine signalling wikipedia , lookup
Biochemical cascade wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Signal transduction wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Genomic library wikipedia , lookup
Genetic engineering wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Point mutation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Gene regulatory network wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Gene expression wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Information flow within the cell a primer… Zoii Lygerou Z L Medical School, Patras University Greece All living organisms today have derived from the same cell which appeared on earth some 4 billion years ago © 2000 by Geoffrey M. Cooper All living organisms today are related The tree of life… © 2002 by Bruce Alberts, Alexander Johnson, Julian Lewis, Martin Raff, Keith Roberts, and Peter Walter All living organisms are made up of cells Prokaryotic y cell 1-10μm Eukaryotic y cell 10-100 μm There are hundreds of different cell types within the human body, each with a unique structure and function Blood cells Neuron Sperm cell and oocyte Fibroblasts Cardiac myocyte There are millions of different cells on earth… All cells are made up of the same building blocks Which is the main structural and functional component of cells? Proteins are the main structural and functional components t off th the cell ll Collagen Haemoglobin Proteins are chains off amino-acids NH2 COOH Proteins are builWfrom 20 different amino acids © 2000 by Geoffrey M. Cooper The unique properties of the amino-acid side chains h i give i each h protein t i its it structure t t and d ffunction ti NH2 COOH Proteins are folded into a specific conformation compatible tibl with ith a specific ifi ffunction ti The amino Th i acid id sequence contains i all ll the h information for protein structure and function Out of the trillions of amino acid combinations possible, proteins have the sequence which leads to a stable structure suitable ffor a specific p f function f so, how is the amino-acid composition of proteins defined, preserved and passed down to future generations? Each cell contains all the information required to builG and maintain the complete organism (to th i all ll the th proteins t i needed d d in i every cell ll synthesize type) This information must be stored safely but be accessible ibl for f d decoding di Every time a cell divides, an accurate and full copy must be made and correctly segregated to the d daughter ht cell ll The storage molecule must be stable, with high information content, easily copied and read From Nature 171: 740–741 1953 Rosalind Franklin Francis Crick Maurice Wilkins James D. Watson 1962 Nobel Prize for Physiology or Medicine The DNA structure permits access to the primary sequence How can the 4 DNA letters code for 20 amino-acids? The 4 DNA letters are read in triplets 43 combinations = 64 Codons 5’GATGTTCATCGTAATCGTAGCTAACATATCA3’ 3’CTACAAGTAGCATTACGATCGATTGTATAGT5’ GAT GTT CAT CGT AAT CGT AGC TAA CAT ATC A Which is the look-up table? The Genetic Code Marshall W. Nirenberg Robert W. Holley H. Gobind Khorana Nobel Prize in Physiology or Medicine 1968 Second Position of Codon T T C TTT Phe [F] TCT Ser [S] A Tyr [Y] TGT Cys [C] T TTC Phe [F] TCC Ser [S] TAC Tyr [Y] TGC Cys [C] C TTA Leu [L] TCA Ser [S] TAT G TAA Ter [end] TGA F TTG Leu [L] TCG Ser [S] TAG i CTT Leu [L] CCT Pro [P] CAT r s CTC Leu [L] CCC Pro [P] CAC C t CTA Leu [L] CCA Pro [P] CAA Ter [end] A Ter [end] TGG Trp [W] T h T i C r d A G His [H] CGT Arg [R] His [H] CGC Arg [R] Gln [Q] CGA Arg [R] CTG Leu [L] P o ATT Ile [I] s ATC Ile [I] i A ATA Ile [I] t i ATG Met [M] o GTT Val [V] n GTC Val [V] G GTA Val [V] CCG Pro [P] CAG Gln [Q] CGG Arg [R] ACT Thr [T] AAT Asn [N] AGT Ser [S] ACC Thr [T] AAC Asn [N] AGC Ser [S] ACA Thr [T] AAA Lys [K] AGA Arg [R] ACG Thr [T] AAG Lys [K] AGG Arg [R] GCT Ala [A] GAT Asp [D] GGT Gly [G] GCC Ala [A] GAC Asp [D] GGC Gly [G] G P T o s C i A t G i o T n C GCA Ala [A] GAA Glu [E] GGA Gly [G] A GTG Val [V] GCG Ala [A] GAG Glu [E] GGG Gly [G] G The 4 DNA letters are read in triplets 5’ GATGTTCATCGTAATCGTAGCTAACATATCAAATTGA 3’ 3’CTACAAGTAGCATTAGCATCGATTGTATAGTTTAACT5’ Forward frames TTG A L Frame 1 G ATG TTC ATC GTA ATC GTA GCT AAC ATA TCA AAT TGA Met F I V I V A N I S N Stop Frame 2 GAT GTT CAT CGT AAT CGT AGC TAA CAT ATC AAA D V H R N R S StopH I K Frame 3 GA TGT TCA TCG TAA TCG TAG CTA ACA TAT CAA ATT GA C S S StopS StopL T Y Q I Reverse frames T CAA ATT TGA TAT GTT AGC TAC GAT TAC GAT GAA CAT C Frame 4 S I StopY V S Y D Y D E H TC AAA TTT GAT ATG TTA GCT ACG ATT ACG ATG AAC ATC Q F D Met L A T I T Met N I Frame 5 TCA AAT TTG ATA TGT TAG CTA CGA TTA CGA TGA ACA TC S N L I C StopL R L R StopT Frame 6 Open Reading Frame ORF From DNA to RNA DNA is copied into RNA, before it is decoded to protein Why? The central dogma DNA Transcription RNA Translation NH2 COOH Protein Genes are the functional units of the genetic material: a part of the genome which codes for a product d t with ith a specific ifi ffunction ti Regulatory region Transcribed region DNA RNA NH2 COOH Protein The central dogma Replication DNA Transcription RNA Translation NH2 COOH Protein An accurate copy of the genetic information must be made every time a cell divides Replication p Replication Bacteria Single replication initiation point: origin of replication Eukarya Hundreds of origins scattered throughout the genome Replication only at a specific phase of the life of the cell (cell cycle) – S phase Need for accurate spatio-temporal regulation Information flow within the cell – a family business… Arthur A th K Kornberg b Nobel Price 1959 Replication Roger K R Kornberg b Nobel Price 2006 Transcription A few complications… In eukaryotes, the genetic information is split… Genes contain parts coding for function (exons) interrupted by non-coding parts (introns) Regulatory region Transcribed region DNA Promoter Primary P i transcript Splicing NH2 Mature mRNA COOH Protein A few more complications… In addition to genes, there is a hell of a lot more in a genome… especially in the human genome… genome Less than 30% of our genome contains genes (introns and exons) Less than 2% of our genome encodes ffor p protein If 1bp was 1mm… Our genome would be 3200km 300m 300m 30m There would be one g gene every 300m Every gene would be 30m mRNA would be 1m Adapted from Molecular Biology of the Cell, Alberts et al Genes are not evenly distributed along the human genome… Gene-dense “urban centers” alternate with gene-poor “deserts” The sequence composition of gene-rich, gene-poor gene poor regions and boundaries differs significantly So what about all the rest? 50% are repetitive i i sequences Junk DNA ??? Or Shapers of the genome ??? Practical complication: Identifying genes is not straight forward A few more complications… DNA is very long… The DNA in each human cell is 1m long g HowGo you fit a 1m long thread within a sphere 10μm in diameter? ….so that you do not tangle it up and are able to separate p it every y time the cell divides? …and so that each part of it can be accessed for transcription? DNA is folded together with proteins into chromatin Active regions are less compact (euchromatin) Inactive regions are more compact (heterochromatin) Chromatin is further compacted just prior to cell division to p permit separation p without entanglement g chromosomes The many forms and function of cells in the human body arise due to the differential expression of the same genetic information: a unique set of genes i switched is it h d on and d off ff iin every cellll att any given i titime Blood cells Sperm cell and oocyte Neuron Cardiac myocyte Fibroblasts Regulation of gene expression (and inheritance of a cell character) involves Regulation of the activity of proteins (trancription factors) which hich bind specific DNA sequences seq ences and determine when hen they will be transcribed Regulation of chromatin structure (epigenetic control) The many forms and function of cells in the human body arise due to the differential expression of the same genetic information: a unique set of genes i switched is it h d on and d off ff iin every cellll att any given i titime Blood cells Sperm cell and oocyte Neuron Cardiac myocyte Fibroblasts The complexity of humans is believed to arise not due to the presence of many more genes but due to more complex regulation gene p products out off the same g gene more g more combinations in the expression patterns of the different genes