* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download A Genetic Link Between an mRNA-Specific Translational
Proteolysis wikipedia , lookup
Interactome wikipedia , lookup
Epitranscriptome wikipedia , lookup
Gene therapy wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Genetic engineering wikipedia , lookup
Mitochondrion wikipedia , lookup
Gene therapy of the human retina wikipedia , lookup
Expression vector wikipedia , lookup
Gene nomenclature wikipedia , lookup
Genetic code wikipedia , lookup
Magnesium transporter wikipedia , lookup
Community fingerprinting wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Gene expression wikipedia , lookup
Gene regulatory network wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Mitochondrial replacement therapy wikipedia , lookup
Copyright 0 1990 by the Genetics Society of America A Genetic Link Between an mRNA-Specific Translational Activator and the Translation Systemin Yeast Mitochondria Pascal Haffier, Thomas W. McMullin and Thomas D. Fox Section of Genetics and Development, Cornell University, Zthaca,New York 14853-2703 Manuscript received November 30, 1989 Accepted for publicationMarch 24, 1990 ABSTRACT Translation of the Saccharomyces cerevisiae mitochondrial mRNA encoding cytochrome c oxidase subunit 111 (~0x111) specifically requires the products of at least three nuclear genes,PET122, PET494 and PET54. pet122 mutations that remove 24-67 amino acid residues from the carboxyterminus of thegeneproductwerefoundtobesuppressed by unlinkednuclearmutations.Theseunlinked suppressors fail to suppress both a pet122 missense mutation and a complete pet122 deletion. One of the suppressor mutations causes a heat-sensitive nonrespiratory growth phenotype in an otherwise wild-type strain and reduces translation of all mitochondrial gene products in cells grown at high temperature. This suppressor maps to a newly identified gene on chromosome XV termed PET123. The sequence of a DNA fragment carryingPET123 contains one major open reading frame encoding a basic protein of 318 amino acids. Inactivation of the chromosomal copy of PET123 by interruption of this open reading frame causes cellsto become rho- (sustain large deletionsin their mtDNA). This phenotype is characteristic fornull alleles of genes whose products are essential for general mitochondrial protein synthesis. T h u s our data strongly suggest that the PET123 protein is a component of the mitochondrial translation apparatus that interacts directly with the coxIII-mRNA-specific translational activatorPETl 22. M ITOCHONDRIAL genes are expressed by an organellar genetic system whose protein components are (with few exceptions) encoded by nuclear genes (reviewed in TZAGOLOFF and MYERS1986; ATTARDI and SCHATZ 1988).T h e majority of these nuclearly encoded proteins are required generally for the expression of all mitochondrial genes. However in the yeast Saccharomyces cerevisiae, a number of additional nuclear genes have been identifiedthat exert positive control over the expression of specijic mitochondrial genes(reviewed in FOX 1986; ATTARDIand SCHATZ1988). Many of these specific regulators act at the level of translation and thus must mediate, in some fashion, an interaction betweenspecific mRNAs and components of the general mitochondrial translation system. Translation of the mitochondrially coded mRNA for cytochrome c oxidase subunit 111 (~0x111)specifically requires theaction ofat least three nucleargenes, PET122, PET494 and PET54 (CABRALand SCHATZ 1978; MULLER et al. 1984; COSTANZO and Fox 1986; COSTANZO, SEAVER and FOX 1986; COSTANZO et al. 1988; KLOECKENER-GRUISSEM, MCEWENand POYTON 1987, 1988). T h e site (or sites) at which these nuclear genes act to promote translation has been mapped genetically to the upstream two-thirds of the cox111 mRNA5’-untranslatedleader (COSTANZO and Fox 1988a). Furthermore, these three nuclear genes encode proteins thatare localized in mitochondria (CosC.enrtics 125: 495-503 (July, 1990) and Fox 1986; OHMEN, KLOECKENER-GRUISand MCEWEN1988; COSTANZO, SEAVER and Fox 1989; ourunpublished results). Taken together,these studies suggest a model in which at least one of the threenucleargeneproducts contacts the cox111 mRNA 5’-leader and activates translation by an unknown mechanism. Clearly, this mechanism could involve direct protein-protein interactions between one or more of the cox111 mRNA-specific activators and proteincomponents of thegeneral mitochondrial translation machinery. T o identifyinteractions involving the PET122, PET54 and PET494 gene products we are looking for allele-specific suppressors of mutations that alter these proteins. Such suppressors can define genes coding for interacting proteins (HARTMAN andROTH 1973) and are especially informative when the suppressor mutations themselves produce a phenotype (JARVIK and BOTSTEIN1975). In this paper we describe the isolation and characterization of allele-specific suppressorsof pet122 mutations. T h e suppressorsdescribed here, some of which cause a heat sensitive nonrespiratory phenotype, are mutations in a newly identified nuclear gene termed PET123. By examining the phenotypes of theheat sensitive mutation petl23-1 and of pet123 null mutations, we found that the PETl23 protein is essential for the translation of most if not all mitochondrial mRNAs. These findings strongly suggest that we have genetically identified a TANZO SEM 496 P. Haffter, T. W. McMullin and T. D. Fox TABLE 1 Strains used in this study Genotype Stvain DBY947 ‘IF1x9 TMAP2-3 T M K2- 1 WH20 PTH25 PTH37 PTH39 l”IH64 PTH78 PTH211 PTH86 PTH161 T F I 75 GRFlS 405 x55 Source MATa, ade2-101, 3-52 ura MATa, ade2-101, ura3-52 MZ4Ta, ura3-52, ade2-101, pet122-6 MATa, ade2-101, ura3-52, pet122-6, pet123-1 petl23-l MATa, ura3-52, ade2-101, MATa, ade2-101, ura3-52, pet122-6, petL23-l MATa, ade2-101, ura3-52, pet122-7 MATaIlMATa, ade2-l0l/ade2-101, ura3-52/ura3-52 MATa, leu2-3, leu2-I 12, his3-11, his3-15, pet123-I MATa, ade2-101, ura3-52, petl23::URA3 MATa, ade2-101, u r d - 5 2 , pet123-12 (::URAJ) MATa, leu2-3, petl23-1 (possibly canR) MATa, ade2-101, ura3-52, pet122-9 MATa, ura3-52, leu2-3, leu2-112, his4-519, pet122-5 M,4Ta, his3-1 I, his3-15, leu2-3, leu2-I 12, canR ,MATa,leu2-3, his3, ade2, WF5-I MATa, ade9, l e d - 3 , lys2 link between the coxIII-mRNA-specific translational activator PET122 a n d a component of the general mitochondrial translation machinery. MATERIALS AND METHODS Yeast strains, media and genetic methods: S. cerevisiae strains used in this study are listed in Table 1. All strains were isogenic except PTH64,PTH86,TF175,GRF18, 405, and 855. PTH64 was derived from a cross between PTH2O and GRF18; PTH86 from a cross between PTH64 and 855. SUF5 was scored as a suppressor of the leu2-3 mutation (CULBERTSON, UNDERBRINK FINK and 1980). Nonfermentable medium was YPEG (1% yeast extract, 2% peptone, 3% ethanol, 3% glycerol). Complete medium containing glucose (YPD), other media and genetic methods were as described by ROSE,WINSTON and HIETER (1 988), except that some yeast transformations were carried out by agitation with glass beads (COSTANZO and FOX 1988b). DNA manipulations, sequencing and computer searches: DNA manipulations were carried out as described by MANIATIS,FRITSCHand SAMBROOK (1982). DNAsequence determination was performed by the dideoxynucleotide chain terminationmethod (SANGER, NICKLENand COULSON 1977). Computer searches were done using the FASTA-MAIL program (PEARSON and LIPMAN 1988). Isolation and manipulation of pet122 mutations: The pet122-5 mutation was previously isolated in this laboratory (COSTANZO and FOX 1988a). [We formerly referred to PET122 as PET55 (COSTANZO et al. 1988).] The PET122 gene was isolated by selecting a plasmid that could complement the pet122-5 mutation in TF175 from a genomic bank in the vector YEP13 (NASMYTHand TATCHELL 1980). The pet122-6 allele was generated by deletion of the 468-bp PuuII fragment (Figure 1) as follows: an 1820-bp BamHIXbaI fragment carrying PET122 (OHMEN,KLOECKENERGRUISSEM and MCEWEN1988) was subcloned from the original complementing plasmid intothe vector YCp50 (ROSEet al. 1987)to generatepC122. pC122 was then digested with PvuII and religated. The corresponding BamHI-XbaI fragment, carrying the deletion, was then sub- 01- Ref. NEFFet al. (1983) This study study This study This study This This study This study This study (possibly canR) This study This study This study This study This study This study DONAHUE et al. (1983) CULBERTSON,UNDERBRINK and FINK( 1 980) CULBERTSON, UNDERBRINK and FINK(1980) cloned into theintegrating vector YIp5 (STRUHL et al. 1979). The pet122-7 allele was generated by deletion of the 1342bp Hind1 fragmentcontaining theentire gene,froma subclone of PET122 in BLUESCRIPT M13 (Stratagene Inc.) which was then subcloned on an approximately 1-kb BamHI-EcoRV fragment into YIp5,resulting inplasmid pPHY2. Both deletions were then used to replace the PET122 gene of strain DBY947 as described (BOEKE,LACROUTE and FINK1984) andverified by gel-blot hybridization analysis (not shown). DNA carrying the petl22-5 mutation was cloned by taking advantage of the fact that transformation ofyeastwith gapped plasmids frequently results in repair of the gap using informationfrom the chromosomal region corresponding to the gap (ORRWEAVER, SZOSTAK and ROTHSTEIN 1981).The pet122-9 allele was made by mutagenizing a plasmid carrying PET122 on an approximately 2.3-kb BamHI-EcoRV fragment subcloned into YCp50 (ROSEet al. 1987) in E. coli using Nmethyl-N’-nitro-N-nitrosoguanidine as described by MILLER 1972). The mutation was mapped upstream of the PvuI site of PET122 by exchanging PvuI fragments with the original wild-type derivative and analyzing thephenotype of the resulting plasmids by transformation intoPTH37.The pet122-9 allele was then sequenced between the HincII and PvuI sites and foundto be achange of codon 82 from CTA to CCA changing leucine to proline. The pet122-9 allele was subcloned into YIp5 and the resulting plasmid (pPHY41CX82) was used to replace the chromosomal copy of PET122 in DBY947 as described by BOEKE,LACROUTE and FINK(1 984). DNA sequence analysisof PET122 was previously reported by OHMEN,KLOECKENER-GRUISSEM and MCEWEN (1 988). Duringanalysis of the wild-type and mutant genes described here we noted a discrepancy between our results and this published DNA sequence: we found an additional T residue following position 996. Figure 1 reportsour sequence data between positions 950 and 1200. The additional T residue at position 997 generates an alteredreading frame that predicts a PET122 protein of 254 amino acids. Two lines of evidence indicate the sequence of Figure 1 is correct. First, we found that the pet122-5 mutation is due Yeast Translation in to a C toT transition at position 1091. In the reading frame of Figure 1 this substitution generates a UAA codon, accounting for the mutant phenotype. However, in the previously published open reading frame (OHMEN,KLOECKENER-GRUISSEM and MCEWEN1988) this mutation would produce a silent third base change. A second result consistent with the sequence of Figure 1, butinconsistent with the previously published sequence, was obtained by fusing lacZ to PET122 at position 113 1,which would have maintained the previously reported PET122 termination codon. However, as predicted by the sequence of Figure l , this chimeric gene directed the synthesis of a large fusion polypeptide in Escherichia coli with antigenic cross-reactivity to PET1 22 (our unpublished data). I n vivo labeling of mitochondrial translation products were and analysis of mitochondrial RNA: Yeastcells grown to saturation in YPD medium at either 30" or 35" for 24 to 36 hr prior to labeling at the respective temperatures. Radioactive labeling in vivo with ["Slmethionine in the presence of cycloheximide, preparation of crude mitochondria and SDS-polyacrylamide gel electrophoresis were as previously described (DOUGLAS and BUTOW1976; MULLERet al. 1984) except that the labeling medium contained 0.5% glucose instead of galactose. Total cellular RNA JENSEN and HERSKOWwas isolated as described (SPRAGUE, ITZ 1983) from cells grown at either 30" or 37" and subjected to electrophoresis, blotting and hybridization to the coxIII-specific probe pZHS3 as previously described (COSTANZO, SEAVER and Fox 1986). To check that the mutant cells had remained rho+, aliquots of the mutant cultures grown at nonpermissive temperature were diluted and plated on YPD for single colonies. The colonies were then mated to a Pet+, rho" tester strain and the ability of the resulting diploids to grow on YPEG medium was scored. More than 95% of the mutant cells remained rho+. Isolation and manipulation of P E T 1 2 3 The PET123 gene was cloned from a yeast genomic bank in the vector YCp50 (ROSEet al. 1987), selecting for complementation of the Pet"' allele pet123-1. T w o independent clones were obtained, oneof which was within the other.A 1.9-kb XhoIBamHI fragment (this BamHI site is not present in the larger clone and is probably the result of ligating a Sau3AI end into the BamHI site of YCp50) was subcloned between the Sal1 and BamHIsitesof YCp50. The resulting plasmid pPHY7 complemented pet123-1 and its 1.9-kb insert was sequenced. Templates were made by subcloning DNA restriction fragments, generated from the sites shown in Figure 3, into the vectors M13mp18 or M13mp19 (MESSING 1983). A smaller SspI-BamHI fragment subcloned into the NruI and BamHI sites of YCp50 (pPHY30) also complemented thepetl23-1 allele, whereas the DraI fragment inserted into the NruI site of YCp50 (pPHY35) did not (Figure 3). From pPHY3O and pPHY35 two derivatives (pPHY39 and pPHY40) were constructed by swapping PvuI fragments, using the PvuI site within the insert and another one in the vector YCp50. pPHY40 is the subclone from the first DraI site to the BamHI site, pPHY39 contains the sequence from the Ssp1 site to thesecond DraI site. A HincIIBamHI fragment was subcloned separately into the NruIBamHI sites of YCp50. These three additional subclones were then also tested for complementation of the pet123-1 allele (Figure 3). Constructionof null alleles of PET123: The 1.9-kbXhoIBamHI fragment that complements petl23-1 was subcloned intothe plasmid pUCl8 (YANISCH-PERRON, VIEIRAand MESSING1985), yielding the plasmid pPHB5. Into this plasmid, a 1.6-kbXbaI fragment containing the URA3 gene was Mitochondria 497 ........................................ 951 GAG ATA GCA TTG ATG CAG CAA GAT ile ala l e u met g l n g l n a s p r PVUII CAA GCA GCT GCC CTG TTG GCG TTT GGA CGACAG CCC CTA GTG ATA AAG g l n pro leu Val i l e l y s q l u q l n ala ala a l a l e u a l a l e u phe g l y a r q 1002 AAC GAA TGG TCA CTA CCG CTA CTA asn q l u t r p s e r l e u pro l e u l e u l e u CTG GGT GCT GTC CTT TGG CAT ala glyvalleutrphis GTT CCC v a l pro r T in pet122-5 1053 GGC CCA GCG CAG GCG CGA CGT GTG CTG GCG GAG TTC CGT CAA AGT TAT CGC g l y pro a l a q l n a l a arqarq val l e u a l a glu phe a r g g l n s e r t y r arg 1104 GGG CTG glyleu CCG CTG CTG pro l e u l e u a s p GAT GCC GAA CTAATAGTG AAG AGA AGA GGA TTT GAA a l a g l u l e u val i l e l y s a r ga r g q l y phe glu 1155 ATC AAC ACA TAA ATCTGGGTGGAGCATCGCTGTAACAAGGAACAACG.....GTACGTTTCTG i l e asn t h r OCH 1420 rPvuII AATGATCAGCT GTT TAA v a l OCH FIGURE1.-Sequence analysis of thedownstreamregion of PET122, containing alleles suppressible by pet123 mutations. T h e positions of the two PvuII sites used to make the deletion mutation pet122-6 are shown. As indicated, a Val residue is added at the C terminus of theresultingprotein. T h e location ofthe C to T substitution that generates theUAA codon ofpet122-5is indicated. This DNA sequence differs from that reported by OHMEN, KLOECKENER-GRUISSEM and MCEWEN(1988) by an additional T residue following base 996 (see MATERIALS AND METHODS). inserted creating anew plasmid pPHY21. [This 1.6-kb XbaI fragment was derived by inserting the URA3 gene on an Nrul-SmaI fragment from the plasmid YCp50 between the HincII sites of pUC1318 (KAYand MCPHERSON 1987).] A BamHI-PstI fragment,containingthedisruptedPET123 gene was isolated from pPHY21 and used to transform the diploid strain PTH39. Haploids carrying the petl23::URAjr allele (PTH78) were obtained by sporulation and verified by their inability to complement pet123-1 and by DNA gelblot hybridization. A large deletion of PET123 replacing the sequence between the two DraI sites (Figure 3)with the URA3 gene was constructed as follows. A 527-bp KpnI-DraI fragment containing the start of PET123 and upstream sequences and a 304-bp DraI-BamHI fragment containing the carboxyterminus of PET123 and downstream sequences had been subcloned into M13mp18, giving PHFl6 and PHFl2 respectively. A KpnI-Hind111 fragment from PHFl2 and an EcoRI-SphI fragmentfrom PHF16 were then ligated between the KpnI and EcoRI sites of pUC18 in the presence of a 1.6-kb HindII-SphI fragment containingthe URA3 gene, yielding plasmid pPHY59. The 1.6-kb fragment carrying the URA3 gene was derived from a subclone of the URA3 gene on an NruI-SmaI fragment from the plasmid YCp50 between the HincII sites of pUCl8 13 (KAYand MCPHERSON 1987). A 2.7-kb EcoRI-BamHI fragmentcontaining the large pet123 deletion was used totransform the diploid strain PTH39. Haploid strains with this deletion (PTH21 I), termed pet123-12, were obtained upon sporulation of the transformed diploid and verified by their inability to complement pet123-1 and by DNA gel-blot hybridization. RESULTS Primary sequence of pet122 mutant alleles: The pet122 allele for which unlinked suppressors were isolated was adeletion mutation, termed pet122-6, that truncated the PET122 protein at its C terminus by 67 amino acid residues (Figure 1). pet122-6 was 498 P. Haffter, T. W. McMullin and T. D. Fox generated by replacement of the wild-type gene with a sequence from which a 468-bp PvuII fragment had beendeleted (MATERIALS AND METHODS). An additional allele affecting the C terminus was the previously isolated mutation pet122-5 (COSTANZO and FOX 1988a; COSTANZO et al. 1988), which was found to be an ochre (UAA) mutation that truncated the PET122 protein by 24 amino acid residues (Figure 1; MATERIALS ANDMETHODS). Two other pet122 mutations used in this study were a complete deletion, termed pet122-7, and a point mutation,pet122-9, that changed residue 82 from Leu to Pro (MATERIALS AND METHODS). Isolation and characterization of suppressors of pet122-6: A straincarrying the pet122-6 mutation (TMAP2-3; Table 1) failed to grow on medium containing nonfermentable carbon sources (Pet- phenotype), as expected. However, TMAP2-3 yielded spontaneousrespiratory-competentrevertants at afrequency of approximately 10-8,despite the fact that its PET122 protein lacked 67 C-terminalamino acids (Figure1). These revertants exhibited a mitotically stable Pet+ phenotypeat 30 O but were unable to grow on nonfermentable carbonsources at 37 O . They grew normally on glucose at all temperatures. Eighteen heat sensitive (Pet") revertants of TMAP2-3 were analyzed further, as outlined below fortherevertantTMR2-1,todeterminewhether their ability to respire was due to mitochondrial mutations, nuclear mutations linked to PET122, or unlinked nuclear suppressors. First, TMR2-1 was treated with ethidium bromideto remove its mtDNA (GOLDRINC et al. 1970). Thisrhoo derivative was then crossed to an isogenic Pet+, rho+ wild-type strain (TF189), andthe resulting diploid was sporulated. Tetrad analysis of the progeny indicated that TMR2-1 contained an unlinked nuclear suppressor of pet122-6, and furthermore that this suppressor mutation conferred itsownPet"" phenotype:approximatelyone sixth of the tetrads (1 8 total) contained 2 Peths: 2 Pet+ (parental ditype), while one sixth contained 2 Peth": 2 Pet- (nonparental ditype) and two thirds contained 1 Pet+: 2 Peth': 1 Pet- (tetratype). Since this suppressor mutationdefineda new nucleargene (see below) required for respiration even in the presence of a wild-type PET122 gene, we have termed it pet123-I. Similar crosses to wild type showed thatthe17 additional revertants of TMAP2-3 were also due to nuclearmutations unlinked to PET122. However, only one of these additional suppressors conferred an intrinsic Pet"' phenotype while the other 16 had no dramatic effect on respiratory growth in an otherwise wild-type background. As a first step toward determininghow many genes could mutateto suppress pet122-6, we determined whether the 17 additional suppressors were linked to TABLE 2 Tetrad analysis of genetic linkage between markers in the PET123 region on chromosomeXV Ascus type (no.) PD Interval pet12?-his3".'.' pet123-ade2".' petl23-ade9' pet 123-SUF5' ade9-his3' SUFS-ade2' SUF5-his3' ade2-his3",' 163 183 60 161 73 145 62 76 NPD 5 3 0 0 0 1 4 12 Distance T?' 210 100 34 31 19 29 117 221 (CM) 32 21 18 8 10 10 39 47 " Cross of G R F l B X PTHPO. ' Cross of PTH64 X 855. ' Cross of PTH86 X 405. pet123-I. A pet122-6, pet123-I strain (PTH25) was crossed to each of these revertants and the resulting diploids were sporulated. Crosses involving 9 of the 17 additional revertants (including that with the second intrinsically heat insensitive suppressor) yielded tetradsthat all contained 4 PethSspores, indicating that their suppressor mutations were tightly linked and probably allelic to petl23-I. The suppressors in the other 8 revertants (not described further here) were unlinked to pet123-1. The intrinsic Peths phenotype caused by pet123-I (and that of the second intrinsically PethS suppressor mentioned above)was recessive to wild type (therefore the mutant allele is indicated in lowercase). However, the suppresssion of pet122-6 by the pet123-1 mutation was dominant: a diploid strain that was heterozygous for the suppressor(pet123-IIPET123)and carried the suppressible pet122-6 allele over the complete deletion, petI22-7, grew on nonfermentable carbon sources at 30 (although more slowly than the haploid TMR2-1) but not 37 at Similar results were obtained with all of the suppressors linked to pet123-1. Genetic mapping of PETl23: Analysis of a cross between strain PTH20andGRF18(Table l), revealed that petl23-1 was linked to ade2 and his3, two markers on the right arm of chromosome XV (MORTIMER and SCHILD1985). We performed further tetrad analyses to map pet123 with respect to ade2 and his3, as well as SUF5 and ade9 (Table 2). pet123 was located between SUFS and ade9, most tightly linked to SUFS (8 cM) and more weakly linked to ade9 (18 cM). N o pet mutations have been previously mapped to this position. The pet123 suppressorsarespecificfor pet122 alleles that truncate the C terminus of the PET122 protein: The pet123 mutations could either be allelespecific suppressors that depend on residual function of the pet122-6 allele, or mutations that completely bypass PET122 function. T o distinguish between these alternatives, we first tested the ability of the ten O O . Translation Mitochondria in Yeast suppressor mutationsin pet123 to suppress a complete deletion of PET122 (the pet122-7 allele). Haploid strains were constructed that each contained pet122-7 and one of the ten pet123 mutations. None of these haploids was able to grow on nonfermentable carbon sources, demonstrating that thepet123 mutations did not simply bypass the requirement for PET122 function. Similarly, we found that the pet123-I mutation failed to suppress (bypass) deletions of PET54 and PET494, the other nuclear genes required specifically for cox111 translation. We also found that the pet123 mutations could not suppress the missense mutation pet122-9 (Leu to Pro at position 82; MATERIALS AND METHODS). First, diploids were constructed that contained pet122-9 over the complete deletion pet122-7, and each pet123 mutation over wild-type PET123. These diploids failed to respire,demonstratingthatnone of the pet123 mutations were dominant suppressors of pet122-9. Second, when strains carrying each of seven pet123 alleles (including petl23-I) were crossed to a strain containing pet122-9 (PTH161) and sporulated, the resulting tetrads each contained two Pet- spores, demonstrating that the pet123 mutations could not suppress the missense mutation, pet122-9, in haploids. Interestingly, the pet123 mutations were able to suppress pet122-5, an ochre mutation that truncates the PET122 proteinby 24 C-terminal residues (Figure 1): diploids of genotype pet122-5/pet122-7, pet123/ PET123 were able to respire at 30", but not at 37". Thus, the suppressor mutations in PET123 that were selected to restore partial function to a PET122 protein lacking 67 C-terminal amino acids (the pet122-6 product), were also able to restore partial function to a PETl 22protein lacking 24 C-terminal residues. However as noted above, the pet123 mutations could neither bypass the PET122 function nor suppress a missense mutation affecting the N-terminal domain of the PET122 protein. Taken together, these results strongly suggest that the products of PET122 and PET123 interact directly. The petZ23-1 mutation causes temperature-sensitive mitochondrial protein synthesis: If the PET123 gene product does interact with the coxIII-mRNAspecific translational activator PETl 22, then the Pethr mutation petl23-1 would be expected to affect mitochondrial translation at the nonpermissive temperature. T o test this prediction, cells were grown at permissive and non-permissive temperatures,and their mitochondrial translation products were selectively labeled in vivo in the presence of cycloheximide (MATERIALS AND METHODS). The mitochondrially coded proteinswere then detectedby SDS-gel electrophoresis and autoradiography (Figure 2; top panel). In cells grown at permissive temperature, mitochondrial translation in the petl23-1 mutantstrain was 499 1 2 3 4 4 FIGURE 2.-Thepet123-I mutation reduces mitochotldrial translation in cellsgrownatnonpermissivetenlperature. T o p panel: Wild-type(DRY947) and prf123-I mut;tnt (PTH2O) cells were grown and r;tdioactiveIy labeled (in the presence of cycloheximide) at permissive (30") o r non-permissive (35") tempe~tturesas described i n MATERIAIS ANI) METHODS. Crude mitochondri;t were prepared, and equal aliquots of protein from each sample ( I 6 pa) were subjected to electrophoresis i n SDS-polvacrvl;l~nide( I 0- 15% gradient) gels. T h e gels were dried and autor;ldiogr;lplied. Rottonl panel: T h e pet123-I mutation has no effect on the level of cosIll mRNA at non-permissivetemperature. Tot;~lcellular R N A was isolated from wild-tvpe (DBY947) and prt123-I nlutant (PTHPO) cells gro\vn in YPD nledium at permissive (30") or non-pernjissive (37")temperatures.Followingelectrophoresis of 2 0 pg of each s;tmple and blotting to nitrocellulose. the RNA was probed with r;tdio;lctivelv labeledpZHS3 DNA, a probespecific for coxlll (MULLERet al. 1984). and the filter w a s autoradiographed. A parallel gel containing equal ;11110~1nts of RNA w a s stxined with ethidium bronlide and visualized under the U V light to confirm, that equal anlounts of R N A were loaded. T h e I .6 kb coxlll m R N A is indicated by the ;Irrowhe;ld. Lanes 1, Wild type (DBY947) grown a t pertnissivetemperature: Lanes 2. pet123-Illlutant (I"I'H20) grown a t permissivetemperature:Lanes3, Wild type grown a t nonpermissivetemperature; I.anes 4. prtl23-I mutantgrown at nonpermissive temperature. comparable to wild type. However in cells grown at the nonpermissive temperature, translation of all mitochondrial gene productsin the petl23-l mutant was dramatically reduced relative to wild type although some translation was still apparent. In contrast, petl23-1 had no effect on the level ofthe 1.6-kb cox111 mRNA in cells grown at non-permissive temperature (Figure 2; bottom panel), confirming that mitochon- 500 P. Haffter, T. W. McMullin and T. D. Fox -114 URA3 . CTCGAGGTATATAAffiAATGTAATTCAATG~AGACCCGATC~~CGT~TGC~C~TATCffiCffi . -514 . AATTGGACCTTGTGTTGATCTTGTATCTGCTGCAATCACCACTCCGTTA~GAAT~AC~CTACAATG -644 CGGTACCGGCACCAGCACACCATATTTTffi~~~CTATGCAATTTTGCGCTCACAATTCTTATCT~G~ Kpnl Kpnl Ecll Ssp1 Ghol L Dral H~hcll +/- Xbal EcoRl -" Cdl Dral BamHl &oRI " " + Xmnl " " " orf of 318 aminoacids PET123 FIGURE3,"Restriction map and sequence determination strategy of a 1 .l)-Lb D N A fragtnent carrying the PET123 gene. Arrows indicate the extent and direction of nucleotide sequence detertninations. 'The position and direction of the PET123 coding sequence is indicated by a thick arrow. Black bars indicate fragments tested I i w their ability to complement achromosomal pet123-1 allele when carried 011 the replicating vector YCp50: indicates completnentation, - indicates noncomplementation. The site of disruption of the I'BT123 gene by insertion of (IRA3 is indicated by a triangle. + . -504 GTGGTACCCGTGWV\GTTGCTCACCTTAGGTTGTGTGTGCGAGTGCGAGTTTTCC~T~G~TTATTTCTTTGATAAT . -434 TGTCGAACGATAAACCTGCCATGCTCACTCACTCAATTCTATTTTCTACAATCAGG~TATGT~~AGTAT -364 . TCCTGAARAAATTTAACGCTTTACTATACAAACTCTCTCCACCTCAACTGATCACCC~CT~TGAATTATT -294 . AGTTTATCCTTTTCATCTTTCTTTTTGGTATTTTGCCACTCGGCCGGGTTAT~TACGAAACATGGCC -224 . CTAATTTACCCGCTTTTACAATATAAAGGGTTTGTAATGAGffiT~TATTGGCCCTAATG~TCAC -154 . TAGCAACGGAAGTGCAAGTAGAACCCTGAAGTC~CGAGTAffi~TGATTCCCAAGAffiAGTAGAATA . -84 AAGAAGAGAATCTACATATGATTATTTAGGTAATAGTTTCATT~TGATTGTCAACAACAATAATAACA -14 . AGGATAATTGAAGTATCGGGAARffiTGCTCACGGCCAAGTATGGTTTTALAAGTG~TTTTCCCCACAACAAG MetGlyLysGlyAlaAlaLysTyrGlyPheLy~SerGlyValPheProThrThrAr 57 GTCCATTCTGAAGAGCTCACCCCACTACAAAGCAGRCTGATATTATTAATAAffiT~TCACCCAAGCCCAAG gSerIleLeuLysSerProThrThrLysGlnThrAspIleIleAsnLysValLysSerProLy~ProLys 121 . GGTGTTCTTGGTATTGGGTATGCCAAAGGTGTAAAACATCC~ffiATCACATAGATTATCACCCAAffi GlyValLeuGlyIleGlyTyrAlaLysGlyValLysHisProLysGlySerHi~ArgLeuSerProLysV 197 . TAAACTTTATCGACGTGGATAATCTCATTGCGAAGACCGTTGCTCACTGAACCCCAGAGTATALAATCCAGT~ alAsnPheIleAspValA~snLeuIleAlaLysThrValAlaGluProGlnSerIleLysSerSerAs 267 . CGGTTCAGCACAGAAAGTWATTACAAAAAGCTGAATTATTCGC nGlySerAlaGlnLysValArgLeuGlnLysAlaGluLeeuArgArgLysPheLeuIleGluAlaPheArg drialgene expression was blocked atthe level of translation. Interestingly,althoughmitochondrialtranslation was defective in a pet123-1 mutant grown for several generations at nonpermissive temperature,mutant cells grown at permissive temperatureandthen shifted to nonpermissive temperature shortly before labeling hadnormalmitochondrial translation (our unpublished observations). This finding suggests that the petl23-1 mutation may cause thermolabile assembly of a complex, rather than temperature sensitive function, per se. Primarystructure of the PET123 gene: The PET123 gene was cloned by selection of a plasmid that complemented the Pet'" phenotype of pet123-1 from a bank ofyeast genomic DNA in thevector YCp50 (ROSEet al. 1987). A1.9-kb XhoI-BamHI DNA restrictionfragment was isolated from this plasmid that complemented petl23-1 when carried on a replicating vector. Genetic data, described below, confirmed that this fragment carried the PET123 gene. The 1.9-kb fragment was subcloned and sequenced (Figure 3). The sequence contains one long open readingframe, 954 nucleotides in length, which is within a smaller SspI-BamHI fragment that also complements the pet123-1 mutation (Figure 3). This reading frame predicts that the PET123 protein is basic (net charge, +26),with a molecular mass of 41,650 D (Figure 4). However,thepredictedamino acid sequencehadnostrong homology to any sequences found in the SWISS-PROT, PIR, MIPSX or EMBL databases or in a collection of about 400 ribosomal 331 . AAG~GAffiCTAGGCTATTACACAAACACGAGTATTTGCAGAAGAGGAC~GGAA~ffi~GC~ LysGluGluAlaArgLeuLHisLysHisGluTyr~uGlnLysAr~hrLysGlu~uGluLysAlaL 401 . AAGAACTGGAGCTAGATMATAAGGAU.AATCTTCAGACTTGACTATTATGACTCTAGACALAAT ysGluLeuGluLeuGluLysLeuAsnLysGluLysSerSerAJpLeuThrIleMetThrLeuAspLysMe . 417 GATGTCTCAACCTCTTTTAAACAGATCACCAGAAGA~~TTGTT~GTTG~GAATTAC tMetSerGlnProLeuLeuArgAsnArgSerPrffiluGluSerGluLeuLeuLysLeuLysArgAsnTyr 547 . AATCGATCGTTGTTGAACTTTCAGGCGCACAA~GCT~CGAATTATT~CCTCTACCA~TCG A s n A r g S e r L e u L e u A s n P h e G l n A l a H i s L y s L y s L y s I l A 611 . CTAATGAATTCATCGTTACAGAATCCCCAACTACT~~TTGATAAGGT~TTAACGATG~CffiA laAsnGluPheIleValThrGluSerGlnLeuteuLysLysIleAspLysValPheAsnAspGluThrG1 681 . GGAATTCACTGATGCCTATGATGTAACTTCTAACTTCACGTTTCA uGluPheThrAspAlaTyrAspValThrSerAsnPheThrGlnPhffilyAsnArgLysLeuLeuLeuSer 151 . GGTAACACCACCCTACAAACCCAAATTAACAACGCTCACAATAAT~GCTC~TGTC~C~GTTTTTCG GlyAsnThrThrteuGlnThrGlnIleAsnAsnALaIleMetGlySerLeuSerAsnGluLysPhePheA a21 . ATATTTCTTTAGTGGATTCATATCTGAACAA~ATTT~CATTTCCAAT~TTGATTCC~TT spIleSerLeuValAspSerTyrLeuAsnLysAsp~uLysAsnIleSerAsnLysIleAspSerLYsLe 891 . AARCCCCACCTCTAATGGAGCTGGAAATAAT~TAATAATAATAATACAACCAACTTGT~TAACTAAT uAsnProThrSerAsnGlyAlaGlyAsnAsnGlyAsnAsnAsnAsnThrThrAsnLeu*'* 961 . ATATATACTACTTCAACATGTCATGTATTCGAAAGTGCCTTAGACGCA~ACAACT~G~GAAG~ 1037 . AAAAAAATCAAATCGAGAATAAATATGCCCATGTATATACGTCACTT~GAATTGTCTATTTC~TCGTT 1101 . CCCCTTTTTCTTTCAGTCCGCTGATGTTATCAAT~GATATTATCGCCTTTC~CA~ATC FIGURE4.-Nucleotide sequence of PET123 and derived amino acid sequence of its product. protein sequences (I. WOOL, personal communication). Disruption of PET123 yields viable cells that become rho- or rho': Mutations that completely block mitochondrial translation have been shown to destabilize the wild-type mtDNA and lead to the produc- Translation in Yeast Mitochondria tion of cells that contain large or complete deletions of mtDNA (rho- and rho', respectively) (MYERS,PAPE and TZAGOLOFF 1985; MYERS,CRIVELLONE and TZAGOLOFF 1987; FEARON andMASON 1988). The PethS mutation pet123-I did not cause cells to become rhoduring growth at the nonpermissive temperature (MATERIALS AND METHODS). However, the pet123-1 mutation is slightly leaky, and residual protein synthesis couldbe sufficient to maintain rho+ mtDNA. T o determine whether a pet123 null mutation would prevent the maintenanceof rho+ mtDNA, theURA? gene was inserted at theXbaI site in the open reading frame of PET123 (Figure 2;MATERIALS AND METHODS). This construct was then used to transform toUra+, a Pet+,ura?/ura?, rhof diploid strain (PTH39), disrupting one chromosomal copy of PET12? (ROTHSTEIN 1983). Sporulation of a transformed diploid resulted in 2:2 cosegregation of Pet- and Ura+ in all tetrads. As expected, this pet12?::URA? allele failed to complement thePethSphenotype of pet123-I, and was genetically linked to ade2 and his?. None of the haploids carrying the pet12?::URA? allele (including, for example, PTH78) were able to complement the respiratory defect of Pet+, rho' tester strains, demonstrating thatthey were unable to maintain wild-type mtDNA. However, like the translation defective null mutants previously studied by others, the petl2?::URA? strains couldmaintain rho- mtDNA: some subclones from each of the pet12?::URA? haploids studied were able to marker-rescue mitochondrial mutations in the genes oxil, 0x22, oxi? and cob. A strain (PTH211) carrying a chromosomal deletion of virtually the entirePET123 reading frame was made as described in MATERIALS AND METHODS. Like the pet12?::URA? disruptiondescribedabove, cells carrying this deletion, termed pet12?-12, were viable but could not maintain rho+ mtDNA. Null mutations in the mitochondrialRNA polymerase gene, rpo41, reportedly cause the complete lossof mtDNA, resulting in rho' cells (GREENLEAF, KELLYand LEHMAN 1986). However, in the course of control experiments we found that a strain carrying an rpo41-disruption (kindly provided by M. WOONTNER and J. JAEHNING) was also able to maintain rhomitochondrial genomes over several generations, as judged by the ability to marker-rescue mitochondrial mutations (our unpublished observation). DISCUSSION Translation of the mitochondrialmRNAcoding cox111 is specifically activated by the productsof three nuclear genes PET122, PET494 and PET54 (CABRAL and SCHATZ1978; MULLER et al. 1984; COSTANZO SEAVERand Fox 1986; and FOX 1986; COSTANZO, COSTANZO et al. 1988; KLOECKENER-GRUISSEM, Mc- 50 1 EWENand POYTON1987, 1988)which must somehow communicate with the mitochondrial translation system. This study provides strong genetic evidence for adirectinteraction between one of these specific activators, the PET122 protein, and a component of the generalmitochondrialtranslation system coded by the newly discovered gene P E T I 2 3 . We sought to identify proteins that interact with PETl 22 by looking for unlinked allele-specific suppressors of a pet122 mutation. Of particular interest were suppressor mutationsthat, by themselves, caused a temperature sensitive defect in mitochondrial gene expression. Two such PethS suppressor mutations were isolated, which (along with eight other suppressors having no intrinsic phenotype) mapped to the same locus onchromosome XV, identifying a previously unknown gene, termed P E T I 2 3 . These suppressors (petl2? mutations) were selected to act on a pet122 mutation that deleted 67C-terminal amino acid residues of the PET 122 protein. Interestingly, they also suppressed a mutation that truncated the PETl 22 protein by 24 C-terminal amino acids. However, the suppressormutations did not simply bypass the requirement for PET122 function, since they were unable to suppress both a complete deletion of PET122 and a missense mutation affecting the Nterminal regionof the PETl22 protein. Furthermore, suppression did not appear to involve increased levels of either the wild-type PETl 23 protein or the Cterminally truncated PET 122 protein: the presence of genes coding eitherof these proteins on multicopy plasmids did not suppress the pet122-6 mutation (our unpublished results). Taken together, these data are most easily explained by the hypothesis that the wildtype PET122 and PET123 proteins interact to promote the translationof coxIII. Accordingto this interpretation, the interaction would be disrupted by removal of the PET 122C-terminus, but would be partially restored by compensating mutations affecting the structure of the PET123 protein. However we cannot exclude an alternativepossibility, whereby the suppressor mutations in PET123 would change the structure of part of the mitochondrial translation system such as the ribosome. These structural changes might then allow translation of the cox111 mRNA to be promoted by a truncated version of PET 122 protein without involving adirectcontact between PET122 and PET123. The finding that the Pethsallele, pet123-I, dramatically reduces the synthesis of all mitochondrially coded proteins incells grown at the nonpermissive temperature while the level of cox111 mRNA remains normal, clearly suggests that the PET123 gene product is required for general mitochondrial translation. Further support for this conclusion comes from the finding thatpet123 null alleles cause instability of wild- 502 P. Haffter, T. W. McMullin and T. D. Fox type (rho’) mtDNA and lead to the production of rhovide important clues to themechanism of this mRNAand rho’ cells. This phenotype has been previously specific translational activation system. found to be characteristicfor null alleles of genes We thank S. PASSMORE, C. CHANand P. LINDERfor performing required for mitochondrial translation, such as mitocomputer searches, and I. WOOLfor searchinghis ribosomal protein chondrial aminoacyl tRNA synthetases and mitochonsequence library. We also thank E. C . SEAVERfor cloning PET122, drial ribosomal proteins (MYERS, PAPEand TZAGO- and M. CULBERTSONfor gifts of strains. P.H. was a recipient of an LOFF 1985; MYERS, CRIVELLONE and TZACOLOFF EMBO long-term fellowship and T.W.M. was a Post-doctoral Associate of theCornell Biotechnology Program.This work was 1987; FEARON and MASON 1988). Clearly, the viability supported by a grant (GM29362) from theU.S. National Institutes of strains carryingpet123 null mutations indicates that of Health. PET123function is notrequiredfor vital cellular Note added in proof: The PET123 sequencehas been processes other than mitochondrial translation. entered in the EMBL Data Library, accession number The phenotypes of the pet123 mutants described X52362. here are consistent with the possibilities that PET123 could be a mitochondrial ribosomal protein or a miLITERATURECITED tochondrial translation initiation factor required for ATTARDI,G., and G. SCHATZ,1988 Biogenesis of mitochondria. translation of many (or all) mitochondrial mRNAs. Annu. Rev. Cell Biol. 4: 289-333. The open reading frame of PET123 encodes a basic BOEKE,J. D., F. LACROUTEand G . R. FINK, 1984 A positive protein (net charge, +26) with a predicted molecular selection for mutants lacking orotidine-5’-phosphate decarboxmass of approximately 42 kD. The predicted aminoylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197: 345-346. terminus could serve as a signal for import into mitoCABRAL, R., and G. SCHATZ,1978 Identification of cytochrome c chondria, since, like signals for othernuclear-encoded oxidase subunits in nuclear yeast mutants lacking the functional mitochondrial proteins (reviewed in HAY,BOHNIand en7,yme.J. Biol. Chem. 253: 4396-4401. GASSER1984; DOUGLAS,MCCAMMON and VASSACOSTANZO,M . C., a n d T . D. FOX, 1986 Product of Saccharomyces ROTTI 1986), it is relatively rich in basic amino acids cereuisiae nuclear gene PET494 activates translation of a specific mitochondrial mRNA. Mol. Cell. Biol. 6: 3694-3703. and in serine and threonine residues. The predicted COSTANZO,M. C., and T. D. FOX, 1988a Specific translational amino acid sequence of PET1 23 exhibited no strong activation by nuclear gene products occurs in the 5’ untranshomology to any other proteinsequence we have lated leader of a yeast mitochondrial mRNA. Proc. Natl. Acad. searched. However in this connection, it is worth Sci. USA 85: 2677-2681. COSTANZO, M. C., and T . D. FOX, 1988b Transformation of yeast notingthat several S . cerevisiae mitochondrial riboby agitation with glass beads. Genetics 1 2 0 667-670. somal proteins are not closely homologous to any COSTANZO, M . C., E. C. SEAVER and T . D. FOX, 1986 At least two other known polypeptides (MYERS, CRIVELLONE and nuclear gene products are specifically required for translation TZACOLOFF 1987;PARTALEDIS and MASON 1988; of a single yeast mitochondrial mRNA. EMBO J. 5: 3637GRAACK, GROHMANN CHOLI and 1988). 3641. COSTANZO,M. C . , E. C . SEAVERand T. D. Fox, 1989 The PET54 mRNA-specific translational control may be a comgene of Saccharomyces cereuisiae: characterization of a nuclear mon feature in yeast mitochondria, since translation gene encoding a mitochondrial translation activator and subof the mitochondrial mRNAs codingboth cox11 cellular localization of its product. Genetics 122: 297-305. (POUTRE and Fox 1987;STRICKand Fox 1987) and COSTANZO,M. C., E. C. SEAVER, D. L. MARYKWAS and T . D. Fox, 1988 Multiple nuclear gene products are required toactivate cytochrome b (DIECKMANN TZAGOLOFF and 1985; ROtranslation of a single yeast mitochondrial mRNA, pp. 3 7 3 DEL, KORTE and KAUDEWITZ1985; RODEL1986; RO382 in Genetics of Translation: New Approaches, Vol. 14, edited DEL and Fox 1987),in addition to the cox111 mRNA, M . PI CARD^^^ M.BOLOTIN-FUKUHARA. Sprinby M . F. TUITE, requires the action of particular nuclear genes. Howger-Verlag, New York. ever, the mechanism(s) by which these nuclear genes CULBERTSON,M. R., K . M. UNDERBRINK and G. R. FINK, 1980 Frameshiftsuppression in Saccharomyces cereuisiae. 11. act is not understood. It has been possible to map Genetic properties of group I 1 suppressors. Genetics 95: 833genetically the site(s) of action for PET494, PET54 853. and PET122 to the 5”leader of the cox111 mRNA DIECKMANN,C. L., andA. TZAGOLOFF, 1985 Assembly of the (COSTANZO and Fox 1988a) and, similarly, the site(s) mitochondrial membrane system: CEP6, a yeast nuclear gene necessary for thesynthesis of cytochrome b. J. Biol. Chem. 260: of action for two genes affecting cytochrome b trans1513-1520. lation to the 5’4eaderof the cob mRNA (RODEL1986; DONAHUE,T. F., R. S. DAVES,G. LUCCHINIand G. R. FINK. RODELand Fox 1987). Yet it remains to be deter1983 A short nucleotide sequence required for regulation of mined how these mRNA-specific factors communicate HIS4 by the general control system of yeast. Cell 32: 89-98. DOUGLAS,M.,and R. A. BUTOW, 1976Variantforms ofniitowith the mitochondrial translationsystem. The results chondrial translation products in yeast: evidence for location reported here arguestrongly that at least one of these of determinants on mitochondrialDNA. Proc. Natl. Acdd. Sci. factors, the PET122 protein, interacts directly with a USA 73: 1083-1096. component of the general mitochondrial translation DOUGLAS, M. G., M. T. MCCAMMONand A. VASSAROTTI, system, PET 123. The characterization of the PET 123 1986 Targeting proteins into mitochondria. Microbiol. Rev. 50: 166-178. protein, and its interaction with PET122, should pro- Translation Mitochondria in Yeast FEARON, K., and T. L. MASON, 1988 Structure and regulation of LI nuclear gene i n Saccharomyces cerevisiae that specifies MRP7, ;I protein of the large subunit of the mitochondrial ribosome. Mol. Cell. Biol. 8: 3636-3646. Fox. 1’. D., 1986 Nuclear gene products required for translation ofspecific mitochondrially coded mRNAs in yeast. Trends Genet. 2: 97-100. D. KRUPNICK, D. R. CRYER and GOI.DRING, E. S.,L. I . GROSSMAN, J. MARMUR. 1970 The petite mutation in yeast: lossof mitochondrial deoxyribonucleic acid during induction of petites with ethidium bromide. J. Mol. Biol. 52: 323-335. GRAACK, H., I,. GROHMANN and T . CHOLI,1988 Mitochondrial ribosomes ofyeast:isolation of individual proteins and Nterminal sequencing. FEBS Lett. 242: 4-8. 1986 Yeast GREENLEAF. A. Id.,J. L. KELLY and I . R. LEHMAN, R P 0 4 1 gene product is required for transcription and maintenance of the mitochondrial genome. Proc. Natl. Acad.Sci. USA 83: 3391-3394. HARTMAN, P. E., and J. R. ROTH, 1973 Mechanisms of suppression. Adv. Genet. 17: 1-105. I S. GASSER, 1984 How mitochondriaimport HAY,R., P. B ~ H Nand proteins. Biochim. Biophys. Acta 7 7 9 65-87. J A R V I K , .I., and D. BOTSTEIN, 1975 Conditional-lethal mutations th;lt suppress genetic defects in morphogenesis by altering structural proteins. Proc. Natl. Acad. Sci. USA 72: 2738-2742. KAY, R., and J. MCPHERSON, 1987Hybrid pUC vectors for additionofnew restriction enzyme sites to the ends ofDNA frag1nents. Nucleic Acids Res. 15: 2778. KI.OECKENER-GRUISSEM, B., J. E. MCEWEN and R. 0. POYTON, 1987 Nuclear functions required for cytochrome c oxidase biogenesis i n Saccharomyces cerevisiae: multiple trans-acting nuclear genes exert specific effects on the expression of each of the cytochrome c oxidase subunits encoded on mitochondrial DNA. Curr. Genet. 12: 31 1-322. KLOECKENER-GRUISSEM, B., J. E. MCEWEN and R. 0. POYTON, 1988 Identification of a third nuclear protein-coding gene required specifically for posttranscriptional expression of the mitorhondrial COX3 gene i n Saccharomyces cerevisiae. J. Bacterial. 170: 1390-1402. M A N I A T I S , T . , E. F. FRITSCH and J. SAMBROOK, 1982 Molecular Cloning: A Laboratory Manual.Cold Spring HarborLaboratory, Cold Spring Harbor, N.Y. J., 1983 New M 1 3 vectors for cloning. Methods EnMESSING, zymol. 101: 20-78. MILLER,J. H., 1982 Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. MORTIMER, R.K., and D. SCHILD,1985 Genetic map of Saccharomyces cerevisiae, Edition 9. Microbiol. Rev. 49: 181-212. MULLER, P. P.. M.K. REIF, S. ZONGHOU, C. SENGSTAG, T . L. MASON and T . D. FOX, 1984 A nuclear mutation that posttranscriptionally blocks accumulation of a yeast mitochondrial gene product can be suppressed by a mitochondrial gene rearrangement. J. Mol. Biol. 175: 431-452. MYERS, A.M., M. D. CRIVELLONEandA. TZAGOLOFF,1987 Assembly of the mitochondrial membrane system: MPRZ and MRPZ, twoyeast nuclear genes coding for mitochondrial ribosomal proteins. J. Biol. Chem. 262: 3388-3397. MYERS,M., A. L. K. PAPE and A. TZAGOLOFF,1985 Mitochondrial protein synthesis is required for maintenance of intact mitochondrial genomes in Saccharomyces cerevisiae. EMBO J. 4: 2087-2092. NASMYTH, K. A., and K. TATCHELL, 1980 The structure of transposable yeast mating type loci. Cell 1 9 753-764. 503 NEFF, N. F., J. H. THOMAS, P. GRISAFIand D. BOTSTEIN, 1983 Isolation of the &tubulin gene from yeast and demonstration of its essential function in vivo. Cell 33: 2 11-2 19. OHMEN,J. D., B. KLOECKENER-GRUISSEM and J. E. MCEWEN, 1988 Molecular cloning and nucleotide sequence of the nuclear PET122 gene required for expression of the mitochondrial COX3 gene in Saccharomyces cerevisiae. Nucleic Acids Res. 1 6 10783-10802. ORR-WEAVER, T . L., J. W. SZOSTAKand T . J. ROTHSTEIN, 1981 Yeast transformation: a model system for the study of recombination. Proc. Natl. Acad. Sci. USA 78: 6354-6358. PARTALEDIS, J. A,, and T. L. MASON,1988 Structure and regulation of a nuclear gene in Saccharomyces cerevisiae that specifies MRPI3, a protein of the small subunit of the mitochondrial ribosome. Mol. Cell. Biol. 8: 3647-3660. PEARSON, W . R., and D. J.LIPMAN, 1988 Improved tools for biological sequence comparison. Proc. Natl. Acad.Sci. USA 85: 2444-2448 POUTRE,C. G . , and T . D. FOX,1987 P E T l I l , a Sarrharomyces cerevisiae nuclear gene required for translation of the mitochondrial mRNA encoding cytochrome c oxidase subunit 11. Genetics 115: 637-647. RODEL,G., 1986 Two yeast nuclear genes, CBSZ and CBSZ, are required for translation of mitochondrial transcripts bearing the 5’-untranslated COB leader. Curr. Genet. 11: 41-45. RODEL,G., and T . D. Fox, 1987 The yeast nuclear gene CBSZ is required for translation of mitochondrial mRNAs bearing the cob 5”untranslated leader. Mol. Gen. Genet. 206: 45-50. RODEL,G., A. KORTE and F. KAUDEWITZ, 1985 Mitochondrial suppression of a yeast nuclear mutation which affects the translation of the mitochondrial apocytochrome b transcript. Curr. Genet. 9: 641-648. ROSE, M.D.,F. WINSTON and P. HIETER, 1988 Methods in Yeast Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. ROSE, M. D., P. NOVICK, J. H. THOMAS,D. BOTSTEINand G. R. FINK,1987 A Saccharomyces cerevisiae genomic plasmid bank based on a centromere-containingshuttle vector. Gene 6 0 237-243. ROTHSTEIN, R. J., 1983 One-step gene disruption in yeast. Methods Enzymol. 101: 202-21 1. SANGER, F., S. NICKLENand A. R. COULSON,1977 DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467. SPRAGUE, G. F.J., R. JENSEN and I. HERSKOWITZ, 1983 Control of yeast cell type by the mating type locus: positive regulation of the a-specific STE3 gene by the MATaZ product. Cell 32: 409-4 15. STRICK, C. A., and T. D. FOX,1987 Saccharomyces cerevisiae positive regulatory gene PET1 I I encodes a mitochondrial protein that is translated from an mRNA with a long 5’ leader. Mol. Cell. Biol. 7: 2728-2734. STRUHL,K., D. T. STINCHCOMB, S. SCHERER and R. W. DAVIS, 1979 High frequency transformation of yeast: autonomous replication of hybrid DNA molecules. Proc. Natl. Acad. Sci. USA 7 6 1035- 1039. TZAGOLOFF, A., and A. M. MYERS,1986 Genetics of mitochondrial biogenesis. Annu. Rev. Biochem. 5 5 249-285. YANISCH-PERRON, C., J. VIEIRAand J. MESSING,1985 Improved MI3 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUCl9 vectors. Gene 33: 103119. Communicating editor: M. CARLSON