Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Project in bioinformatics Conservation of antisense RNA and their target genes in Bacteria Pninit Shaked-Mishan Tal Kaminer Antisense RNA in bacteria Antisense RNA are small diffusible trascripts that pair to target RNAs to control their biological functions. Definition of the problem: E.coli has small RNA molecules that regulate gene expression. We want to find out whether those molecules are conserved in other bacteria. MicF RNA and his target gene OmpF: OmpF is a major E.coli outer membrane porin. MicF RNA inhibits OmpF expression in response to the environment. Unlike most other cases MicF and OmpF are partially complementary. The mechanism of inhibition is not completely clear. DicF and his target gene FtsZ: The FtsZ gene, which may be involved in initiation of division, is the target of several inhibitors including DicF RNA. Like the MicF case, DicF is only partially complementary to its target, the FtsZ mRNA and the DicF and FtsZ genes are unlinked. Our tools: 1. NCBI and PubMed For sequence search. 2. Blast and Pairwise blast for sequence alignment and homology. 3. RNA fold for structure prediction. MicF RNA : Actagaataactcccgctatcatcattaactttatttattaccgtcattcatttctgaat E.coli ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Actagaataactcccgctatcatcattaactttatttattaccgtcattcagttctgaat K.pneum Gtctgtttacccctatttcaaccggatgcctcgcat E.coli ||||||||||||||||||| ||||||||| |||||| Gtctgtttacccctatttcgaccggatgcttcgcat K.pneum Score = 167 bits (84), Expect = 2e-40 Identities = 93/96 (96%) Aaaacaaaaccttcactcgcaactagaataactcccgctatcatcattaactttatttat E.coli |||||| || ||||| ||||||||| |||| ||||||||||||||||||||||||||||| aaaacagaatcttcattcgcaactaaaatagtgaccgctatcatcattaactttatttat salmonella Taccgtcattcatttctgaatgtctgtttacccctatttcaaccggatgcctcgcattcg E.coli |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| taccgtcattcacttctgaatgtctgtttacccctatttcaaccggatgcttcgcattcg salmonella Score = 161 bits (81), Expect = 1e-38 Identities = 111/121 (91%) MicF RNA Fold: K.pneumoniae Salmonella E.coli OmpF gene : E.coli OmpF secondary structure: Conserved region DicF RNA and FtsZ gene: The blast results show no homology between DicF and other bacteria. FtsZ gene: The gene is highly conserved in bacteria. It plays an important role in cell division. Score = 1379 bits (717), Expect = 0.0 Identities = 1007/1152 (87%) E.coli Possible directions for future research: 1) Analyze other antisense RNA molecules of E.coli and their conservation in other bacteria. 2) Look for homology between antisense in E.coli and other organisms (not only bacteria) in the molecules that we examined. 3) Comparison of the conserved regions and RNA-RNA interaction regions between different antisense molecules in bacteria. 4) Searching for evolutionary motifs in antisense RNA.