* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Genetics Exercises PDF
Human genome wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Ridge (biology) wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Genomic library wikipedia , lookup
Gene desert wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Point mutation wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
History of genetic engineering wikipedia , lookup
Non-coding RNA wikipedia , lookup
Primary transcript wikipedia , lookup
Hybrid (biology) wikipedia , lookup
Genome (book) wikipedia , lookup
Y chromosome wikipedia , lookup
Gene expression profiling wikipedia , lookup
Genomic imprinting wikipedia , lookup
Genome evolution wikipedia , lookup
Helitron (biology) wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
X-inactivation wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Gene expression programming wikipedia , lookup
Designer baby wikipedia , lookup
Neocentromere wikipedia , lookup
Chromosomes The big questions: Which chromosomes in a nucleus are similar? Which are identical? Which are completely different? How do chromosomes align during mitosis? How do chromosomes align during meiosis? Using pipe cleaners to represent the chromosomes in a fruit fly: different chromosomes similar chromosomes (homologs) Add beads to represent genes (colors can show alleles): different chromosomes similar chromosomes (homologs) Leave just the different color/allele beads … to mark the homologs: different chromosomes similar chromosomes (homologs) Duplicate the chromosomes in preparation for division: after duplication different chromosomes similar chromosomes (homologs) identical chromosomes (sister chromatids) Student activities: Model mitosis and meiosis with pipe cleaners & beads Devise 2D drawings Practice (going back and forth between pipe cleaners and drawings as needed) Apply pipe cleaners and beads to new situations Create chromosomes for a 2n=6 organism model mitosis model meiosis x x x Other uses of pipe cleaners and beads: Ploidy -model trisomy vs triploidy Complementation -model complementation vs failure to complement different chromosomes similar chromosomes (homologs) Other uses of pipe cleaners and beads: Ploidy model trisomy model triploidy Other uses of pipe cleaners and beads: Complementation m1/m1 homozygotes show a particular phenotype. m2/m2 homozygotes show the same phenotype. Are m1 and m2 mutations in the same gene or in different genes? model complementation model failure to complement Crossing Over and Recombinant Chromosomes Using pool noodles to discuss crossing over and % recombinants Locke & McDermid (2005) Genetics 170: 5-6 describe using pool noodles to teach mitotis and meiosis, as shown below Pool noodles are great for allowing the students to create many different cross-over events and see the consequences, e.g., recombinant and parental (non-recombinant) chromosomes that will end up in gametes. Here’s one event: P = Parental homologs R = Recombinant A A a a A a A a b B B b b B B P R R P centromere b sister chromatids Activation of Gene Expression How do genes get “turned on” in response to signals? This skit brings the process to life, and helps students think about dynamic processes and the importance of drawing cartoon renditions. Example: How steroids (e.g. testosterone) turn on genes for maleness, a lesson designed by Roger Innes A description of the process in words: 1) Steroids bind to proteins called “receptors”. 2) Steroid receptors dimerize and bind DNA. 3) Steroid receptors that are bound to DNA recruit other proteins that function as “co-activators”. 4) Coactivators recruit RNA polymerase, which binds to the promoter of a gene and initiates transcription. I ask the students to create a living model depicting how testosterone “activates” expression of specific genes! I need a group of 4 ----> 2 folks are testosterone receptor 1 is coactivator 1 is RNA polymerase Using the proper sequence of events, act out the process of gene activation according to the following rules: - Testosterone must be perceived. - A gene with the following sequence GAGCGCATTATTATGCGCTC ||||||||||||||||||||! CTCGCGTAATAATACGCGAG! must be found. - Demonstrate the proper protein-protein and protein-DNA interactions. - What is the end result? The 96 students not acting out the living model direct the activities (the “fishbowl technique”; Silberman, 1996). testosterone receptors dimerized testosterone receptors with their testosterone “caps” dimerized testosterone receptors find and bind their target sequence coactivator is recruited RNA polymerase is recruited transcription of the target gene Assessment: Students are asked to 1) Depict the steps of gene activation by testosterone in cartoon form. 2) List 1 or 2 questions that this modeling exercise and their cartoon raised in their mind. Outcome: 1) Students realized the utility and importance of modeling … and how it can help them identify what they don’t understand. 2) Many students posed intellectually sophisticated questions, similar to those that scientists are currently asking and testing.