Download - Wiley Online Library

Molecular Microbiology (2009) 73(6), 1009–1019 䊏
doi:10.1111/j.1365-2958.2009.06841.x
First published online 28 August 2009
Cell division ring, a new cell division protein and
vertical inheritance of a bacterial organelle in
anammox planctomycetes
mmi_6841 1009..1019
Laura van Niftrik,1* Willie J. C. Geerts,2
Elly G. van Donselaar,2 Bruno M. Humbel,2
Richard I. Webb,3 Harry R. Harhangi,1
Huub J. M. Op den Camp,1 John A. Fuerst,3
Arie J. Verkleij,2 Mike S. M. Jetten1 and
Marc Strous1,4
1
Department of Microbiology, Institute for Water and
Wetland Research, Faculty of Science, Radboud
University Nijmegen, Heyendaalseweg 135, 6525 AJ
Nijmegen, the Netherlands.
2
Cellular Architecture and Dynamics, Utrecht University,
Padualaan 8, 3584 CH Utrecht, the Netherlands.
3
Department of Microbiology and Parasitology
(JAF)/Centre for Microscopy and Microanalysis (RIW),
University of Queensland, Brisbane, QLD 4072,
Australia.
4
Max Planck Institute for Marine Microbiology,
Celciusstrasse 1, 28359 Bremen, Germany.
Summary
Anammox bacteria are members of the phylum Planctomycetes that oxidize ammonium anaerobically and
produce a significant part of the atmosphere’s dinitrogen gas. They contain a unique bacterial organelle,
the anammoxosome, which is the locus of anammox
catabolism. While studying anammox cell and anammoxosome division with transmission electron
microscopy including electron tomography, we
observed a cell division ring in the outermost compartment of dividing anammox cells. In most Bacteria,
GTP hydrolysis drives the tubulin-analogue FtsZ to
assemble into a ring-like structure at the cell division
site where it functions as a scaffold for the molecular
machinery that performs cell division. However, the
genome of the anammox bacterium ‘Candidatus
Kuenenia stuttgartiensis’ does not encode ftsZ.
Genomic analysis of open reading frames with potential GTPase activity indicated a possible novel cell
division ring gene: kustd1438, which was unrelated to
Accepted 30 July, 2009. *For correspondence. E-mail l.vanniftrik@
science.ru.nl; Tel. (+31) 24 3652563; Fax (+31) 24 3652830.
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd
ftsZ. Immunogold localization specifically localized
kustd1438 to the cell division ring. Genomic analyses
of other members of the phyla Planctomycetes and
Chlamydiae revealed no putative functional homologues of kustd1438, suggesting that it is specific
to anammox bacteria. Electron tomography also
revealed that the bacterial organelle was elongated
along with the rest of the cell and divided equally
among daughter cells during the cell division
process.
Introduction
Anaerobic ammonium-oxidizing (anammox) bacteria
perform an important process in the global nitrogen cycle
and produce a large part of the atmosphere’s dinitrogen
gas (Arrigo, 2005). They are deep-branching members of
the phylum Planctomycetes, a group known to possess a
unique shared cell plan in which intracellular compartments are bounded by membranes (Lindsay et al., 2001;
Fuerst, 2005). In anammox bacteria a major compartment, the anammoxosome (Fig. 1A and B), is the locus of
anammox catabolism (van Niftrik et al., 2004; 2008a).
This bacterial organelle is bounded by a single bilayer
membrane mainly consisting of unique cyclobutane-ring
ladderane lipids (Sinninghe Damsté et al., 2002).
Membrane-bounded organelles and vacuoles are highly
unusual among prokaryotes, the absence of such structures being one of their defining features. The biogenesis
of organelles by bacteria is still largely unexplored. How
anammox bacteria divide is unknown altogether, apart
from the fact that it is a very slow process. The doubling
time of these bacteria is in the order of weeks (Strous
et al., 1998), rather than the minutes of model organisms
such as Escherichia coli.
Cell division is perhaps one of the most complicated
tasks in the life cycle of bacteria. It has been studied most
extensively in a number of model organisms, such as
E. coli, where it is performed and regulated by the
divisome. The divisome is a multi-protein complex with
FtsZ (fts = filamentous temperature-sensitive) as the key
player (Dai and Lutkenhaus, 1991). Driven by GTP
hydrolysis, FtsZ assembles into a ring-like structure at
1010 L. van Niftrik et al. 䊏
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1009–1019
Cell division of anammox bacteria 1011
Fig. 1. Diagram explaining anammox ultrastructure and transmission electron micrographs showing anammox cell division phases in
K. stuttgartiensis.
A. Schematic representation of a non-dividing, single cell. The cell plan is proposed to be divided into three cytoplasmic compartments
separated by single bilayer membranes (Lindsay et al., 2001; Fuerst, 2005). The outer compartment, the paryphoplasm, is defined on its outer
side by the cytoplasmic membrane and cell wall and on the inner side by the intracytoplasmic membrane. The second compartment, the
riboplasm, contains ribosomes and the nucleoid. The third and innermost compartment, the anammoxosome, is free of ribosomes, packed
with tubule-like structures and iron-rich particles (van Niftrik et al., 2008b), and bounded by the anammoxosome membrane.
B. Non-dividing cell.
C. Phase 1: appearance of division ring.
D. Phase 2: invagination of cell wall.
E. Phase 3: doubling in cell size.
F. Phase 4: constriction.
Arrows and insets: division ring, scale bars: 500 nm.
midcell (Bi and Lutkenhaus, 1991; de Boer et al., 1992;
RayChaudhuri and Park, 1992; Mukherjee and Lutkenhaus, 1994; Ma et al., 1996), recruits at least 14 other
proteins (Vicente et al., 2006) and constricts to separate
the two daughter cells. Of the 15 proteins that form the
divisome – FtsZ, FtsA, ZipA, ZapA, FtsE, FtsX, FtsK,
FtsQ, FtsB, FtsL, FtsW, FtsI, FtsN, AmiC and EnvC – 10
(underlined proteins) are essential for cell division (Goehring and Beckwith, 2005). The 10 essential divisome
proteins are proposed to be recruited in a concerted mode
of assembly (RayChaudhuri and Park, 1992) and each
protein requires all upstream proteins to localize. In this
concerted mode of assembly, the so-called FtsAindependent divisomal complex (FtsK, FtsQ, FtsB, FtsL,
FtsW and FtsI) is believed to assemble independently
from the Z-ring complex (ZipA, FtsA and FtsZ) and FtsN
and to be recruited to midcell once the Z-ring complex is
established (Goehring et al., 2006; Vicente and Rico,
2006). In E. coli and most other bacteria, six of the divisome proteins are encoded in an operon, the division cell
wall (dcw) gene cluster (Carrión et al., 1999), together
with genes involved in peptidoglycan precursor biosynthesis (see Fig. 2A). The bacterial FtsZ ring itself has proved
difficult to observe directly within cells (in vivo) at molecular resolution under the electron microscope (Margolin,
2000; Vicente et al., 2006), but recently cytoplasmic structures and filaments that could be interpreted as cytoskeletal elements driving cell division (i.e. FtsZ) have been
described (Briegel et al., 2006; Zuber et al., 2006; Li et al.,
2007). With hundreds of bacterial genomes sequenced at
present it appears that the key division genes are almost
always conserved. There are a few exceptions, most
notably members of the Planctomycetes and Chlamydiae,
among bacteria the only phyla with no obvious homologue
for the otherwise ubiquitous cell division gene ftsZ
(Margolin, 2005; Wagner and Horn, 2006).
In the present study we investigated cell and organelle
division of two anammox planctomycetes using transmission electron microscopy including electron tomography.
We show that during anammox cell division, the bacterial
organelle is divided among the daughter cells and that
despite the absence of ftsZ in the genome of the
anammox bacterium ‘Candidatus Kuenenia stuttgartiensis’, a division ring is present. The genome was searched
and, based on the presence of an ATP/GTP binding site
and associated synergy loops, a possible novel cell division ring gene was identified that was unrelated to ftsZ.
Immunogold localization using an antibody raised against
the encoded protein showed that it was indeed part of the
division ring. Genomic analyses of other Planctomycetes
and Chlamydiae revealed no putative functional homologues of the newly identified gene, suggesting that it is
specific to anammox bacteria.
Results
We used transmission electron microscopy including electron tomography to study cell division in two anammox
planctomycetes: ‘Candidatus Kuenenia stuttgartiensis’
and ‘Candidatus Brocadia fulgida’. Both organisms were
observed to divide by constrictive binary fission, as no
septum was visible (Fig. 1). During the process of cell
division, the intracellular anammoxosome compartment
was also divided among the daughter cells (Fig. 1). The
first sign of cell division was the appearance of a division
ring in the outermost compartment, the paryphoplasm
(phase 1; Fig. 1C), followed by a slight invagination of the
cell wall (phase 2; Fig. 1D, Movies S1.1 and S1.2). The cell
then doubled in size by elongation of the two poles (phase
3; Fig. 1E), during which the anammoxosome also became
elongated and slightly invaginated. After elongation, the
constriction continued until the cells were almost entirely
pinched off (phase 4; Fig. 1F, Movies S2.1–S2.6). In this
way the anammoxosome was divided equally among the
daughter cells. Membrane links between the anammoxosome and paryphoplasm compartment were not observed,
either in hundreds of thin sections or in electron tomograms
collected from cells at different stages of the cell cycle. This
indicates that the anammoxosome remains a separate
entity during the entire cell cycle.
In all phases of cell division, a division ring was clearly
visible as a bracket-shaped, electron-dense structure in
the paryphoplasm. The ring was situated at a constant
distance of 5–6 nm from the cytoplasmic membrane
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1009–1019
1012 L. van Niftrik et al. 䊏
Fig. 2. Comparison between K. stuttgartiensis (Strous et al., 2006) and E. coli K-12 MG1655 (Blattner et al., 1997) cell division genes.
A. E. coli dcw operon (NCBI Accession Numbers NP_414623-NP_414638).
B. K. stuttgartiensis dcw operon (NCBI Accession Numbers CAJ73119-CAJ73133) with per cent identities to E. coli genes.
C. Other E. coli divisome genes (NCBI Accession Numbers NP_415410, NP_416907, NP_417228, NP_417294, NP_417386, NP_417919,
NP_417920, NP_418070 and NP_418368 respectively).
D. Other K. stuttgartiensis divisome genes (NCBI Accession Numbers CAJ75021, CAJ72236, CAJ73638 and CAJ73639 respectively)
with per cent identities to E. coli genes.
E. K. stuttgartiensis putative cell division ring protein (ORF kustd1438, NCBI Accession Number CAJ72183) showing signal peptide, ATP/GTP
binding site, synergy loops, staphylocoagulase repeats, polymorphic membrane protein repeats, bacterial neuraminidase repeats and antibody
target.
suggesting its association with this membrane. The
width of the ring (longest side in transsection) increased
significantly during the different cell division phases:
from on average 27 nm (phase 1), to 42 nm (phase 2),
to 52 nm (phase 3), to 111 nm (phase 4). The thickness
of the ring (shortest side in transsection) also increased
significantly from on average 5 nm (phase 1), to 6 nm
(phase 2), to 8 nm (phase 3), to 9 nm (phase 4). Threedimensional modelling of the presently observed structure in anammox cells indicated that it was a continuous
ring without (major) gaps (Fig. 3). The contrast of the
paryphoplasm and the varying way the ring was secFig. 3. Snapshots of electron tomogram
(right pane) and model (left pane) showing
cytoplasmic membrane (in the model in dark
grey) and continuous division ring (in the
model in white) at the anammox cell division
site (simplified model from Movie S2.6
B. fulgida cell division phase 4).
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1009–1019
Cell division of anammox bacteria 1013
tioned resulted in variation of clarity of the ring in different tomograms. In some tomograms the ring structure
was visible but less distinct (Movie S1.1) and in these
one might question the continuity of the ring structure.
In other tomograms with greater contrast the ring
structure was clearly continuous (Fig. 3, Movie S2.3)
and in thin sections of dividing cells the ring structure
was also always observed. Therefore, we modelled
the structure as a continuous ring here (Movie S1.2),
even though the occurrence of small gaps could not
always be excluded. In tomograms and thin sections
of single, non-dividing cells the ring was completely
absent. We estimated the duration of the constriction
of the ring by counting the proportion of dividing cells
in thin sections (369 cells were analysed) and electron
tomograms (nine tomograms of what appeared in 2D
to be non-dividing cells were analysed). This analysis
indicated that time-wise ring constriction took 55 days,
over two-thirds of the length of the total cell cycle
(66 days).
In the search for possible candidates for genes encoding
division ring proteins, the Kuenenia stuttgartiensis genome
(Strous et al., 2006) was investigated for all 15 known cell
division genes (Fig. 2). Of the 15 E. coli divisome genes,
putative homologues to eight were found with sequence
identities ranging between 20% and 43%. The genes ftsL,
ftsI, ftsW and ftsQ were part of a putative dcw operon (see
also Pilhofer et al., 2008) as in E. coli (Blattner et al., 1997)
(Fig. 2A and B). Other putative orthologues of divisome
genes, ftsK, ftsB, ftsX and ftsE, were not organized in
operons (Fig. 2C and D). Of the 10 known essential cell
division genes, the so-called FtsA-independent divisomal
complex (Goehring et al., 2006; Vicente and Rico, 2006)
(ftsK, ftsQ, ftsB, ftsL, ftsW and ftsI ) was complete.
Clear homologues of genes encoding the Z-ring
complex itself (ftsZ, ftsA and zipA) and ftsN were not
found in the K. stuttgartiensis genome. More sensitive
searches with the FtsZ and tubulin signature domains
present in prosite and PFAM were also negative.
In search for a protein that might substitute for the
function of FtsZ, we focused on open reading frames
(ORFs) containing a GTP binding site. One ORF
(kustd1438, NCBI Accession Number CAJ72183) in particular drew attention (Fig. 2E). This ORF codes for a
3690-amino acids (aa)-long protein that contains an ATP/
GTP binding site (P loop; PROSITE PS00017), two
synergy loops [also called T7 loop, involved in GTPase
activity (Dai et al., 1994)] and a 22-aa-long signal peptide
(Fig. 2E). The presence of a signal peptide was consistent
with the location of the division ring in the paryphoplasm,
the outermost compartment of the anammox cell. Like
FtsZ, kustd1438 was characterized by a high number of
alanine and glycine residues (> 10%). In addition, and
unlike FtsZ, kustd1438 also contained large amounts of
threonine (19%) and serine (10.4%). Together these four
aa comprised over 50% of the kustd1438 protein
sequence. This type of skewed aa composition is characteristic for structural proteins that form higher-order structures, such as the division ring, the cytoskeleton and the
cell wall. The structural role of kustd1438 was further
supported by sensitive Hidden Markov searches (Coin
et al., 2003). These searches indicated the presence of
four staphylocoagulase repeats (PF04022), three
polymorphic membrane protein repeats (PF02415) and
three bacterial neuraminidase repeats or Asp-boxes
(PF02012). ORF kustd1438 was structurally different from
both FtsZ and tubulin: it did not contain the FtsZ protein
signatures 1 and 2 (PROSITE PS01134 and PS01135),
the latter of which contains the GTP binding region (Díaz
et al., 2001) (also called tubulin signature motif or T3
loop). Neither of the two tubulin/FtsZ domains (PF00091
and PF03953) was present. In conclusion, sequence
analysis indicated that kustd1438 is a large structural
protein with predicted ATP/GTP hydrolysis activity and
thus potentially capable of effecting supra molecular
motion. However, on the level of their primary structure,
kustd1438 and FtsZ are not homologous.
To investigate whether kustd1438 could indeed be
involved in anammox cell division, we first investigated
the presence of kustd1438 mRNA by real-time reverse
transcription PCR using specific primers on RNA
extracted from K. stuttgartiensis cells. This showed that
kustd1438 was indeed transcribed. The transcription of
kustd1438 was also confirmed by Illumina sequencing of
reverse-transcribed K. stuttgartiensis mRNA (data not
shown). Subsequently, we investigated the location of the
kustd1438 protein in the K. stuttgartiensis cell using
immunogold localization. For this purpose, we expressed
464 aa (including the ATP/GTP binding site) of ORF
kustd1438 (Fig. 2E) in E. coli. The identity of the heterologously expressed protein was verified by MALDI-TOF MS
peptide mass fingerprinting of a tryptic digest of the
Ni-NTA purified protein (five peptides, total coverage
33%). We then used this protein to immunize a rabbit after
which the affinity and specificity of the produced antibody,
anti-kustd1438, for its target was confirmed by immunoblotting (Fig. 4). Finally, immunogold localization using antikustd1438 unambiguously located the protein to the
division ring (Fig. 5A–F). After incubation with antikustd1438, 54% of the division rings were labelled in 50
dividing cells inspected and very few non-division ring
labels were observed (Fig. 5E). Incubation with the preimmune serum resulted in no labelling at all.
Discussion
We investigated anammox cell and organelle division
using transmission electron microscopy including electron
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1009–1019
1014 L. van Niftrik et al. 䊏
Fig. 4. Immunoblot analysis of the antibody (anti-kustd1438)
targeting 464 aa of K. stuttgartiensis ORF kustd1438 that were
heterologously expressed in E. coli. The SDS-PAGE gels were
loaded with 50 mg/lane K. stuttgartiensis protein (cell free extract).
A. 10% SDS-PAGE gel blotted onto a cellulose-nitrate membrane.
Lane 1, marker (PageRuler Prestained Protein Ladder Plus,
Fermentas, St. Leon-Rot, Germany); lane 2, incubation with
anti-kustd1438; lane 3, incubation with the pre-immune serum
instead of anti-kustd1438; lane 4, incubation with blocking buffer
instead of anti-kustd1438.
B. 6% SDS-PAGE gel blotted onto a cellulose-nitrate membrane.
Lane 1: marker; lane 2, incubation with anti-kustd1438; lane 3,
incubation with the pre-immune serum instead of anti-kustd1438.
In both the 10% and 6% gels blotted onto cellulose-nitrate
membranes, anti-kustd1438 shows specific binding to a protein of
the expected size (~370 kDa).
tomography. Anammox bacteria were observed to divide
by constrictive binary fission with an equal division of the
anammoxosome compartment between the two daughter
cells. Further, a division ring was present in all dividing
anammox cells. The genome of the anammox bacterium
K. stuttgartiensis was investigated for known cell division
genes and found to contain the FtsA-independent
complex (Goehring et al., 2006; Vicente and Rico, 2006)
while the Z-ring complex, which includes the division ring
gene ftsZ, was absent. Further genome analysis identified
a putative novel division ring gene unrelated to ftsZ:
kustd1438. Immunogold localization studies using an antibody directed at kustd1438 located the protein to the
anammox cell division ring.
The bacterial cell cycle proceeds differently in different
genera. In the canonical ‘E. coli version’ (Nanninga,
2001), it starts with the build-up of ATP, followed by the
duplication of the chromosome and ends with the actual
septation and separation of the daughter cells (cell division or cytokinesis). In the anammox case the first sign of
cell division was the appearance of the division ring after
which cell growth proceeded while the ring contracted,
leading to a high prevalence of so-called ‘diplococci’. An
estimation of the duration of the ring constriction indicated
that time-wise ring constriction took 55 days, over twothirds of the length of the total cell cycle (66 days). Thus,
the constriction of the ring was 10 000 times slower than
cytokinesis in the rod-shaped E. coli, which takes only a
third of the total 20 min cell cycle.
The observation that anammox bacteria divide by constrictive binary fission was unexpected because all other
members of the phylum Planctomycetes so far examined
reproduce by budding (Fuerst, 1995). Further, neither
transmission electron microscopy nor electron tomography showed membrane links between the anammoxosome and paryphoplasm compartment, indicating that the
anammoxosome remains a separate entity during the
entire cell cycle. However, because membrane topology
is never preserved completely, it is impossible to entirely
rule out the possibility that the anammoxosome membrane is not somehow derived from the intracytoplasmic
membrane. The anammox division ring was visible as a
bracket-shaped, electron-dense structure in the paryphoplasm with transmission electron microscopy. This 2D
appearance was comparable to that of the putative
Enterococcus gallinarum FtsZ protein (Zuber et al., 2006),
and to that of the eukaryotic organelles chloroplast
(plastid) and mitochondrion, where division is performed
by ring complexes consisting of FtsZ, plastid-dividing or
mitochondrion-dividing apparatus and dynamin rings
(Miyagishima et al., 2003). Although small gaps could not
be excluded for some tomograms, electron tomography
showed that the presently observed structure in anammox
cells was a continuous ring, unlike the discontinuous ringlike bundle and the individual filaments recently observed
in Caulobacter crescentus (Briegel et al., 2006; Li et al.,
2007).
Of the 10 essential cell division genes, the FtsAindependent divisomal complex was present in the
K. stuttgartiensis genome. This higher-order complex is
believed to assemble independently from the Z-ring
complex and to be recruited to midcell once the Z-ring
complex is established (Goehring et al., 2006; Vicente
and Rico, 2006). Clear homologues of genes encoding
the Z-ring complex itself, including ftsZ, were not found in
Fig. 5. Transmission electron micrographs of cryofixed, freeze-substituted and cryosectioned K. stuttgartiensis cells showing immunogold
localization of the antibody directed against ORF kustd1438. The antibody localizes kustd1438 to the division ring (insets).
A–F. Sectioned cells blocked with 2% skim milk powder and treated with anti-kustd1438. This antibody targets 464 aa of ORF kustd1438 that
were heterologously expressed in E. coli. Scale bars: 250 nm.
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1009–1019
Cell division of anammox bacteria 1015
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1009–1019
1016 L. van Niftrik et al. 䊏
the K. stuttgartiensis genome. The genome of
K. stuttgartiensis (an environmental genome) is estimated
to be 98% complete so it is still possible that ftsZ was
missing from the assembly. However, all related bacteria
with finished genomes certainly lack ftsZ and the
K. stuttgartiensis dcw operon certainly does not encode it,
strengthening the position that K. stuttgartiensis most
probably lacks ftsZ.
In the search for a protein that might form a higherorder structure, kustd1438 was identified as a likely
candidate. An antibody raised against part of kustd1438
located the protein to the division ring in immunogold
localization studies. These results show that ORF
kustd1438 is part of the K. stuttgartiensis divisome
complex and on basis of sequence analysis might actively
contribute to ring constriction or assembly via GTP
hydrolysis. One could speculate that kustd1438 substitutes for the role of FtsZ, forms a ring structure at the site
of anammox cell division and recruits the FtsAindependent complex (Goehring et al., 2006; Vicente and
Rico, 2006) to perform anammox cell division.
There are large differences between anammox cell division and cell division involving FtsZ. First, on the level of
their primary structure, kustd1438 and FtsZ are not
homologous; the domain organization of kustd1438 is
completely different. For more detailed analyses of
kustd1438, X-ray crystallography of purified kustd1438
should be performed. Second, the observed surface area
of the anammox division ring increased during constriction (see Fig. 1). This was also observed for the outer
plastid-dividing and mitochondrion-dividing rings (Miyagishima et al., 1999). For FtsZ, changes in surface area
would not be expected considering its dynamic nature
with continuous assembly and disassembly of protofilaments (Stricker et al., 2002). Recently, electron cryotomography showed that the putative FtsZ ‘ring’ of
C. crescentus consists of short individual filaments situated randomly near the division site instead of a complete
ring-like structure (Li et al., 2007).
It is tempting to speculate about a role in cell division of
similar proteins in the evolutionarily related ftsZ-less
bacteria. However, no kustd1438 homologues, at least on
the basis of primary sequence similarity or structure, were
detected among the phyla Chlamydiae and Planctomycetes and the more distantly related Verrucomicrobia.
Thus together with the recently detected divergent homologues of FtsZ in some members of the phylum Verrucomicrobia (Pilhofer et al., 2007; Yee et al., 2007), our
results suggest that in this lineage there may be no
common theme in cell division other than the absence of
FtsZ. In view of the amazingly different lifestyles among
this lineage, from obligate intracellular parasites to the
chemolithoautotrophic anammox bacteria, that is perhaps
not surprising.
Experimental procedures
Anammox enrichment cultures
Samples containing an 80% enrichment culture of either
K. stuttgartiensis or B. fulgida were taken from a 2 l sequencing batch reactor or a 15 l continuous reactor modified from
Strous et al. (1998).
Sample preparation for transmission electron
microscopy: cryofixation, freeze-substitution and
Epon embedding
Kuenenia stuttgartiensis cells were cryofixed by highpressure freezing, freeze-substituted in acetone containing
2% osmium tetroxide, 0.2% uranyl acetate and 1% H2O,
embedded in Epon resin and sectioned as described previously (van Niftrik et al., 2008b).
For
B. fulgida
cell
division
phase
4
early
(Movies S2.1–S2.6) the sample was processed as described
previously (van Niftrik et al., 2008b) with the following
modifications. Cryofixed by high-pressure freezing in a
HPM010 HPF (BAL-TEC, Balzers, Liechtenstein). Freezesubstituted in anhydrous acetone containing 2% osmium
tetroxide and 0.5% uranyl acetate. Samples were kept at
-90°C for 24 h, -80°C for 24 h, brought to -45°C at 2°C h-1,
kept at -45°C for 2 h, brought to 0°C at 22.5°C h-1 and
brought to 20°C at 10°C h-1. Samples were washed four
times for 20 min with anhydrous acetone. Epon was polymerized for 24 h at 60°C.
Sample preparation for immunogold localization:
cryofixation, freeze-substitution and cryosectioning
(rehydration method) (van Donselaar et al., 2007)
Kuenenia stuttgartiensis cells were cryofixed by highpressure freezing and freeze-substituted in acetone containing 0.5% glutaraldehyde and 1% H2O as described previously
(van Niftrik et al., 2008b). After freeze-substitution, fixation
was continued for 60 min on ice. Samples were rehydrated in
a graded acetone series on ice: 95%, 90%, 80% and 70%
acetone in water containing 0.5% glutaraldehyde, then 50%
and 30% acetone in PHEM buffer (60 mM Pipes, 25 mM
HEPES, 10 mM EGTA, 2 mM MgCl2, pH 6.9) containing 0.5%
glutaraldehyde, and finally 0.5% glutaraldehyde in PHEM
buffer. Samples were rinsed in PHEM buffer and embedded
in 12% gelatin in PHEM buffer. The gelatin-embedded cells
were cut into small cubes (1–2 mm3) under the stereo microscope, infiltrated overnight at 4°C with 2.3 M sucrose in
PHEM buffer and frozen in liquid nitrogen.
Samples were cryosectioned using a cryoultramicrotome
UC6/FC6 (Leica Microsystems, Vienna, Austria). Cryosections (55 nm) were picked up with a drop of 1% methyl
cellulose and 1.15 M sucrose in PHEM buffer and transferred
to formvar-carbon-coated copper hexagonal 100 mesh grids
for immunogold localization.
Transmission electron microscopy
Ultra-thin sections of Epon-embedded cells were investigated
at 80–120 kV and cryosections were investigated at 80 kV in
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1009–1019
Cell division of anammox bacteria 1017
a transmission electron microscope (Tecnai12, FEI Company,
Eindhoven, the Netherlands). Images were recorded using a
CCD camera (MegaView II, AnalySis).
Electron tomography
Electron tomography was performed as described previously
(van Niftrik et al., 2008b).
Real-time reverse transcription PCR analysis
RNA was isolated from K. stuttgartiensis cells using the
Promega RNA extraction kit (Promega, Madison, USA)
according to the manufacturer’s protocol. Reverse transcription was performed with a reverse primer on nucleotide position 8487 (see below) and RevertAid M_MulV (Fermentas,
St. Leon-Rot, Germany). Transcription products of kustd1438
were detected using specific primers [reverse primer on
nucleotide position 8487 (CTCGAGTGTCCCTGTGGTA
AAACTC); forward primer on nucleotide position 8217
(CAAGCCCGGCGTATGGCGAC)]. Real-time PCR was done
using the iQ custom SYBR Green supermix kit (Bio-Rad,
Hercules, USA), according to the manufacturer’s instructions.
The PCR programme on the Bio-Rad MyiQ was 3 min 95°C
and 40 cycles of 30 s at 95°C, 30 s at 54°C and 30 s at 72°C.
Two negative controls were performed: real-time PCR
without a template and real-time PCR using the isolated RNA
as the template (without the reverse transcription step). As a
positive control, real-time reverse transcription PCR was performed with specific primers targeting the K. stuttgartiensis
hydrazine hydrolase gene (unpublished results).
Antibody production
For the K. stuttgartiensis ORF kustd1438 antibody, we
expressed and purified the region encoding the ATP/GTP
binding site in E. coli as described previously (Harhangi et al.,
2002), with the following changes. Two primers were
designed on the sequence; a forward primer on nucleotide
position 7114 (GGATCCTTTTCATCCG) and a reverse primer
on nucleotide position 8487 (CTCGAGTGTCCCTGTGG
TAAAACTC). For directional cloning, an XhoI restriction site
was included in the reverse primer; the forward primer
already contained a BamHI site. As an expression vector,
pET30a (Novagen, Darmstadt, Germany) was used, and as
the host, BL21 cells (Novagen, Darmstadt, Germany). The
heterologous expressed 464 aa protein was purified using
the nickel-nitrilotriacetic acid protein purification system
(Qiagen, Venlo, the Netherlands) with an 8 M urea, 50 mM
phosphate buffer with different pH (5.5, 5.0 and 4.5). The
identity of the expressed protein was verified by MALDI-TOF
MS peptide mass fingerprinting of a tryptic digest of the
Ni-NTA purified protein (Harhangi et al., 2002). The protein
was used in a 3 month immunization protocol to immunize a
rabbit (SEQLAB Sequencing Laboratories Göttingen GmbH,
Göttingen, Germany). This was used as the primary antibody
(anti-kustd1438, polyclonal, crude serum) in immunoblotting
and immunogold localization as described below.
PAGE (sodium dodecyl sulphate polyacrylamide gel electrophoresis) gel and transferred to a cellulose-nitrate membrane
(Schleicher and Schuell GmbH, Dassel, Germany) with the
semidry transfer cell blotting system (Bio-Rad, Veenendaal,
the Netherlands). Blotting was performed at 50 mA for 3 h
with a transfer buffer that consisted of 25 mM Tris and
192 mM glycine including 20% methanol in the anode buffer
and 0.05% SDS in the cathode buffer. After blotting, the blot
was dried and stored at 4°C until further use. Blots stored at
4°C were washed in MilliQ for 30 min and incubated in blocking buffer: 1% bovine serum albumin in Tris-buffered saline
(TBS; 10 mM Tris-HCl, 0.9% NaCl, pH 7.4) for 1 h. The blot
was then incubated for 2 h in either blocking buffer or rabbit
pre-immune serum diluted 250-fold in blocking buffer as the
negative controls or primary antibody diluted 250-fold in
blocking buffer. The blot was washed three times for 10 min in
TBS containing 0.05% Tween20 and incubated for 1 h in
monoclonal mouse anti-rabbit IgG alkaline phosphatase conjugate (Sigma, Zwijndrecht, the Netherlands) diluted
150 000-fold in blocking buffer. The blot was washed two
times for 10 min in TBS containing 0.05% Tween20 and two
times for 10 min in TBS. The blot was incubated with the
BCIP/NBT Liquid Substrate System (Sigma, Zwijndrecht, the
Netherlands) for 5 min, rinsed in excess amounts of MilliQ
and dried. All blots were scanned with the same settings.
Immunogold localization
Grids containing ultra-thin cryosections of K. stuttgartiensis
cells were washed for 30 min at 37°C with phosphate-buffered
saline (PBS; 0.1 M phosphate, 137 mM NaCl, 2.7 mM KCl,
pH 7.4), incubated for 10 min at room temperature on drops of
PBS containing 20 mM glycine and blocked for 15 min on
drops of PBS containing 2% skim milk powder. After blocking,
the grids were incubated for 60 min with the primary antibody
80-fold diluted in PBS containing 2% skim milk powder and
washed for 12 min on drops of PBS containing 0.2% skim milk
powder. Grids were incubated for 20 min with the secondary
antibody; protein A coupled to 10 nm gold (PAG-10), 80-fold
diluted in PBS containing 2% skim milk powder and washed for
14 min on drops of PBS. The cryosections on grids were fixed
for 5 min with PBS containing 1% glutaraldehyde and washed
for 10 min on drops of water.
Cryosections were poststained for 5 min with 2% uranyl
acetate in 0.15 M oxalic acid pH 7.4 and embedded for 5 min
in 1.8% methyl cellulose containing 0.4% aqueous uranyl
acetate on ice after which they were air-dried.
Several control treatments were performed. As a positive
control, grids were incubated with rabbit anti-anammox
hydroxylamine oxidoreductase (Schalk et al., 2000) as the
primary antibody. Negative controls were: incubation with
pre-immune serum instead of primary antibody, incubation
with affinity-isolated rabbit anti-influenza haemagglutinin
(anti-HA, H6908, Sigma, Zwijndrecht, the Netherlands) as a
primary antibody and incubation with blocking buffer instead
of primary antibody.
Alignments and signal peptide prediction
Immunoblotting
Kuenenia stuttgartiensis proteins (cell-free extract prepared
using French press) were separated on a 6% and 10% SDS-
In the search for possible FtsZ homologues or substitutes,
the PIR pairwise alignment tool (http://pir.georgetown.edu/
pirwww/search/pairwise.shtml) was used. For the prediction
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1009–1019
1018 L. van Niftrik et al. 䊏
of signal peptides, the SignalP tool was used (http://www.cbs.
dtu.dk/services/SignalP/) using hidden Markov models and
Gram-negative trained models.
Reactor doubling time
The reactor doubling time was determined with the anammox
biomass yield (Strous et al., 1998) (0.07 C-mol/mol NH4+),
ammonium consumption (0.19 mmol ammonium/min) and
total protein content (19 g). The ammonium consumption was
calculated by assuming that per 1.32 nitrite, 1 ammonium is
consumed (Strous et al., 1998) and the total protein content
was measured with the Biuret protein determination (Stickland, 1951).
Relevant accession numbers
NCBI (GenBank) (http://www.ncbi.nlm.nih.gov/)
K. stuttgartiensis:
CAJ72183, CAJ73119 to CAJ73133, CAJ75021, CAJ72236,
CAJ73638, CAJ73639
CT030148, CT573071 to CT573074
E. coli K-12 MG1655:
NP_414623 to NP_414638, NP_415410, NP_416907,
NP_417228, NP_417294, NP_417386, NP_417919,
NP_417920, NP_418070, NP_418368
Prosite (http://www.expasy.ch/prosite/)
Ps01134, ps01135, ps00017
Pfam (http://www.sanger.ac.uk/Software/Pfam/)
Pf02415, pf00091, pf03953, pf04022, pf02012
Acknowledgements
We thank Professor Gijs Kuenen for discussions, Katinka van
de Pas-Schoonen and Boran Kartal for the anammox enrichment cultures and anammox crude extract protocol, and
Cathelène Carrière and Benjamin Lee for structural
sequence analysis of kustd1438.
References
Arrigo, K.R. (2005) Marine microorganisms and global nutrient cycles. Nature 437: 349–355.
Bi, E., and Lutkenhaus, J. (1991) FtsZ ring structure associated with division in Escherichia coli. Nature 354: 161–
164.
Blattner, F.R., Plunkett,G., III, Bloch, C.A., Perna, N.T.,
Burland, V., Riley, M., et al. (1997) The complete genome
sequence of Escherichia coli K-12. Science 277: 1453–
1462.
de Boer, P., Crossley, R., and Rothfield, L. (1992) The essential bacterial cell-division protein FtsZ is a GTPase. Nature
359: 254–256.
Briegel, A., Prabha Dias, D., Li, Z., Jensen, R.B., Frangakis,
A.S., and Jensen, G.J. (2006) Multiple large filament
bundles observed in Caulobacter crescentus by electron
cryotomography. Mol Microbiol 62: 5–14.
Carrión, M., Gómez, M.J., Merchante-Schubert, R., Dongarrá, S., and Ayala, J.A. (1999) mraW, an essential gene
at the dcw cluster of Escherichia coli codes for a cytoplas-
mic protein with methyltransferase activity. Biochimie 81:
879–888.
Coin, L., Bateman, A., and Durbin, R. (2003) Enhanced
protein domain discovery by using language modeling
techniques from speech recognition. Proc Natl Acad Sci
USA 100: 4516–4520.
Dai, K., and Lutkenhaus, J. (1991) ftsZ is an essential cell
division gene in Escherichia coli. J Bacteriol 173: 3500–
3506.
Dai, K., Mukherjee, A., Xu, Y., and Lutkenhaus, J. (1994)
Mutations in ftsZ that confer resistance to SulA affect the
interaction of FtsZ with GTP. J Bacteriol 175: 130–136.
Díaz, J.F., Kralicek, A., Mingorance, J., Palacios, J.M.,
Vicente, M., and Andreu, J.M. (2001) Activation of cell
division protein FtsZ. Control of switch loop T3 conformation by the nucleotide gamma-phosphate. J Biol Chem
276: 17307–17315.
van Donselaar, E., Posthuma, G., Zeuschner, D., Humbel,
B.M., and Slot, J.W. (2007) Immunogold labeling of cryosections from high-pressure frozen cells. Traffic 8: 471–
485.
Fuerst, J.A. (1995) The planctomycetes: emerging models for
microbial ecology, evolution and cell biology. Microbiology
141: 1493–1506.
Fuerst, J.A. (2005) Intracellular compartmentation in
planctomycetes. Annu Rev Microbiol 59: 299–328.
Goehring, N.W., and Beckwith, J. (2005) Diverse paths to
midcell: assembly of the bacterial cell division machinery.
Curr Biol 15: 514–526.
Goehring, N.W., Gonzalez, M.D., and Beckwith, J. (2006)
Premature targeting of cell division proteins to midcell
reveals hierarchies of protein interactions involved in divisome assembly. Mol Microbiol 61: 33–45.
Harhangi, H.R., Steenbakkers, P.J.M., Akhmanova, A.,
Jetten, M.S.M., van der Drift, C., and Op den Camp, H.J.M.
(2002) A highly expressed family 1 b-glucosidase with
transglycosylation capacity from the anaerobic fungus
Piromyces sp. E2. Biochim Biophys Acta 1574: 293–
303.
Li, Z., Trimble, M.J., Brun, Y.V., and Jensen, G.J. (2007) The
structure of FtsZ filaments in vivo suggests a forcegenerating role in cell division. EMBO J 26: 4694–4708.
Lindsay, M.R., Webb, R.I., Strous, M., Jetten, M.S.M., Butler,
M.K., Forde, R.J., and Fuerst, J.A. (2001) Cell compartmentalisation in planctomycetes: novel types of structural
organization for the bacterial cell. Arch Microbiol 175: 413–
429.
Ma, X., Ehrhardt, D.W., and Margolin, W. (1996) Colocalization of cell division proteins FtsZ and FtsA to cytoskeletal
structures in living Escherichia coli cells by using green
fluorescent protein. Proc Natl Acad Sci USA 93: 12998–
13003.
Margolin, W. (2000) Themes and variations in prokaryotic cell
division. FEMS Microbiol Rev 24: 531–548.
Margolin, W. (2005) FtsZ and the division of prokaryotic cells
and organelles. Nat Rev Mol Cell Biol 6: 862–871.
Miyagishima, S., Itoh, R., Toda, K., Kuroiwa, H., and
Kuroiwa, T. (1999) Real-time analyses of chloroplast and
mitochondrial division and differences in the behavior of
their dividing rings during contraction. Planta 207: 343–
353.
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1009–1019
Cell division of anammox bacteria 1019
Miyagishima, S., Nishida, K., Mori, T., Matsuzaki, M., Higashiyama, T., Kuroiwa, H., and Kuroiwa, T. (2003) A plantspecific dynamin-related protein forms a ring at the
chloroplast division site. Plant Cell 15: 655–665.
Mukherjee, A., and Lutkenhaus, J. (1994) Guanine
nucleotide-dependent assembly of FtsZ into filaments.
J Bacteriol 176: 2754–2758.
Nanninga, N. (2001) Cytokinesis in prokaryotes and eukaryotes: common principles and different solutions. Microbiol
Mol Biol Rev 65: 319–333.
van Niftrik, L.A., Fuerst, J.A., Sinninghe Damsté, J.S.,
Kuenen, J.G., Jetten, M.S.M., and Strous, M. et al. (2004)
The anammoxosome: an intracytoplasmic compartment in
anammox bacteria. FEMS Microbiol Lett 233: 7–13.
van Niftrik, L., Geerts, W.J.C., van Donselaar, E.G., Humbel,
B.M., Webb, R.I., Fuerst, J.A., et al. (2008a) Linking ultrastructure and function in four genera of anaerobic
ammonium-oxidizing bacteria: cell plan, glycogen storage
and localization of cytochrome c proteins. J Bacteriol 190:
708–717.
van Niftrik, L., Geerts, W.J.C., van Donselaar, E.G., Humbel,
B.M., Yakushevska, A., Verkleij, A.J., et al. (2008b)
Combined structural and chemical analysis of the anammoxosome: a membrane–bounded intracytoplasmic compartment in anammox bacteria. J Struct Biol 161: 401–410.
Pilhofer, M., Rosati, G., Ludwig, W., Schleifer, K.-H., and
Petroni, G. (2007) Coexistence of tubulins and ftsZ in different Prosthecobacter species. Mol Biol Evol 24: 1439–
1442.
Pilhofer, M., Rappl, K., Eckl, C., Bauer, A.P., Ludwig, W.,
Schleifer, K.-H., and Petroni, G. (2008) Characterization
and evolution of cell division and cell wall synthesis genes
in the bacterial phyla Verrucomicrobia, Lentisphaerae,
Chlamydiae, and Planctomycetes and phylogenetic comparison with rRNA genes. J Bacteriol 190: 3192–3202.
RayChaudhuri, D., and Park, J.T. (1992) Escherichia coli
cell-division gene ftsZ encodes a novel GTP-binding
protein. Nature 359: 251–254.
Schalk, J., de Vries, S., Kuenen, J.G., and Jetten, M.S.M.
(2000) Involvement of a novel hydroxylamine oxidoreductase in anaerobic ammonium oxidation. Biochemistry 39:
5405–5412.
Sinninghe Damsté, J.S., Strous, M., Rijpstra, W.I.C.,
Hopmans, E.C., Geenevasen, J.A.J., van Duin, A.C.T.,
et al. (2002) Linearly concatenated cyclobutane lipids form
a dense bacterial membrane. Nature 419: 708–712.
Stickland, L.H. (1951) The determination of small quantities
of bacteria by means of the biuret reaction. J Gen Microbiol
5: 698–703.
Stricker, J., Maddox, P., Salmon, E.D., and Erickson, H.P.
(2002) Rapid assembly dynamics of the Escherichia coli
FtsZ-ring demonstrated by fluorescence recovery after
photobleaching. Proc Natl Acad Sci USA 99: 3171–3175.
Strous, M., Heijnen, J.J., Kuenen, J.G., and Jetten, M.S.M.
(1998) The sequencing batch reactor as a powerful tool for
the study of slowly growing anaerobic ammonium-oxidizing
microorganisms. Appl Microbiol Biotechnol 50: 589–596.
Strous, M., Pelletier, E., Mangenot, S., Rattei, T., Lehner, A.,
Taylor, M.W., et al. (2006) Deciphering the evolution and
metabolism of an anammox bacterium from a community
genome. Nature 440: 790–794.
Vicente, M., and Rico, A.I. (2006) The order of the ring:
assembly of Escherichia coli cell division components. Mol
Microbiol 61: 5–8.
Vicente, M., Rico, A.I., Martínez-Arteaga, R., and Mingorance, J. (2006) Septum enlightenment: assembly of bacterial division proteins. J Bacteriol 188: 19–27.
Wagner, M., and Horn, M. (2006) The Planctomycetes, Verrucomicrobia, Chlamydiae and sister phyla comprise a
superphylum with biotechnological and medical relevance.
Curr Opin Biotechnol 17: 241–249.
Yee, B., Lafi, F.F., Oakley, B., Staley, J.T., and Fuerst, J.A.
(2007) A canonical FtsZ protein in Verrucomicrobium spinosum, a member of the Bacterial phylum Verrucomicrobia
that also includes tubulin-producing Prosthecobacter
species. BMC Evol Biol 7: 37–44.
Zuber, B., Haenni, M., Ribeiro, T., Minnig, K., Lopes, F.,
Moreillon, P., and Dubochet, J. (2006) Granular layer in the
periplasmic space of Gram-positive bacteria and fine structures of Enterococcus gallinarum and Streptococcus
gordonii septa revealed by cryo-electron microscopy of
vitreous sections. J Bacteriol 188: 6652–6660.
Supporting information
Additional supporting information may be found in the online
version of this article.
Please note: Wiley-Blackwell are not responsible for the
content or functionality of any supporting materials supplied
by the authors. Any queries (other than missing material)
should be directed to the corresponding author for the article.
© 2009 The Authors
Journal compilation © 2009 Blackwell Publishing Ltd, Molecular Microbiology, 73, 1009–1019