* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download The basic unit of an immunoglobulin (Ig) molecule is composed of
Gene therapy wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
SNP genotyping wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Gene regulatory network wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Genetic engineering wikipedia , lookup
Molecular Inversion Probe wikipedia , lookup
DNA supercoil wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Gene expression wikipedia , lookup
Molecular cloning wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Genetic code wikipedia , lookup
Genomic library wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Biochemistry wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Non-coding DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Community fingerprinting wikipedia , lookup
Biosynthesis wikipedia , lookup
Point mutation wikipedia , lookup
Volume 13 Number 8 1985 Nucleic Acids Research Cloning and sequence analysis of an Ig X light chain mRNA expressed in the Burkitt's lymphoma cell line EB4 M.L.M.Anderson, L.Brown, E.McKenzie, J.E.Kellow and B.D.Young* Beatson Institute for Cancer Research, Garscube Estate, Switchback Road, Bearsden, Glasgow, UK Received 18 February 1985; Accepted 22 March 1985 ABSTRACT A cDNA l i b r a r y was c o n s t r u c t e d from t h e mRNA of t h e I g \ producing B u r k i t t ' s lymphoraa c e l l l i n e , EB4. Overlapping c l o n e s encompassing t h e coding sequence of the IgX. mRNA were isolated and sequenced. The predicted amino a c i d sequence shows a s h o r t hydrophobic l e a d e r p e p t i d e and a mature polypeptide of 217 residues in which V, J and C regions can be distinguished. The V region belongs t o subgroup VI and has g r e a t e s t homology (80%) with the Amyloid-AR protein. The constant region i s the Kern" 0z + isotype. Probing normal human DNA with the subcloned V^ coding sequence d e t e c t s one gene a t high s t r i n g e n c y and a f a m i l y of 11 members a t low s t r i n g e n c y . To d a t e , no r e s t r i c t i o n enzyme s i t e polymorphisms have been detected. The V\m gene i s rearranged on both chromosomes of EB4 and i s deleted on both chromosomes in the B u r k i t t ' s lymphoma c e l l l i n e BL2. INTRODUCTIOM The basic unit of an immunoglobulin (Ig) molecule is composed of two heavy and two light polypeptide chains. In any one molecule, the light chains are either both k or both X type, but never a mixture. The ratio of k:\ chains in human serum Ig is 60:10 (1). Ig light chains are encoded by three segments, variable (VL) genes, joining (JL) sequences and constant (CL) genes. In germ line cells, these genes are discontinuous and are not transcribed (2,3). Light chain production involves rearrangement of DNA in B lymphocyte precursor cells such that one of many VL genes is juxtaposed to one of several JL sequences. This generates an activated light chain gene which is transcribed (2,3). Excision of the intron between the J^ and C^ sequences in the primary transcript gives rise to light chain mRNA. The human Igk locus has been extensively studied and the V, J and C segments which contribute to k chain production have been defined (2,3). By contrast, less is known about the human Ig\ locus. The constant region genes have been mapped and their structure and organisation are known (4,5). However comparatively l i t t l e is known about the V^ and J^ region genes. To © IRL Press Limited, Oxford, England. 2931 Nucleic Acids Research date, only one genomic V^ gene has been isolated and i t cross hybridises to a family of about 10 members (6). A V^j sequence from an Ig\ cDNA has recently been reported which detects a family of some 12 members (7). The human Ig V^ locus must therefore be more complex than the better studied mouse V^ locus which contains only two members for inbred lines (8-10) and three for feral s t r a i n s (11). In order to characterise further the human V^ locus, we have isolated an Ig\ cDNA containing a \ V I sequence and used i t to probe human DNA from light chain producing and non producing sources. MATERIALS AHD METHODS Construction and s c r e e n i n g of a cDNA Library Cytoplasmic RNA was prepared by phenol e x t r a c t i o n of the post mitochondrial supernatant of EB4 cells lysed in 0.14 M NaCl, 10mM Tris-HCl, pH7.4, 1.5mM MgCl2, 0.5% NP40. The polyadenylated mRNA was recovered by alcohol precipitation followed by two cycles of adsorbtion and elution from an oligo (dT)-cellulose column (12). Double stranded cDNA prepared by the method of Wickens (13,14), was ligated into the Smal s i t e of the plasmid pUC8. A cDNA l i b r a r y (50,000 recombinants from 0.5 ug polyadenylated RNA) was made and screened a t high density (15) using as a probe, pul 3.2, a subcloned 0.6 kb Bglll-EcoRI fragment of the Ig C^ locus which includes the c \2 gene, Ke"0z+ (4). The DNA from purified positive clones was analysed on Southern blots to determine the insert size and confirm the hybridisation to the Ig C^ probe. DNA Sequencing Inserts from cDNA clones were excised with EcoRI and Hindlll and were subcloned into the appropriate s i t e s of r e p l i c a t i v e form DNA of the bacteriophages M13mp8 and M13mp9. Sequencing was carried out by the method of Sanger (16,17) using (a35S)dATPaS. Human DNA p r e p a r a t i o n DNA from tissue culture cell lines was prepared by the method of GrossBellard et a l . (18). To frozen cord blood was added an equal volume of 5M guanidinium thiocyanate, 50 mM Tris-HCl pH 7.0, 50mM EDTA, 5% mercaptoethanol. The blood was thawed a t room temperature with gentle mixing. An equal volume of isopropanol was added and the DNA which precipitated immediately, was isolated by centrifugation, then washed in 70$ ethanol and dried. The DNA was purified from protein and RNA by conventional procedures (18). 2932 Nucleic Acids Research Restriction digests, Gel electrophoresis, Transfer and Hybridisation of DNA These procedures are described in (6). Probes - In a l l cases inserts excised from plasmids were used as probes, pul 3.2 A 0.6 kb EcoRI-Bgl II fragment carrying the Ig\ C^3 gene (t) pLB1.3 A 0.3 kb Alu I- Alu I fragment carrying the V^VI gene (this paper) pHV0.6 A 0.6 kb BamHI-Bglll fragment subcloned from pHV4A and carrying a genomic Ig Vo gene (6). (The predicted amino and sequence of t h i s gene does not f a l l into any of the subgroups so far described. I t was formerly tentatively assigned to a new subgroup VII (6) however, since i t i s not known if i t i s ever transcribed, the designation of subgroup 0 seems more appropriate.) RESULTS AMD DISCUSSION Characterisation of X chain cDNA by cloning and sequencing The EB4 cell l i n e i s derived from malignant lymphocytes of a patient suffering from Burkitt's lymphoma (19) and has been shown to produce IgX l i g h t chains (20). To i s o l a t e a V sequence, we constructed a cDNA l i b r a r y from EBt polyadenlyated cytoplasmic RNA and screened i t with a genomic Ig C^ gene probe. Although i t was not known which of the six C^ genes is used for mRNA synthesis in EB4 c e l l s , the C^ genes differ in sequence by only a few nucleotides (4), so any one should hybridise to all C^ sequences. A total of 8 positively scoring recombinants was isolated. To determine if these recombinant clones contained a V^ sequence, the inserts were recloned into the phage vectors M13mp8 and M13mpQ and sequenced. Fig. 1 shows r e s t r i c t i o n maps and the sequencing strategy of 4 Fig. 1. Restriction map of cDNA clones representing human Ig \ light chain gene and the strategy for DNA sequencing. The DNA r e s t r i c t i o n fragments indicated by arrows were sequenced by the procedure of Sanger (16,17). Overlapping sequences from both strands were determined. A = Alul, H = Hpal. The dotted line shows the 0.3 kb subcloned Alul-Alul fragment, pLB1.3. 2933 Nucleic Acids Research HUH.LBV TCTGAGGATACGCGTGACAGATAAGAAGGGCTGGTGGGATCAGTCCTGGTGGTAGCTCAG IB 28 38 48 SB 60 -19 M A W A P L L L T L r.AAGCAGAGCCTGGAGCATCTCCACTATGGATGGCCTGGGCTCCACTACTTCTCACCCTC 78 BB 98 188 118 128 1 I A H C T O C U A N F H L T O P H S U S CTCGCTCACTGCACAGATTGTTGGGCCAATTTTATGCTGACTCAGCCCCACTCTGTGTCG 138 140 1S8 168 170 188 , 20 £t E S P G K T V T I S C |T G N S G S I A S GAGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCGGCAACAGTGGCAGTATTGCCAGC 198 288 218 228 238 248 40 N V U 0 1 U Y O O R R V S A P T I V I Y \T^ AACTATGTGCAGTGGTATCAGCAGCGCCGGGTCAGTGCCCCCACCATTGTGATCTATGAG 258 260 278 268 298 388 CD ^ 2 60 D N D R P L I G V P D R F S O S I D S S S GATAACCAAAGACCTCTGGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCCTCC 318 328 338 348 358 368 80 N S A S L T I S G L K T E D E A B Y Y C AACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGT 378 388 398 488 418 420 , I ^ ^ .100 O S F D N T N Q I G V F G G G T K L T V L CAGTCTT1TGATAACACCAATCAAGGAGTGTTCGGCGGAGGGACCAAGTTGACCGTCCTA 438 448 458 468 478 488 120 G Q P K A A P S V T L F P P S S E E L Q GGTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCACCCTCCTCTGAGGAGCTTCAA 490 500 518 528 538 548 140 A N K A T L V C L I S D F Y P G A U T U GCCAACAAGGCCACACTGGTGTGTCTCATAAGTGACTTCTACCCGGGAGCCGTGACAGTG 550 568 570 586 590 600 160 A U K A D S S P U K A G U E T T T P S h GCCTGGAAGGCAGATAGCAGCCCCGTCAAGGCGGGAGTGGAGACCACCACACCCTCCAAA 618 620 630 648 658 668 180 O S N N K Y A A S S Y L S L T P E O W K CAAAGCAACAACAAGTACGCGGCCAGCAGCTACCTGAGCCTGACGCCTGAGCAGTGGAAG 678 688 690 780 718 728 200 S H K S Y S C O W T H E G S T W E h T V TCCCACAAAAGCTACADCTGCCAGGTCACGCATGAAGGGAGCACCGTGGAGAAGACAGTR 738 740 758 760 770 788 A P T E C S * GLLCCIACAGAATGTTCATAGGTTCTCATCCCTCACCCCCCACCACGGGAGACTAGAG 798 800 BIB 828 838 Fig. 2. Nucleic acid sequence of the human Ig \ cDNA. The predicted araino acid sequence i s shown above the coding region. Figures below the nucleic acid sequence refer to the nucleotide number and figures above the araino acid sequence refer to the ami no acid number. Minus numbers denote amino acids in the leader peptide. CDR denotes complementary determining region. 2934 Nucleic Acids Research cONA Aft NIG-4B cDNA AR NIG-48 IB 28 3S 48 CDR1 NFNLTQPHSV SESPGKTVTI SC TGNSGSIA SNYVE <V90R D F SG DSF— -L—I—P— M — -RT-D 1—R— ** * 78 88 58 60 CDR2 RVSAPTIVIY EDN0RPL 3VP PG T D £ ' PGG I L — DT ** * * * * 96 188 118 C0R3 DRFSGSIDSS SNSASLTISG LKTEDEADYY C 3SFDNTNC i VFGGGTKLTV LG D- A YNSNHH I V N F TND-T-M-F - —Y-SS-LW -S ***** * * ** * * * * Fig. 3. Comparison of the predicted amino acid sequence encoded by the LBV cDNA V region and members of human subgroup VI. A dash in the sequences of AR (Amyloid-AR) and NIG 48 indicates identity at that position to the cDNA V sequence. CDR denotes complementarity determining region. Stars denote positions of low variability (21-23). overlapping subclones which encompass the coding region. A compilation of the sequence information i s presented in Fig. 2. We shall refer to the compiled sequence as LBV. There i s an open reading frame s t a r t i n g a t nucleotide 91 and extending for 700 bases. This predicts an amino acid sequence in which a leader peptide, and the V, J and C regions characteristic of Ig light chains can be distinguished. A 19 amino acid long hydrophobic peptide encoded by nucleotides 91-147 precedes the V region. This peptide i s probably a signal peptide which i s cleaved from precursor Ig chains as they pass through the c e l l membrane. While mouse V^ leader peptides have been known for several years (10,9), human \ signal peptides have only recently been predicted from the nucleotide sequences of a genomic V^ (pHV4A) and a cDNA V^j clone (6,7). The mouse and human leader peptides have the same length, 19 amino acids, and are hydrophobic in nature, although the amino acid sequences are not identical. The LBV leader peptide has the same amino acid a t 12/19 positions as the cDNA V^ sequence and at 9/19 positions as the genomic pHV4A V^ sequence. There i s a striking conservation of the first 9 nucleotides in the leader sequences of the LBV, pHV4A and mouse Ig VXI DNAs, but the significance of t h i s i s not known. The complete V domain of the mature light chain polypeptide i s 112 amino acids long and i s encoded by nucleotides 148-483. The three complementarity determining r e g i o n s (CDR1,2,3) c h a r a c t e r i s t i c of V r e g i o n s can be distinguished and the appropriate amino acid i s generated a t 23/26 positions designated as low variant; Fig. 3 (21-23). The amino acid sequence of the complete V domain was compared by 2935 Nucleic Acids Research computer to a l l known human Ig V^ chains. Greatest homology was observed with Amyloid-AR and NIG-48 (80{ and 73% respectively), the only two members of subgroup VI for which the complete sequence is known (22). Since V chains are assigned to the same subgroup if they share 70$ or greater homology (22,23), we conclude that EB4 c e l l s produce subgroup VI V^ chains. A characteristic feature of the fully sequenced members of subgroup VI, which is not shared by other subgroups, is the presence of three extra amino acids, X-Asp-X, at positions 66-68. This feature is also present in the LBV protein sequence. Of the partially sequenced members of subgroup VI, only GIO has complete homology with LBV. However, since only 24 amino acids of GIO have been determined, we do not know if LBV is identical to GIO. The thirteen amino acids at the carboxy terminal end of the complete V domain are highly conserved and are encoded by a J segment of DNA (22,2,3). Within the complete V domain of LBV, nucleotides 445-183 corresponding to amino acids 100-112 derive from a J segment of DNA. To date apart from that of a processed pseudogene (24), no human genomic J^ DNA sequence has been reported. The J sequence used in EB4 X mRNA production shares identity at 34/39 positions a t the nucleotide level and 12/13 positions at the amino acids level with the J sequence recently described for a human V^j cDNA clone (7). The amino acid difference between these two sequences i s a t position one. This i s known to be a hot spot for mutation (22) because i t occurs at the join of V and J DNA where the position of recombination i s flexible and thus contributes to V chain diversity (2,3). There are six human X constant region genes clustered in a 40 kb stretch of DNA of which three have been sequenced (4). The constant region expressed in EB4 c e l l s (amino acids 113-217 encoded by nucleotides 484-801) i s most homologous to the C^^ gene which encodes the isotype Kern~0z+. The only differences (at nucleotides 600,636,700,789 in Fig. 2) are in the third base position of codons and therefore the predicted amino sequence i s identical to the Kern"Oz+ isotype. Nucleotides 1-90 of LBV constitute the 5' non coding sequence. I t has l i t t l e homology to the mouse or either of the two other human X 5' flanking regions so far described (9,6,7). Human X chains may be more variable in their 5' untranslated sequences than their k counterparts for i t has been shown that two members of the same subgroup are identical for 388 nucleotides immediately preceding the coding region (25). On the other hand, i t i s possible t h a t flanking regions of members of the same X subgroup are very 2936 Nucleic Acids Research HI Hind III i ^o«l - - m HI O s s "r> p» - w *"> * • S2S o 5 347 —If— •. « 3s - S S Z H ind 1120 16 74 B o .n i III s! = • *• o IcoKI — to •* * S t —T O 2-1-1 1-9— Fig. 4. Hybridisation of subcloned 0.3 kb V^VI probe to human DNA. Ten raicrograms of DNA from each of six individuals was restricted with BamHI, Hindlll or EcoRI. Five raicrograras of each digest was fractionated on d u p l i c a t e 1$ agarose g e l s and t r a n s f e r r e d to GeneScreen f i l t e r s . Hybridisation of the probe was under A) high stringency or B) low stringency conditions as described in (6). Lanes 1-6, BamHI digests: lanes 7-12, Hindlll digests: lanes 13-18, EcoRI digests. Numbers above lanes identify the individuals; numbers to the left indicate the length in kb of Hindlll A DNA and Haelll/ (JIX174 DNA markers. similar, but differ from those of other subgroups. same subgroups are characterised, When other members of the i t will be possible to resolve t h i s question. Determination of Copy Number of V^yj genes To determine the extent of polymorphism and to estimate the copy number of the IgV^yj genes, we probed digests of several human DNAs with a subcloned 0.3 kb Alu-Alul fragment, pLB1.3, which contains only leader and V^ coding sequences (Fig. 1). The results obtained when DNA samples from cord blood of six unrelated individuals were analysed at two different stringencies are shown in Fig. 4. For Hindlll, BamHI and EcoRI digests only one band was observed a t high stringency. At lower stringency, 11 bands were observed with each digest. In an analysis of 18 different people, we found no evidence of polymorphism for any of the above enzymes. This means that here, gene counting by Southern blot analysis i s not complicated by r e s t r i c t i o n fragment length polymorphisms. The above results suggest that there i s one gene per haploio complement with sufficient homology to be detected at high 2937 Nucleic Acids Research 2-1 19- Fig. 5. Hybridisation of subcloned V^ probes to DNA from Burkitt's lymphoma cell l i n e s . Human DNAs were digested with EcoRI, fractionated on 0.8$ agarose gels and transferred to filters. Hybridisation and washing were at high stringency conditions. 36831 and 31071, cord blood DNA. The type of Ig light chain produced and translocation in Burkitt's lymphoma lines is: LY47 (-, 8:22); LY67 ft., 8:22); BL2 ft, 8:22); JI (k, 8:2); LY91 (k, 8:2); EB4 ft, 8:14) (26). The NALM-1 cell l i n e c a r r i e s a 9:22 chromosomal translocation (30). A - V^VI probe (pLB 1.3), B - genomic V^ probe (pHV0.6), both under high stringency conditions.. stringency of hybridisation and that there is a family of at least 11 members which cross hybridise with the V^yj sequence. When the same b l o t s were hybridised a t low stringency to a subcloned genomic V^Q probe pHV0.6 (6), about 10 bands were observed which did not overlap with those hybridising to pLB1.3 (data not shown). At a minimum estimate then, the human V^ locus must consist of a t l e a s t 20 members. When several hybridization probes are available for each subgroup, i t w i l l be possible to make more accurate estimates. The number of V^ genes will be known definitely only when a l l the genes have been cloned and sequenced, since only by sequencing can we distinguish between potentially functional genes and pseudogenes. Characterisation of the V^VI gene in lymphoid cell lines The Ig loci in cord blood DNA are in the germ line or unrearranged form. In order to examine the V^yj gene arrangement in Ig producing c e l l s , we probed a Southern blot of EcoRI digested DNAs with 3 2 P-labelled pLB1.3 DNA (Fig. 5A). DNA samples were from cord blood (non producing), Burkitt's lymphoma c e l l l i n e s (k or \ producers) and the NALM-1 c e l l line (a myeloid 2938 Nucleic Acids Research l i n e with a 9:22 translocation). In cord blood DNA (lanes 2 and 3), the probe detected a single germline band of 5.0 kb. With DNA of the k producing l i n e s , JI and LY91, the same 5.0 kb band was observed indicating that the V^yj gene is not rearranged in these cells. This i s what i s expected since i t appears t h a t during B lymphocyte d i f f e r e n t i a t i o n , there i s an ordered sequence of l i g h t chain gene rearrangement during B lymphocyte differentiation. Kappa genes are rearranged f i r s t and only if t h i s i s aberrant and f a i l s to give r i s e to k l i g h t chains, does the \ locus become rearranged (27). Since EB4 cells express V^yj sequences, the Vj^yj gene must be rearranged on a t l e a s t one copy of chromosome 22. As seen in Fig. 5A, lane 9, the 5.0 kb band i s missing and instead a single band of 2.2 kb i s detected. This i s probably the productively rearranged gene. The other so-called "excluded" a l l e l e appears to be deleted or, l e s s l i k e l y , may also be rearranged to the same size of fragment. BL2 (a \ producer) gives a weaker signal with the pLB1.3 probe than control samples even although the same amount of DNA was applied to the gel. This suggests that one allele of the pLB1.3 gene has been deleted. The other X producing cell line examined, LY67, must express a different V^ gene from EBt cells since the pLB1.3 gene is in the germ line form. An i d e n t i c a l blot prepared at the same time was probed with the V^Q probe, pHV0.6 (6) to compare i t s pattern of hybridisation to that of pLB1.3. Fig. 5B shows that the three strongly hybridising bands detected in the control cord blood samples are missing in EB4 DNA showing that both copies of chromosome 22 have a rearranged \ locus. A new faint band of 3.7 kb i s present in EB4 DNA and may represent a V^Q gene on the non productively rearranged chromosome. The LY47, LY67 and BL2 c e l l l i n e s analysed in Fig. 5 are a l l Burkitt's lymphoma cell lines with 8:22 chromosomal translocations. The breakpoint on chromosome 22 (22q11) i s in the same cytogenetic band to which Ig\C and W genes have been assigned (28,29, Anderson e t a l . manuscript in preparation). The \ V I and the pHV0.6 genes are not rearranged in LY47 and LY67 so they can not be very close to the breakpoint. However, i t i s s t r i k i n g that there are no bands hybridising to pHvu.6 in BL2 DNA. There has been loss of V^ sequences from both the productively rearranged chromosome 22 and the copy of chromosome 22 which i s involved in the 8:22 translocation. The same conclusion was recently reported based on analysis of BL2 DNA with a V^z 2939 Nucleic Acids Research probe (7). There i s no a l t e r a t i o n in the size of r e s t r i c t i o n fragments containing V^ genes in NALM-1 cells which have a 9:22 translocation involving the 22q11 band (30). This suggests that the breakpoint is not very close to these genes. Concluding Remarks The above results show that EB4 cells produce \ light chains of subgroup VI and subtype Ke~0z+. Subgroup VI was initially recognised through peptide analysis of proteins extracted from the splenic f i b r i l s of p a t i e n t s with primary arayloidosis (31»32). In the normal population, subgroup VI represents only 5% of the V sequences in X chains, but i t is the predominant subgroup associated with the amyloid condition (33). I t i s perhaps surprising that a subgroup which i s such a minor contributor to \ chains in normal cells should be one of the f i r s t to have i t s mRNA sequence determined. Further analyses will determine if subroup VI i s a predominant contributor to Burkitt's lymphoma light chains. ACKNOWLEDGagHTS We thank G. Stewart for g i f t s of frozen human cord blood and G.M. Lenoir for B u r k i t t ' s Lymphoma c e l l l i n e s . This work was supported by grants from the Leukaemia Research Fund and the Cancer Research Campaign. •Present address: Imperial Cancer Research Fund, Lincoln's Inn Fields, London REFERENCES 1. Kabat, E. (1976) S t r u c t u r a l Concepts in Immunology and Immunochemistry (Holt, Rinehart and Winston, New York) p232. 2. W a l l , R. and K u e h l , M. (1983) Ann. Rev. Immunol. 1, 3 9 3 - 4 2 2 . 3. Honjo, T. (1983) Ann. Rev. Immunol. 1 . 4 9 9 - 5 2 8 . 4. H i e t e r , P.A., H o l l i s , G.F., K o r s m e y e r , S.J., Waldemann, T.A. and L e d e r , P. (1980) N a t u r e , 3 0 4 , 5 3 6 - 5 4 0 . 5. Taub, R.A., H o l l i s , G.F., H i e t e r , P.A., K o r s m e y e r , S.J., Waldmann, T.A. and L e d e r , P. (1980) N a t u r e , 3 0 4 , 172-174. 6. A n d e r s o n , M.L.M., S z a j n e r t , M.F., K a p l a n , J.C., McColl, L. and Young, B.D. Nuc. A c i d . R e s . 12, 6 6 4 7 - 6 6 6 1 . 7. T s u j i m o t o , Y. and C r o c e , CM. (1984) Nuc. Acid Res. 1 2 , 8 4 0 7 - 8 4 1 4 . 8. B r a c k , C , H i r a m a , M., L e n h a r d - S c h u l l e r , R. and Tonegawa, S. (1978) C e l l , 1 5 , 1-14. 9. B e r n a r d , 0 . , Hozumi, N. and Tonegawa, S. (1978) C e l l 1 5 , 1 1 3 3 - 1 1 4 4 . 10. Tonegawa, S., Max am, A.M., T i z a r d , R., B e r n a r d , 0. and G i l b e r t , W. (1978) P r o c . N a t l . Acad. S c i . (U.S.A.) 7 5 , 1 4 8 5 - 1 4 8 9 . 11. S c o t t , C.L. and P o t t e r , M. (1984) J . Immunol. 1 3 2 , 3 8 8 3 - 2 6 4 3 . 12. A v i v , H. and L e d e r , P. (1972) P r o c . N a t l . Acad. S c i . (U.S.A.) 6 9 , 1 4 0 8 1412. 13. B u e l l , G.N., W i c k e n s , M.P., P a y v a r , F. and S c h i m k e , R.T. (1978) J . B i o l . Chem. 2 5 3 , 2471-2482. 2940 Nucleic Acids Research 14. Wickens, M.P., Buell, G.N. and Schirake, R.T. (1978) J. Biol. Chem. 253, 2483-2195. 15. Gergen, J.P., Stern, R.H. and Wensink, P.C. (1979) Nucl. Acid. Res. 7, 2115-2136. 16. Sanger, F., Nicklen, S. and Coulson, A.R. (1978) Proc. Natl. Acad. Sci. (U.S.A.) 74, 5463-5467. 17. Sanger, F. and Coulson, A.R. (1978) FEBS Letts, 87, 107-110. 18. Gross-Bellard, M., Oudet, P. and Chambon, P. (1973). Eur. J. Biochem. 36, 32-38. 19. Epstein, M.A., Barr, Y.M. and Achong, B.G. (1966) Brit. J. Cancer 20, 475-479. 20. Mclntosh, R.V., Cohen, B.B., Steel, CM., Read, H., Moxley, M. and Evans, H.J. (1983) Int. J. Cancer, 3 1 . 275-279. 21. Wu, T.T. and KaDat, E.A. (1970) J. Exp. Med. 132, 211-250. 22 Kabat, E.A., Wu, T.T., Bilofsky, H., Reid-Miller, M. and Perry, H. (1983) Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services. N14. 23. Dayhoff, M.O. (1972) Atlas of Protein Sequence and Structure 5, D229D233. 24. Hollis, G.F., Hieter, P.A., McBride, O.W., Swan, D. and Leder, P. (1982) Nature 296, 321-325. 25. Gustav-Klobeck, Corabriato, G. and Zachau, H.G. (1984) Nucl. Acid. Res. 12, 6995-7006. 26. Lenoir, G.M., Preud'homrae, J.L., Bernheim, A. and Berger, R. Nature, 298, 474-476. 27. Korsraeyer, S.J., Hieter, P.A., Ravetch, J.V., Poplack, D.G., Leder, P. and Waldmann, T.A. (1981) Leukaemia Markers (Academic Press), 85-97. 28. Rowley, J. (1982) Science 216, 749-751. 29. Goyns, M.H., Young, B.D., Guerts van Kessel, A., deKlein, A., Grosveld, G., Bartram, C.R. and Bootsma, D. (1984) Leukaemia Res. 8, 547-553. 30. Minowada, J., Tsubota, T.f Greaves, M.F. and Walters, T.R. (1977) J. Nati. Cancer. Inst. 59,83-88. 31. Sletten, K., Husby, G. and Natvig, J.B. (1974) Scand. J. Immunol. 3, 833-836. 32. Skinner, M., Benson, M.D. and Cohen, A.S. (1975) J. Immunol. 114, 14331435. 33. Solomon, A., Frangione, B. and Franklin, E.C. (1982) J. Clin. Invest. 70, 453-460. 2941