Download What are enzymes and how do they work

Bio200 POGIL Cell Biology Activity 3 - Translation
Schivell
MODEL 1: (RQ10)
We are reprinting these questions for you so that you can compare your answers to questions
2-4 with your group before you move on to Model 2.
Model 1 is the video "Translation Movie" on our website under the "Movies-3" link on the
Bio200 homepage. You may need to watch the animation several times to answer all of the
questions below.
Notes: There are several components of translation shown in their "true" molecular form (as
determined by research using X-ray crystallography). In addition, the animation is showing
you translation at its estimated real speed in eukaryotes!
Critical Thinking Questions:
1. Identify each of the following structures (by watching their behavior in the video) and write
what color they have in the blanks.
- ribosome: The machine _________
- messenger RNA (mRNA): information ____________
- protein: product _____________
- transfer RNA (tRNA): decoder ____________
2. Watch carefully the very beginning of the process.
a. Which part of the ribosome binds to the mRNA initially? ____________________
b. Does translation start at the very end of the mRNA or somewhere else? ___________
3. a. What must be attached to tRNAs as they enter the ribosome? ____________________
b. How are tRNAs different when they leave the ribosome? _______________________
4. What is the maximum # of tRNAs that can fit into the ribosome at the same time? _________
1
Bio200 POGIL Cell Biology Activity 3 - Translation
Schivell
MODEL 2:
= "codon"
= "anticodon"
Critical Thinking Questions
5. a. Label as many components of the cartoon as you can.
b. The small subunit of the ribosome initially binds to the "ribosome binding site" near the
5' end of the mRNA. What type of bases are found at high frequency at the 5' end?
- purines
- pyrimidines
- G's and C's
-A's and T's
6. Label the 5' and 3' sides of the anticodons.
7. a. How many nucleotides are there in a codon? __________ in an anticodon? __________
b. Which molecule contains codons? ___________ Which contains anticodons? __________
c. What type of bond holds the tRNA in the ribosome? ________________
d. How many amino acids does each tRNA carry? ______
e. Based on the drawing, does the "start codon" have to be found "in frame" with the 5' end
of the mRNA? (Do you start counting triplets from the 5' end)?
8. Label each tRNA with their appropriate name:
- "Amino-acyl tRNA"
- "Peptidyl tRNA
2
- "Empty tRNA"
Bio200 POGIL Cell Biology Activity 3 - Translation
Schivell
9. Use the letters A, P, and E (as they correspond to the tRNAs in question 8) to label the three
tRNA binding sites in the ribosome.
10. Carefully consider the image and the incoming and outgoing molecules. In which
direction must the ribosome move ("translocate") along the mRNA?
(From 5' to 3' or from 3' to 5'?) _________
3
Bio200 POGIL Cell Biology Activity 3 - Translation
Schivell
MODEL 3:
This model shows the change in covalent
bonding between amino acids and tRNAs
during translation.
amino acid
tRNA with the
nucleotide at one
end shown much
larger than the rest
of the molecule
11. Which end of the tRNA is attached
to the amino acid, 5' or 3'?
12. a. In the top half of the model...
... circle the two atoms that will be connected
by a new bond.
... draw a slash through the bond that will be
broken.
b. In the bottom half of the model, circle
the newly formed bond.
13. Ribosomes consist of a few very long RNAs (ribosomal RNAs) and
several proteins. If all of the proteins were taken away from the ribosome,
the reaction shown above would still proceed. What type of molecule
catalyzes the reaction?
14. The drawing to the right shows a short protein of 8 amino acids
that is complete, but is still in the ribosome.
a. Circle the bond that needs to be broken before the protein
can be used.
b. Label the amino terminus and the soon-to-be-carboxyl terminus
of the protein.
c. Draw a square around a peptide bond.
4
Bio200 POGIL Cell Biology Activity 3 - Translation
Schivell
MODEL 4:
Termination of translation (from Freeman, 4e)
"release
factor"
16. Compare the two tRNAs in this model with release factor. List two things that release
factor does NOT have that the tRNAs do have (or had at some point).
________________________
________________________
17. Release factor is NOT a nucleic acid, yet it is capable of catalysis.
What kind of biological macromolecule must it be? _______________
18. One covalent bond is broken in the figure above.
a. What two things are held together by that covalent bond? _______________________
(See the figure for Q14 for detail)
b. Describe release factor's enzymatic function in a few words:
19. What is the nucleotide sequence of the codon that binds release factor? ___________
(This is called a "stop codon".)
20. Using the codon table on page 6, list two other codons that release factor can bind to:
(include 5' and 3' labels)
______________
_____________
5
Bio200 POGIL Cell Biology Activity 3 - Translation
Schivell
MODEL 5:
This diagram shows an amino-acyl tRNA (top), and four different amino-acyl tRNA
synthetase enzymes. These enzymes are responsible for attaching the appropriate amino acid
to a tRNA. **** They are also Dr. Mandy's FAVORITE enzymes!
amino acid
tRNA (light gray)
Amino-acyl tRNA
4 different
"amino-acyl
tRNA
synthetase"
enzymes
(dark gray)
www.pdb.org
22. Draw a square around the part of the tRNA (at the top) that must contain the anti-codon.
(Be sure to go back and consider models 1 and 2.)
23. a. Using the name "amino-acyl tRNA synthetases" as
a guide, name two different substrates of these enzymes: ____________
_______________
b. These enzymes also require ATP as a substrate. Give a likely explanation for this.
24. The aa-tRNA synthetases (an abbreviation) are a large family of enzymes found in every
living cell.
a. What parts of the enzymes must be different between different members of this family?
b. Are the reactions catalyzed by different members of this family the same or different?
How do you know?
25. How many different aa-tRNA synthetase
enzymes are needed (at the very least) by a cell? _________
6
Bio200 POGIL Cell Biology Activity 3 - Translation
On your own:
Schivell
1. This is the sequence of a complete mRNA from a bacterial cell:
5' UCAAGGAGGCGUUAGCAUGAAAUUUAUGGGGCGGGUAUAGCUAGCAUUUCAAG 3'
a. Write the protein sequence that is translated from this mRNA on the line below, and label
the amino (N) and carboxyl (C) termini of the protein.
b. How many tRNAs will bind to the ribosome to make this protein? _________
c. Which of the following sequences within the mRNA most likely contains the ribosome
binding site? (Circle ONE)
5'UAGCUAGCA3'
5'UUAAUGG3'
7
5'AAGGAGGC3'
Bio200 POGIL Cell Biology Activity 3 - Translation
Schivell
2. For each different mutant cell described below, assume that ONE specific molecule or part
of a molecule is mutated in that cell so that the molecule’s function has changed. Name as
many molecules that could result in the description (but remember that for the mutant
phenotype, you are considering each mutation by itself).
Cell 1: In many different types of proteins, there is the amino
acid Thr (threonine) where an Ala (alanine) should be.
________________________
Cell 2: Many different types of proteins are much shorter than
in a normal cell, but have the correct sequence up to that
point. tRNA levels are normal in the cell.
________________________
Cell 3: mRNAs are bound to small ribosomal subunits, but
nothing else is attached. Large ribosomal subunits are
floating in the cytoplasm, and no proteins are made.
________________________
3. Should there be tRNAs in the cell that can base pair with a stop codon? Why or why not?
8