* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download What are enzymes and how do they work
Protein–protein interaction wikipedia , lookup
Polyadenylation wikipedia , lookup
Lipid signaling wikipedia , lookup
Point mutation wikipedia , lookup
Paracrine signalling wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Polyclonal B cell response wikipedia , lookup
Signal transduction wikipedia , lookup
Evolution of metal ions in biological systems wikipedia , lookup
Gene regulatory network wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Metalloprotein wikipedia , lookup
Gene expression wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Messenger RNA wikipedia , lookup
Proteolysis wikipedia , lookup
Biochemistry wikipedia , lookup
Genetic code wikipedia , lookup
Epitranscriptome wikipedia , lookup
Bio200 POGIL Cell Biology Activity 3 - Translation Schivell MODEL 1: (RQ10) We are reprinting these questions for you so that you can compare your answers to questions 2-4 with your group before you move on to Model 2. Model 1 is the video "Translation Movie" on our website under the "Movies-3" link on the Bio200 homepage. You may need to watch the animation several times to answer all of the questions below. Notes: There are several components of translation shown in their "true" molecular form (as determined by research using X-ray crystallography). In addition, the animation is showing you translation at its estimated real speed in eukaryotes! Critical Thinking Questions: 1. Identify each of the following structures (by watching their behavior in the video) and write what color they have in the blanks. - ribosome: The machine _________ - messenger RNA (mRNA): information ____________ - protein: product _____________ - transfer RNA (tRNA): decoder ____________ 2. Watch carefully the very beginning of the process. a. Which part of the ribosome binds to the mRNA initially? ____________________ b. Does translation start at the very end of the mRNA or somewhere else? ___________ 3. a. What must be attached to tRNAs as they enter the ribosome? ____________________ b. How are tRNAs different when they leave the ribosome? _______________________ 4. What is the maximum # of tRNAs that can fit into the ribosome at the same time? _________ 1 Bio200 POGIL Cell Biology Activity 3 - Translation Schivell MODEL 2: = "codon" = "anticodon" Critical Thinking Questions 5. a. Label as many components of the cartoon as you can. b. The small subunit of the ribosome initially binds to the "ribosome binding site" near the 5' end of the mRNA. What type of bases are found at high frequency at the 5' end? - purines - pyrimidines - G's and C's -A's and T's 6. Label the 5' and 3' sides of the anticodons. 7. a. How many nucleotides are there in a codon? __________ in an anticodon? __________ b. Which molecule contains codons? ___________ Which contains anticodons? __________ c. What type of bond holds the tRNA in the ribosome? ________________ d. How many amino acids does each tRNA carry? ______ e. Based on the drawing, does the "start codon" have to be found "in frame" with the 5' end of the mRNA? (Do you start counting triplets from the 5' end)? 8. Label each tRNA with their appropriate name: - "Amino-acyl tRNA" - "Peptidyl tRNA 2 - "Empty tRNA" Bio200 POGIL Cell Biology Activity 3 - Translation Schivell 9. Use the letters A, P, and E (as they correspond to the tRNAs in question 8) to label the three tRNA binding sites in the ribosome. 10. Carefully consider the image and the incoming and outgoing molecules. In which direction must the ribosome move ("translocate") along the mRNA? (From 5' to 3' or from 3' to 5'?) _________ 3 Bio200 POGIL Cell Biology Activity 3 - Translation Schivell MODEL 3: This model shows the change in covalent bonding between amino acids and tRNAs during translation. amino acid tRNA with the nucleotide at one end shown much larger than the rest of the molecule 11. Which end of the tRNA is attached to the amino acid, 5' or 3'? 12. a. In the top half of the model... ... circle the two atoms that will be connected by a new bond. ... draw a slash through the bond that will be broken. b. In the bottom half of the model, circle the newly formed bond. 13. Ribosomes consist of a few very long RNAs (ribosomal RNAs) and several proteins. If all of the proteins were taken away from the ribosome, the reaction shown above would still proceed. What type of molecule catalyzes the reaction? 14. The drawing to the right shows a short protein of 8 amino acids that is complete, but is still in the ribosome. a. Circle the bond that needs to be broken before the protein can be used. b. Label the amino terminus and the soon-to-be-carboxyl terminus of the protein. c. Draw a square around a peptide bond. 4 Bio200 POGIL Cell Biology Activity 3 - Translation Schivell MODEL 4: Termination of translation (from Freeman, 4e) "release factor" 16. Compare the two tRNAs in this model with release factor. List two things that release factor does NOT have that the tRNAs do have (or had at some point). ________________________ ________________________ 17. Release factor is NOT a nucleic acid, yet it is capable of catalysis. What kind of biological macromolecule must it be? _______________ 18. One covalent bond is broken in the figure above. a. What two things are held together by that covalent bond? _______________________ (See the figure for Q14 for detail) b. Describe release factor's enzymatic function in a few words: 19. What is the nucleotide sequence of the codon that binds release factor? ___________ (This is called a "stop codon".) 20. Using the codon table on page 6, list two other codons that release factor can bind to: (include 5' and 3' labels) ______________ _____________ 5 Bio200 POGIL Cell Biology Activity 3 - Translation Schivell MODEL 5: This diagram shows an amino-acyl tRNA (top), and four different amino-acyl tRNA synthetase enzymes. These enzymes are responsible for attaching the appropriate amino acid to a tRNA. **** They are also Dr. Mandy's FAVORITE enzymes! amino acid tRNA (light gray) Amino-acyl tRNA 4 different "amino-acyl tRNA synthetase" enzymes (dark gray) www.pdb.org 22. Draw a square around the part of the tRNA (at the top) that must contain the anti-codon. (Be sure to go back and consider models 1 and 2.) 23. a. Using the name "amino-acyl tRNA synthetases" as a guide, name two different substrates of these enzymes: ____________ _______________ b. These enzymes also require ATP as a substrate. Give a likely explanation for this. 24. The aa-tRNA synthetases (an abbreviation) are a large family of enzymes found in every living cell. a. What parts of the enzymes must be different between different members of this family? b. Are the reactions catalyzed by different members of this family the same or different? How do you know? 25. How many different aa-tRNA synthetase enzymes are needed (at the very least) by a cell? _________ 6 Bio200 POGIL Cell Biology Activity 3 - Translation On your own: Schivell 1. This is the sequence of a complete mRNA from a bacterial cell: 5' UCAAGGAGGCGUUAGCAUGAAAUUUAUGGGGCGGGUAUAGCUAGCAUUUCAAG 3' a. Write the protein sequence that is translated from this mRNA on the line below, and label the amino (N) and carboxyl (C) termini of the protein. b. How many tRNAs will bind to the ribosome to make this protein? _________ c. Which of the following sequences within the mRNA most likely contains the ribosome binding site? (Circle ONE) 5'UAGCUAGCA3' 5'UUAAUGG3' 7 5'AAGGAGGC3' Bio200 POGIL Cell Biology Activity 3 - Translation Schivell 2. For each different mutant cell described below, assume that ONE specific molecule or part of a molecule is mutated in that cell so that the molecule’s function has changed. Name as many molecules that could result in the description (but remember that for the mutant phenotype, you are considering each mutation by itself). Cell 1: In many different types of proteins, there is the amino acid Thr (threonine) where an Ala (alanine) should be. ________________________ Cell 2: Many different types of proteins are much shorter than in a normal cell, but have the correct sequence up to that point. tRNA levels are normal in the cell. ________________________ Cell 3: mRNAs are bound to small ribosomal subunits, but nothing else is attached. Large ribosomal subunits are floating in the cytoplasm, and no proteins are made. ________________________ 3. Should there be tRNAs in the cell that can base pair with a stop codon? Why or why not? 8