Download the genome of herpes simplex virus: structure, replication and

J . Cell Sci. Suppl. 7, 6 7 -9 4 (1987)
P rin ted in G reat B ritain © The Company o f Biologists L im ited 1987
67
T H E GE NOM E OF HERPES SIMPLEX VIRUS:
STRUCTURE, REPLICATION AND EVOLUTION
D U N C A N J. M c G E O C H
M RC Virology Unit, Institute of Virology, University o f Glasgow, Church Street,
Glasgow G il 5JR, Scotland
SUMMARY
The objectives of this paper are to discuss the structure and genetic content of the genome of
herpes simplex virus type 1 (HSV-1), the nature of virus D N A replicative processes, and aspects of
the evolution of the virus D N A , in particular those bearing on D N A replication. We are in the late
stages of determining the complete sequence of the D N A of HSV-1, which contains about 155 000
base pairs, and thus the treatment is primarily from a viewpoint of D N A sequence and
organization.
The genome possesses around 75 genes, generally densely arranged and without long range
ordering. Introns are present in only a few genes. Protein coding sequences have been predicted,
and the functions of the proteins are being pursued by various means, including use of existing
genetic and biochemical data, computer based analyses, expression of isolated genes and use of
oligopeptide antisera. Many proteins are known to be virion structural components, or to have
regulatory roles, or to function in synthesis of virus D N A. Many, however, still lack an assigned
function.
Two classes of genetic entities necessary for virus D N A replication have been characterized: cisacting sequences, which include origins of replication and packaging signals, and genes encoding
proteins involved in replication. Aside from enzymes of nucleotide metabolism, the latter include
D N A polymerase, D N A binding proteins, and five species detected by genetic assays, but of
presently unknown functions.
Complete genome sequences are now known for the related alphaherpesvirus variceila-zoster
virus and for the very distinct gammaherpesvirus Epstein-Barr virus. Comparisons between the
three sequences show various homologies, and also several types of divergence and rearrangement,
and so allow models to be proposed for possible events in the evolution of present day herpesvirus
genomes. Another aspect of genome evolution is seen in the wide range of overall base compositions
found in present day herpesvirus DNAs. Finally, certain herpesvirus genes are homologous to non­
herpesvirus genes, giving a glimpse of more remote relationships.
INTRODUCTION
The genome of herpes simplex virus (HSV) is a D N A molecule of some 155 000
base pairs. By the standards of virology this is a large and complex genetic object. My
colleagues and I, working in the M R C Virology Unit in Glasgow, have undertaken
determination of the whole D N A sequence of HSV type 1 (HSV-1), and we are now
in the late stages of this task. The primary objective of this work, having obtained the
sequence, is to interpret it as fully as possible in terms of genes, transcripts, encoded
proteins, and other functional entities. In addition, other topics are of increasing
interest, as it has become possible to use sequence data in examining relations
between H SV and other herpesviruses, in comparing genes of herpesviruses with
68
L). J. McGeoch
other, non-herpesvirus genes, and in defining more clearly phenomena of herpes­
virus D N A evolution. From this description it can be seen that my interest in the
processes of H SV D N A replication is secondary to my involvement with the
structure and properties of the object to be replicated, the virus genome. Accord­
ingly, this paper sets out to describe our current understanding of the H SV genome,
and of its replication, and to explore implications which analyses of genome sequence
may have for the mechanisms of replication.
H SV is a member of the family Herpesviridae, a large group of viruses responsible
for a variety of diseases of man and animals (Matthews, 1982). All have large,
icosahedral, enveloped virions, whose genomes are linear, double-stranded D N A of
M t in the range 80X106 to 150X106. The group is very diverse in many aspects of
pathology and biology, although one unifying feature is the ability to enter into long­
term, latent infections (Roizman, 1982). Three sub-families have been defined,
based primarily on biological characteristics; these are termed the Alpha-, Beta- and
Gamma-herpesvirinae. The genomes of the herpesviruses vary widely, in their size
and base composition and in the arrangement of large, repeated sequences (reviewed
by Honess, 1984). There are, however, no simple correlations between genome
characteristics and biological properties. Five herpesviruses are recognized as natural
pathogens of Homo sapiens : the two serotypes of H SV (HSV-1 and HSV-2),
varicella-zoster virus (VZV), human cytomegalovirus (H CM V ) and Epstein-Barr
virus (EBV). The first three of these belong to the Alphaherpesvirinae, H C M V is
assigned to the Betaherpesvirinae, and EBV to the Gammaherpesvirinae. Although
this paper is primarily concerned with HSV-1, comparative analyses of aspects of
HSV-2, VZV and EBV are also employed. Complete genome sequences have now
been published for EBV (Baer et al. 1984) and for VZV (Davison & Scott, 1986).
S T R U C T U R E A N D O R G A N I Z A T I O N OF T H E H S V G E N O M E
A rrangem ent o f sequence elements in H S V D N A
HSV-1 virion D N A is a linear molecule containing about 155 000 base pairs (Kieff
et al. 1971). As shown in Fig. 1, the D N A is viewed as consisting of two covalently
joined segments, termed Long (L) and Short (S). Each segment contains an unique
sequence flanked by a pair of repeat sequences in opposing orientation. Thus, we
have the long and short unique sequences ( U l and U s), of 110000 and 13 000 base
pairs respectively, the terminal and internal long repeats (T R L and I R l ) , each of
9200 base pairs, and the terminal and internal short repeats (TRg and IR s), each of
6600 base pairs. The sequences of R l and R§ are distinct. In addition, the D N A
possesses a direct, terminal repeat of 400 base pairs; for historical reasons this is
termed the a sequence. There is a further copy of the a sequence internally, in
inverted orientation, at the ‘joint’ between the L and S segments. In some molecules
in a virion D N A preparation, the L terminus and the joint may possess multiple
copies of the a sequence (Wagner & Summers, 1978).
Preparations of H SV virion D N A contain equivalent amounts of four sequenceorientation isomers, which differ in the relative orientations of the two unique
69
The genome of herpes simplex virus
sequences about the joint, as indicated in Fig. 1. These isomers are apparently
functionally equivalent (Davison & Wilkie, 19836; Longnecker & Roizman, 1986).
By convention, one arbitrarily chosen isomer is regarded as the prototype, and this is
used for most purposes in maps of restriction sites and gene organization.
Early sequence analysis of HSV D N A revealed another phenomenon of sequence
repeats, on a finer scale: families of multiple copies of short, directly repeated
sequences were discovered, first in several locations in Rs (Davison & Wilkie, 1981).
Each family had a distinct sequence, although there were marked generic similarities
(high content of G and C, high occurrence of homopolymer runs, marked strand
asymmetry of purine versus pyrimidine content). The copy numbers of several
families were found to vary among individual plaque isolates or molecular clones of
restriction nuclease fragments. Sets of small repeat sequences have now been
observed in Us, Rs and R l , with unit lengths ranging up to 54 residues (McGeoch et
al. 1985; Rixon et al. 1984; Perry, 1986).
O rganization o f H S V genes
Our best current estimate is that there are about 75 genes in the genome of HSV.
In general these are densely arranged, and various forms of gene overlap have been
observed (see for instance: Rixon & McGeoch, 1984; McGeoch et al. 1985; Wagner,
1985). Genes are found in both orientations. Each gene has its own promoter. Thus,
there is no discernible long range order in gene layout (in contrast, for instance, to
0
40
1
80
i
i
120
i
L
<
a
155 kbp
t
S
a'
□
----------------------------- ----- 1— n —
TR l
Ul
P
----------------------------------- >
Is
—
II
<■
->
a
□
IR l IR s U s TR s
I ls
Fig. 1. Organization of HSV-1 genomic D N A. HSV-1 D N A is regarded as comprising
two covalently joined segments, L and S. Each of these consists of an unique sequence
(U l and Ug, drawn as solid lines) flanked by a pair of inverted repeat sequences (T R L
and I R l , IRs and T R S, drawn as open boxes). The D N A also possesses a 400 base pair
directly repeated sequence at each terminus, termed the a sequence. A copy of the a
sequence in inverted orientation is present at the ‘joint’ between L and S. A population of
HSV D N A contains four equimolar sequence orientation isomers differing in the relative
orientations of the L and S segments, as indicated in the lower part of the diagram. These
are designated P (an arbitrary prototype), Is (inverted S), I I (inverted L) and Ils (both
inverted). See Sheldrick & Berthelot (1974); Roizman (1979).
70
D. J. McGeoch
the case of adenovirus, where many genes are expressed using only a few promoters,
but with complex processing of transcripts). A common feature of transcriptional
organization in H SV is the occurrence of 3'-coterminal families of transcripts. In this
arrangement, several adjacent genes are similarly aligned. For each gene, transcrip­
tion starts 5' to that gene’s coding sequence, but continues through the following
genes of the family until a common, distal polyadenylation site is reached. In each
transcript species, only the 5'-proximal coding region is translated (Rixon &
McGeoch, 1984, 1985). As far as can be judged from our present level of analysis,
introns are an uncommon, but not wholly absent, feature of HSV genes (Rixon &
Clements, 1982; Murchie & McGeoch, 1982; Costa et al. 1985; Perry et al. 1986).
R E P L I C A T I O N OF HSV D N A
O utline o f H S V D N A replicative processes
O ur present knowledge of the mechanistic details of H SV D N A replication is quite
limited. In the newly infected cell, incoming virus D N A accumulates in the nucleus.
It is likely that it is quickly converted into a circular form, perhaps by direct ligation
(Davison & Wilkie, 1983«; Poffenberger & Roizman, 1985). Expression of the virus
genes occurs in several stages. The first genes to be transcribed and translated are the
five ‘immediate-early’ (IE) genes (Honess & Roizman, 1974; Watson et al. 1979;
Wagner, 1985). The major recognized function of these is the activation of later
classes of genes, and there is now direct evidence for three of the IE proteins that they
can act as transcriptional activators (Everett, 1984; Gelman & Silverstein, 1986;
O ’Hare & Hayward, 1985; Everett, 1986). A large class of ‘early’ genes is then
expressed. These include many whose products are involved in aspects of H SV D N A
replication, and virus D N A synthesis then ensues. The final classes of H SV genes are
expressed after the onset of D N A replication.
The nature of the replicative forms of H SV D N A is obscure, although electron
microscopic studies have produced some evidence, showing proposed replicative
forks and bubbles (Friedmann et al. 1977). The size and fragility of the virus D N A
present such analyses with severe problems: one paper described replicating
herpesvirus D N A as occurring in ‘large, tangled masses’ (Ben-Porat & Rixon, 1979).
It is known that newly replicated D N A does not possess detectable termini, so that it
is probably circular or in head-to-tail concatemers (Jacob et al. 1979; Jongeneel &
Bachenheimer, 1981). It is not at all clear whether D N A replication first undergoes a
template amplification stage (as circular monomers) before synthesis of D N A for
packaging into progeny virus. Late in infection, replicated D N A is in a very rapidly
sedimentable form, thought to be extensive concatemers (Jacob et al. 1979). It thus
appears likely that replication, at least at this stage, is by a rolling circle mechanism.
Concatemeric D N A is further processed in the cell nucleus by packaging into nascent,
nucleocapsids, and by scission into genome unit lengths (Vlazny et al. 1982). At
present, the order of the packaging and cutting steps is not clearly resolved.
There are in the H SV genome two classes of genetic entity directly concerned with
genome replication, namely m-acting sequences (involved in initiation of synthesis
The genome of herpes simplex virus
71
and in packaging), and genes encoding proteins active in some aspect of D N A
synthesis. In the following sections we outline what is presently known of these
elements.
cis-acting signals fo r D N A replication a n d processing
There was some early evidence, from electron microscopic analyses of H SV D N A
extracted from infected cells, that the virus genome might possess one or more
specific sites at which replicative synthesis of D N A started (Friedmann et al. 1977).
However, study of the existence and location of such origins of replication really only
became productive after analyses of the nature of defective HSV D N A species. As
with many other virus types, defective species are obtained when HSV is repeatedly
passaged at high multiplicity. The H SV defective DNAs were found to consist of
tandem repeats of sequences derived from the standard genome, and were divided
into two classes on the basis of the sequences present. Both classes contained
sequences from the terminus of T R S. Class I molecules contained in addition further
sequences from the S segment, while class I I molecules contained sequences from
near the centre of U l (Kaerner et al. 1979; Vlazny & Frenkel, 1981; Spaete &
Frenkel, 1982). It was also shown that when monomer units from either class of
defective were introduced into cells in the presence of wild-type virus, these could
serve as ‘seeds’ for regeneration of tandemly repeated defective DN As (Vlazny &
Frenkel, 1981; Spaete & Frenkel, 1982). The ability of such defective molecules to be
replicated and packaged, with the help of wild-type virus, was taken as indicating
that they carried regions of the genome providing necessary cis -acting signals for
D N A synthesis and processing.
With this background, a system was introduced for detailed analysis of m-acting
sequences needed for replication (Stow, 1982). This consisted of introducing into
culture cells a circular plasmid carrying the sequences under test, and using H SV (or
H SV D N A ) to provide genes expressing proteins needed for replication. When the
test plasmid contained sequences necessary for its own replication, then amplifi­
cation of the non-HSV sequences in the plasmid could be detected by hybridization
of extracted D N A with labelled parental vector D N A . Thus, the plasmid assumes
the role of an H SV defective D N A , but with the advantage of being amenable to
genetic manipulation. With this system, a small part of the R s region was identified
as enabling replication of covalently linked sequences, as head-to-tail concatemers,
and was termed ‘on's’, for ‘short region origin of replication’ (Stow & McMonagle,
1983). M uch further work on the properties of oris has now been performed, and in
addition a similar element (onL) has been detected in U L. The properties of these
sequences are thoroughly consistent with their being structures where synthesis of a
new D N A strand is initiated, but it should be pointed out that formal proof for this
has yet to be obtained.
A nalysis o f oris
Stow & McMonagle (1983) carried out a systematic deletion analysis to localize
orz's activity to a region of 90 base pairs in the Rs sequences of HSV-1, as shown in
I---- 1
100 bp
B
« « < < « « <<<<<<<<<<<>>>>> »> >>>>>>>>>>>>>
GGCCGCCGGGTAAAAGAAGTGAGAACGCGAAGCGTTCGCACTTCGTCCCAATATATATATATTATTAGGGCGAAGTGCGAGCACTGGCGC
t t tt l tl ti tl tl tt tl t
c
HSV-1
GGCCGCCGGGTAAAAGAAGTGAGAACGCGAAGCGTTCGCACTTCGTCCC AATATATATATATTATTAGGGCGAAGTGCGAGCACTGGCGC
**
* * * * * *
***********
* * ************
**
*
VZV
GGGTTTTCATGTTTTGGCATGTG'ICCAACCACCGTTCGCACTTTCTTTCTATATATATATATATATATATATATATATATATAGAGAAAG
Fig. 2. Organization of HSV-1 oris. (A) The location of theon'g copy in IRs is indicated,
together with parts of IE genes 3 and 4. The features numbered are: (1) S' terminus of
leftward transcribed IE gene 3 m RN A ; (2) location of IE gene3 promoter; (3) location of
IE gene 3 upstream control region; (4) location of IE gene 4 upstream control region (illdefined at right); (5) minimum oris region; (6) location of IE gene 4 promoter; (7) 5'
terminus of IE gene 4 mRNA and location of intron; and (8) location of IR g/U s
junction. Redrawn from Preston et al. (1984). (B) The minimal oris sequence is shown,
as the rightward S' to 3' strand only, of the IRg copy (Stow & McMonagle, 1983).
Residues in the left and right arms of the imperfect palindrome are marked “< ’ and “> ’,
respectively. The central A + T rich region is overlined, and the sequence protected from
DNase by the ori specific binding protein is marked ‘ : : : ’. (C) The minimal HSV-1 oris,
as in (B), is compared with the VZV ori sequence (Stow & Davison, 1986) to illustrate
conserved features discussed in the text. Positions of pairs of identical residues are
marked
Fig. 2. There are thus two copies of orig, one in IR S and one in TRg, but these are
not distinguished in further description in this paper. Ori§ lies in an intergenic region
between two divergently transcribed IE genes, and is surrounded by the promoters
and the far-upstream regulatory elements of these genes. As illustrated in Fig. 2, the
orig sequence contains an imperfect palindrome, with each arm consisting of 21
residues. Essential functional sequences are known to lie outside the palindrome
(Stow & McMonagle, 1983). At the centre of the palindrome there is a sequence
(A-T)f,, which is essential for ori function (Stow, 1985).
Two examples from other viruses of sequences corresponding to HSV-1 on's are
now available. First, Whitton & Clements (1984) have shown that in Rs of HSV-2,
strain HG52, there are sequences closely similar to HSV-1 ons . The HSV-2
organization differs in that there are two copies of the ori$ sequences, contained
within almost identical direct repeats of 137 base pairs. Next, Stow & Davison (1986)
have recently identified a functional ori sequence in the Rs regions of the distantly
related alphaherpesvirus VZV. They demonstrated that in a plasmid amplification
assay VZV oris could be activated by HSV-1 replication factors. For comparative
The genome of herpes simplex virus
73
purposes, the VZV example is of particular interest, since in general HSV and VZV
D N A sequences are widely diverged. Like HSV, the VZV oris contains a
palindromic sequence with an (A-T)„ tract at its centre (Fig. 2). The palindromic
sequences flanking this central part are not conserved. However, there is a stretch of
11 residues identical in HSV-1 and VZV, which in HSV-1 lies across the boundary of
the palindrome and in VZV is just outside the palindrome.
Very recently, Elias et al. (1986) have shown that in nuclei from HSV-1 infected
cells there exists a protein which binds specifically to oris D N A . This binding
protects from DNase digestion an 18 base pair region across one end of the
palindrome (Fig. 2). Interestingly, this binding site includes the 11 base pair
sequence conserved between HSV-1 and VZV.
A nalysis o f ori/.
The analysis of what is now called oh’l of H SV might have been expected to
proceed systematically from the knowledge of class II defective D N A structure, as
for oris. However, an unexpected obstacle has greatly retarded the progress of this
analysis in the past several years. This was the discovery that D N A containing
functional o n L could not be cloned intact into standard bacterial vector systems.
Recombinant clones could indeed be obtained, but these invariably exhibited a
deletion of about 100 base pairs, and were not primarily active in plasmid
amplification assays (Spaete & Frenkel, 1982). When amplification was observed, it
turned out that the deleted region had been restored, presumably through
recombination with D N A of wild-type helper virus. Fine localization of oh'l
functional limits by plasmid manipulation, and also convenient sequence analysis,
were thus frustrated.
The first ori l sequence to be determined was for a class I I defective D N A of
HSV-1 strain Angelotti, where the tandem repeat units of the defective served as the
source of suitable D N A for sequence analysis (Gray & Kaerner, 1984). It turned out
that this sequence contained 296 base pairs which became deleted on plasmid
cloning, and that within the deleting region were two long palindromic sequences. It
has since been recognized that this structure is not the simplest form of sequence
associated with onL, so further description of it is postponed until later in this
section. In 1985, sequences were reported for wild-type HSV-1 D N A in the region of
on L , using non-cloned virus D N A fragments as sequencing substrates (Weller et al.
1985; Q uinn & MeGeoch, 1985). In addition, molecular cloning of the region in an
undeleted form was reported using a yeast plasmid (Weller et al. 1985).
The oh’l sequences of HSV-1 lie between the divergently transcribed genes for the
major D N A binding protein and the D N A polymerase, as shown in Fig. 3. It was
found that the deleting region contained a long perfect palindrome, with arms each of
72 residues, and that this palindromic sequence showed striking similarity to the oris
sequence (Fig. 3). Evidently, this long inverted repeat was the cause of the cloning
instability. Recently, it has been shown that ori^ activity can be obtained with
sequences representing almost the complete palindromic region but lacking any
adjacent non-palindromic sequences (S. K. Weller, personal communication).
74
D. J. McGeoch
As indicated in Fig. 3, the oriL region contains symmetry elements additional to
the 72 residue inverted repeat, in that each arm of the repeat contains short sequences
which together form an ‘inner’ interrupted inverted repeat. As with oris, the onL
region contains an A + T-rich region at the centre of the palindrome. Alignment of
the two oii sequences shows that the whole ons palindrome is closely similar to the
central portion of the onL palindrome (Fig. 3). The sequence similarity extends
beyond the on’s palindrome on one side only. This non-palindromic part of the on’s
dbp
OH
pal
100bp
<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
GCGCGTCATCAGCCGGTGGGCGTGGCCGCTATTATAAAAAAAGTGAGAACGCGAAGCGTTCGCACTTTGTCCTAATAATATA
1
2
3
3
*
2
'
1*
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
TATATTATTAGGACAAAGTGCGAACGCTTCGCGTTCTCACTTTTTTTATAATAGCGGCCACGCCCACCGGCTACGTCACTCT
1
2
3
3
'
2
'
1*
<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<<
O r iL GCGCGTCATCAGCCGGTGGGCGTGGCCGCTATTATAAAAAAAGTGAGAACGCGAAGCGTTCGCACTTTGTCCTAATAATATA
**• * •
O ris
*
•
* ***** ******
***** *************************** **** *** *****
GCGGGACCGCCCCAAGGGGGCGGGGCCGCCGGG . TAAAAGAAGTGAGAACGCGAAGCGTTCGCACTTCGTCCCAAT. ATATA
<<<<<<<<<< <<<<<< <<<<<
<-----------------------------------------sss s ss s: ) si : t : t : : :
>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>
O riL TATATTATTAGGACAAAGTGCGAACGCTTCGCGTTCTCACTTTTTTTATAATAGCGGCCACGCCCACCGGCTACGTCACTCT
O ris
* * * * * * * * * * * * * * * * * * * * * * **
* *
*
*
* * * * * *
TATATTATTAGGGCGAAGTGCGAGCACTGGCGCCGTGCCCGACTCCGCGCCGGCCCCGGGGGCGGGCCCGGGCGGCGGGGGG
>>>>> >» >>>>>>>>>>>>>
Fig. 3. Organization of HSV-1 onL. (A) The location of theoniypalindrome between the
divergent dbp and pol genes is shown, with 5' regions of transcripts marked (Quinn &
McGeoch, 1985; Gibbs et al. 1985). (B) The sequence of the ori\. region is shown, as the
rightward 5' to 3' strand only. The palindrome is marked with ' < ’ and *>’ as for Fig. 2.
Within each arm of the palindrome, three regions, 1, 2 and 3, of interrupted, inverted
repetition are indicated (Weller et al. 1985). (C) The sequences of the oii\, and oris
regions are compared. Two padding characters have been inserted in the oris sequence to
optimize alignment. Positions with identical residues are marked V . Palindromic regions
are indicated as before. The mapped limits of on’s are marked ‘< --------- > ’ (Stow &
McMonagle, 1983), and the on protein site binding is marked
-
The genome of herpes simplex virus
75
sequence is within the mapped functional limits of oris (Stow & McMonagle, 1983),
and it contains part of the oric, protein binding site (Elias et al. 1986).
The o n L sequence in HSV-1 Angelotti class I I defective D N A , described above, is
another example of a ‘double’ origin, consisting of two closely spaced palindromic
sequences (Gray & Kaerner, 1984), and the larger of these is identical to that
described above for HSV-1 strains K O S and 17. The other palindrome is a slightly
shorter version, with 65 residue arms. There is no direct characterization available
for oh'l of wild-type strain Angelotti. However, from size differences in restriction
digests of HSV-1 strain Angelotti, as compared to other HSV-1 strains, it seems
probable that the double origin is present also in non-defective strain Angelotti D N A
(Gray & Kaerner, 1984). Recently, Lockshon & Galloway (1986) examined oh’l in
HSV-2. Here a palindrome, almost perfect, of total length 136 residues is present,
with high sequence homology to the HSV-1 palindrome. In contrast, VZV does not
possess any sequence counterpart of HSV oh'l in the equivalent genome location
(Stow & Davison, 1986).
M echanism s o f ori action
At present we can discern four common elements of alphaherpesvirus ori structure
and surroundings: (1) a palindromic sequence; (2) a repeating (A-T) sequence; (3) a
region conserved between H SV and VZV, which is part of the site for binding an ori
specific protein; and (4) an intergenic location, close to transcriptional regulatory
regions of divergently transcribed genes. Palindromic sequences have been found in
other replication origins, for instance in SV40 (Bergsma et al. 1982). In that
example, however, there is no A + T-rich region at the centre of the palindrome, but
an A + T-rich region is located adjacent to the palindrome. SV40 also provides
another example of an origin located between two divergent genes. The perceived
significance of the locations of the HSV ori sequences certainly is enhanced by the
importance of the genes concerned: in the case of o n s these are IE genes, one of
which encodes a vital transcriptional activator, and in the case of o h l the genes
encode prominent functional components of the D N A replication machinery. The
arrangement may suggest a functional link between ori activity and transcriptional
activity. Until establishment of a cell-free replication system for H SV and biochemi­
cal analysis of events in initiation of new D N A synthesis, definite roles for the ori
elements cannot be assigned. For the moment, it is reasonable to suppose that the
binding of the ori specific protein at the H S V /V Z V conserved locus may represent an
early stage in ori recognition and provide a site for assembly of the replicative
complex, while the (A-T)„ region would comprise a site for facile strand separation
prior to initiation of a new D N A strand.
It is quite unclear as to why HSV should possess both ons (in two copies) andon^.
The essential structural difference between them is that the on'L palindrome is
longer. It presumably thus includes two specific protein binding sites. A consequent
attractive possibility is that replication from on'L might be bidirectional, and that
from ong unidirectional. Thus, o n L might be active in early, template-amplification
replication of circular monomeric D N A , while on's might act in later rolling-circle
76
D. J. McGeoch
CD-
dri
b'
><
uh
DR2
Uc
DR1
- X -- —
I---------- 1
100bp
Fig. 4. Organization of the HSV-1 a sequence. Sequence elements in the copy of the a
sequence at the L /S joint (a') are outlined for HSV-1 strain 17 (Davison & Wilkie, 1981)
using the nomenclature of Mocarski & Roizman (1982). ‘D R 1’ is a 17 base pair sequence
present in two copies in the same orientation. The limits of the a sequence, as defined by
positions of the two termini in virion D N A , lie asymmetrically within the DR1 elements.
Ub is a locally non-repeated sequence, adjacent to the non-a-sequence part of IRi, (the b'
sequence), and U c is a locally non-repeated sequence adjacent to the non-a-sequence part
of I R S (the c' sequence). DR2 is a family of directly repeated 12 base pair sequences.
replication to generate genomes for packaging in progeny virions. These are
speculative and unsupported notions, and they are rather vitiated by the apparent
lack of an ohl equivalent in VZV. There are also other obscure questions concerning
HSV replication origins: (1) is there any significance to the ‘doubling’ of an origin
seen in two cases? (2) what are the evolutionary relations between the highly similar
on's and oh’l sequences?
The a sequence
In early experiments on replication of plasmids carrying oris (Stow, 1982), the
amplified plasmid sequences were not encapsidated. However, Stow et al. (1983)
showed that when the test plasmid also contained a copy of the a sequence, then
processing and encapsidation of progeny plasmid DNA did occur. The sequence
organization of the HSV-1 a sequence is shown in Fig. 4, in the form in which it
occurs at the L/S joint. The a sequence is flanked by a pair of direct repeats of 17
base pairs (‘D R1’). In the genome terminal a sequences, the termini lie within these
repeats. Within the a sequence is a set of tandem reiterations (‘DR2’). Variations in
the sequences and copy number of these reiterations are found in different HSV-1
strains. The events which take place at the a sequence during encapsidation and
cleavage of nascent virion DNA are by no means well resolved. Varmuza & Smiley
(1985) have shown that cleavage can still take place at a partial a sequence, lacking
the Rl proximal copy of DR1 and part of U b (see Fig. 4), but not at smaller a
The genome of herpes simplex virus
77
sequence fragments. However, no finer definition of recognition sites has yet been
reported. It seems to be the case that a precursor D N A with one a sequence at a given
locus can be cleaved and processed in such a manner that both resulting ends now
possess a copy of the a sequence. Yarmuza & Smiley (1985) presented evidence that
generation of termini involved two distinct cleavages, at each DR1 sequence, and
suggested that the doubling of the a sequence was effected as part of the same
process. In a study of sequences needed for genome isomerization, Chou & Roizman
(1985) ascribed to the D R 2 repeat array a role in high frequency, site specific
recombination. A difficulty with this is that the HSV-2 a sequence does not possess a
D R 2 repeat set (Davison & Wilkie, 1981).
H SV -encoded enzym es o f nucleotide metabolism
The H S Y genome encodes a number of proteins which are involved in virus D N A
synthesis. These include proteins which participate directly in D N A replication, and
also enzymes of nucleotide metabolism. The latter are treated first.
There are two HSV-specified enzymes which catalyse reactions in the biosynthesis
of D N A precursors: thymidine kinase (TK) and ribonucleotide reductase (R R ). T K
was first described by K it & Dubbs (1963) and has been widely studied since.
Genetic analyses have demonstrated that T K is not essential for virus growth in
tissue culture (Jamieson et al. 1974). However, the experimental pathogenicity of
T K deficient mutants is reduced, probably because T K assumes more importance in
the supply of T T P for D N A synthesis in non-dividing cells (Field & Wildy, 1978).
T K is important in the action of nucleoside analogues which inhibit H SV infection
(see Rapp & Wigdahl, 1983). In the infected cell the active form of such compounds
is the 5'-triphosphate equivalent, and the first step in this activation is catalysed by
TK.
The other HSV-encoded enzyme of nucleotide synthesis is ribonucleotide
reductase, which catalyses the reduction of nucleoside diphosphates to deoxynucleoside diphosphates (Cohen, 1972; Dutia, 1983). The enzyme is composed of two
subunits, which are encoded by separate but contiguous genes (Preston, Palfreyman
& Dutia, 1984; Bacchetti et al. 1984; Frame eZ,al. 1985; McLauchlan & Clements,
1983). R R from other sources, both prokaryotic and eukaryotic, also consists of two
subunits, and indeed the HSV enzyme shows amino acid homology to these other
enzymes (Caras et al. 1985; Standart et al. 1985). The HSV R R differs from its
counterpart in normal, mammalian cells in that it is resistant to feedback inhibition
by T T P (Cohen, 1972). Unlike T K , R R is essential for virus growth in tissue
culture, presumably because it occupies a more central position in metabolic routes
for the supply of D N A precursors (Preston et al. 1984).
H SV also encodes a deoxyuridine triphosphatase (Wohlrab & Francke, 1980;
Preston & Fisher, 1984), which is more probably of significance in minimizing
incorporation of uracil into nascent D N A than in providing dU M P for T TP
synthesis. It is not essential for growth in culture cells (Fisher & Preston, 1986). It
was recently found, by way of D N A sequence studies, that a thymidylate synthase is
encoded by VZV and also by the gammaherpesvirus, herpesvirus saimiri (HVS)
78
D. J. McGeoch
(Davison & Scott, 1986; Honess et al. 1986). This enzyme catalyses methylation of
dU M P to T M P, but H SV has no corresponding gene.
Proteins active in D N A replication
Apart from the enzymes of nucleotide metabolism just described, a number of
proteins encoded by H SV or found in HSV infected cells have been implicated in
processes of virus D N A replication. The quantity and quality of knowledge
regarding these spans a wide range. Best characterized is the D N A polymerase,
where the protein has been purified, the enzymatic activities have been character­
ized, the gene is known and sequenced, and various mutated forms have been
obtained and studied. At the other end of the spectrum there are poorly characterized
entities; for instance, proteins for which circumstantial evidence, such as copurifi­
cation with a better known protein, suggests an involvement, but for which no
function is known or gene identified.
H SV D N A polymerase was first described by Keir & Gold (1963), and since then
the enzyme has been extensively studied. The protein has been purified as a single
polypeptide chain of M r 136000 (Powell & Purifoy, 1977; Knopf, 1979). This,
however, has been found associated with other species (see below). The polymerase
also exhibits a 3' to 5' exonuclease action, which is thought to have a proofreading
role (Knopf, 1979). As already mentioned, the polymerase gene (p o l ) lies adjacent to
o n L. Several types of mutant have been studied (ts , drug resistance and drug
hypersensitivity; see Coen et al. (1984), and Honess et al. (1984)). The ts mutants
fall into two complementation groups within the one gene (Purifoy & Powell, 1981).
From the use of pol mutants it is clear that the polymerase participates directly in
virus D N A replication. The H SV D N A polymerase plays a key role in the
mechanism of action of antiviral agents which mimic dNTPs or pyrophosphate, and
the pol gene is a site of mutation to resistance to such compounds (Hay & SubakSharpe, 1976; Chartrand et al. 1979; Crumpacker et al. 1980; Coen et al. 1982;
Honess et al. 1984).
After the polymerase, the best characterized protein involved in H SV D N A
replication is a species termed the major D N A binding protein (DBP) of M r 128 000,
the gene for which (dbp) lies on the other side of onL from pol. Ts mutants in dbp
have shown that the protein is essential for H SV D N A replication (Conley et al.
1981; Weller et al. 1983). Its precise role, however, is not clear at present. D B P is not
the same protein as the oris binding protein of Elias et al. (1986). In vitro, DBP has
been shown able to dissociate the strands of duplex D N A (Powell et al. 1981). It has
been suggested that it may act in a complex with D N A polymerase and H SV
exonuclease (Littler et al. 1983).
Like H SV D N A polymerase, H SV exonuclease was first detected by Keir & Gold
(1963), as an increased alkaline nuclease activity in infected cells. Subsequently, the
enzyme was purified and was shown to consist of a single polypeptide chain, with
both 5' and 3' exonuclease activity and also an endonuclease activity (Morrison &
Keir, 1968; Hoffmann & Cheng, 1978, 1979; Stfobel-Fidler & Francke, 1980;
Hoffmann, 1981). The relation of this enzyme to D N A replication remains obscure
The genome of herpes simplex virus
79
and contentious. Studies with ts mutants have come to differing conclusions
regarding requirement of exonuclease for virus D N A synthesis (Moss et al. 1979;
Francke & Garrett, 1982; Moss, 1986). It remains at least possible that this is a
catabolic enzyme, whose function is to degrade host D N A to fuel virus D N A
synthesis.
Biochemical experiments have suggested the involvement of several additional
proteins or enzyme activities in H SV D N A synthesis. Vaughan et al. (1985) have
reported copurification with D N A polymerase of a distinct H SV coded protein of
estimated M r 54 000. Topoisomerase activities have been reported, both copurifying
with D N A polymerase and in virions (Biswal et al. 1983; Muller et al. 1985). As
described above, a protein which binds specifically to part of oris, has been detected
(Elias et al. 1986). Another report has described an a sequence binding protein
(Dalziel & Marsden, 1984). All of these must be regarded as possible components of
the replicative machinery, but more work is needed to authenticate their involvement
and clarify their roles.
Genes required fo r H S V D N A replication
Studies on the genetics of H SV have assigned ts mutants to about 10 complemen­
tation groups which were considered defective in viral D N A synthesis at non­
permissive temperature (V. G . Preston, personal communication; S. K . Weller,
personal communication). The genes concerned fall into three distinct classes:
(1) genes encoding known proteins, which are involved directly in D N A synthesis;
(2) genes encoding known proteins, which are not thought to be involved in D N A
synthesis, but which influence D N A synthesis as part of a pleiotropic effect; and
(3) genes for proteins of unknown specific function, at least some of which may
participate directly in D N A replication. In the first we include genes for D N A
polymerase, DBP and R R . In the second are several of the IE genes. Until very
recently the membership of the third category has been somewhat ill-defined,
suffering from lack of detailed knowledge of gene organization in the large and
complex genome of this virus, from wide mapping limits for mutants, and from
undoubted background complications of secondary and double mutations. This
situation is now improving, and it seems likely that there are at least five separate
groups, distributed across U l , in our third class, representing unknown proteins
which might be involved in the processes of D N A replication (based on data of V. G.
Preston and of S. K. Weller).
Recently a novel approach has been developed and exploited by M. D . Challberg
to identify H SV genes involved in D N A synthesis (Challberg, 1986; also, personal
communication). It was previously well known that purified H SV D N A could be
introduced into culture cells, where the virus genes were then expressed. Thus, such
transfected D N A could provide in trans the functions to support amplification of an
ori s-containing plasmid introduced concurrently. Challberg found that a set of
plasmid clones representing between them most of the H SV genome, in large
fragments, could substitute efficiently for intact virus D N A in supplying replication
functions. Systematic subcloning, deletion analysis and inactivation by restriction
80
D. J. McGeoch
nuclease digestion then identified loci necessary for plasmid amplification. Compari­
son of these loci with our D N A sequence data has indicated clearly the genes
involved. Two classes of loci were found, those essential for plasmid amplification
and those which increased amplification but were not absolutely necessary. The
latter comprised IE genes and also genes for RR, and were thus satisfactorily
explicable. There were seven essential loci, as shown in Fig. 5. Predicted M r values
for the encoded proteins are given in Table 1. As expected, two of the loci represent
th epol and dbp genes. The other five correspond to genes for which no products have
yet been recognized. Each of these either coincides definitively with the position of a
tightly mapped DNA-negative complementation group, or lies within the mapping
limits of a less tightly mapped group (unpublished data of V. G . Preston and of S. K.
Weller). The exonuclease gene is not required.
The plasmid amplification assay is a test for initiation and elongation of D N A
synthesis, in a rolling circle mode. The work just described shows that there are
seven H SV genes which are essential for these functions, including pol and dbp.
There are several ways in which possible further H SV genes for proteins involved in
replication could have escaped detection by this assay. First, there may be proteins
whose function could be replaced by a host cell protein, at least in the plasmid assay.
For instance, a virus-specified ligase might fall in this category. Next, it is
conceivable that there might be H SV proteins involved in regulation of replicative
processes, which would not register. Lastly, there are certainly events in the
downstream processing of progeny D N A - packaging and cutting - which cannot be
assayable by the plasmid system. Much the same limitations would apply to the
assignment of ts mutants as ‘D N A negative’. However, the agreement between ts
mutant mapping and the results of the plasmid assay system is impressive, and
strongly suggests that the major genes involved primarily in D N A synthesis have
now been located.
' 0
0-2
•
I
0-4
I
0-6
0-8
I
CZD--------------- !------------------ L.
4 44
UL5
UL9
UL8
« ►
db p p o l
►
G C .2L
M
I
i
IZJ----O
►
63.2L
I
f
O riL
O ris
Fig. 5. Locations of genes required for HSV-1 D N A synthesis. The prototypic HSV-1
genome is shown, with scale in fractional map units, and the locations and orientations of
seven genes necessary for virus D N A synthesis are indicated, together with the positions
of onL and on's-
t
O ris
81
The genome of herpes simplex vim s
Table 1. HSV-1 genes required fo r D N A replication
HSV-1 gene
Protein
Mr
VZV
equivalent
genef
EBV
equivalent
genej
UL5
UL8
UL9
dbp
pol
‘G C .2L’
‘63.2L’
99000
80000
94000
128 000
136000
51000
115 000
55
52
51
29
28
16
6
BBLF4
?
?
BALF2
BALF5
j
BSLF1
*The HSV-1 genes identified from the functional assays of M. D. Challberg and from DN A
sequence analysis are listed, as in Fig. 5. ‘G C .2L’ and ‘63.2L’ are temporary, working names,
f Obtained by comparison with the sequence of Davison & Scott (1986).
I Obtained by comparison with the sequence of Baer et al. (1984). '?’ indicates that no EBV
reading frame showing sequence homology could be found.
There thus exist five proteins encoded by HSV-1 which are clearly implicated as
acting in virus D N A synthesis, but whose roles are at present undefined. In addition,
they have not yet been correlated with known protein species in virus infected cells.
This could well point to their being present only in small amounts. The molecular
weights for these species, as predicted from D N A sequence open reading frames, are
all relatively large, with predicted M r values of 51000, 80 000, 94000, 99000 and
115 000. The predicted amino acid sequences are without particularly extreme or
striking properties - in short, at this informal level of analysis, they look like typical
large, globular proteins. From comparisons with other systems, there is no shortage
of possible functions for these proteins. These could include on recognition and
binding, primer synthesis, primer degradation, unwinding of duplex D N A , main­
tenance of unwound D N A in an extended configuration, D N A phosphorylation and
joining, enhancement of polymerase processivity, and other positive regulatory
activities.
Progress in elucidating the biochemistry of HSV D N A replication ought now to be
substantially facilitated by the enumeration of genes involved, and by the determi­
nation of the D N A sequences and prediction of protein sequences.
ASPECTS OF H E R P E S V I R U S E V O L U T I O N
Comparative analyses o f herpesvirus genomes
This final section examines some aspects of herpesvirus evolution, with emphasis
on topics related to the nature and functioning of the components of the D N A
replicative machinery of the virus. In the last two or three years, the increasing
availability of herpesvirus D N A sequences has greatly enhanced our views of
relationships between herpesvirus DNAs, and of evolution of herpesvirus DNAs,
and this will certainly continue with accumulation of more sequences. Prior to large
scale D N A sequencing, it was clear that many alphaherpesviruses did indeed share a
common ancestry, as evidenced by antigenic cross-reaction between their proteins,
82
D. J. McGeoch
and by hybridization, at some level, between genome sequences (for instance,
Davison & Wilkie, 1983c). There was, however, no comparable evidence for
relations between sub-families. Assignment to the Herpesviridae had been generally
made on the basis of virion morphology, aspects of the biology and gross
characteristics of the virus genome, so that there was in fact no critical, direct
evidence of genomic relatedness at the time of such classification decisions.
Comparisons based on the genome sequences have now provided such evidence of a
common ancestry, in part, for the genomes of alphaherpesviruses (HSV and VZV)
on the one hand, and gammaherpesviruses (as exemplified by EBV) on the other.
They have also illuminated the relations between gene organization in HSV and
VZV, where the viruses, although detectably related by previous methods, were
nonetheless substantially diverged, for instance in gross genome structure and also in
genomic base composition (Davison & McGeoch, 1986).
The genome sequences of these viruses often show little or no meaningful D N A
homology, and comparison of amino acid sequences predicted from the D N A
sequence, using computer methods, has emerged as the appropriate method of
analysis. This has proved useful at several levels. First, it has been used to assign
gene functions by comparison of sequences from a genome poorly studied genetically
with sequences from a genetically better characterized genome. In this way,
homologues in EBV have been detected to H SV genes encoding glycoproteins B and
H, D N A polymerase, ribonucleotide reductase, exonuclease and major D N A
binding protein among others (Pellett et al. 1985; McGeoch & Davison, 19866;
Q uinn & McGeoch, 1985; Gibson et al. 1984; McGeoch et al. 19866). Similar, but
more extensive, assignments have been made in VZV by comparison with H SV
sequences (Davison & McGeoch, 1986; Davison & Scott, 1986). The second aspect
of such comparisons concerns the detailed location of conserved residues in a pair of
predicted sequences. In cases where the genomes are extensively diverged, to the
point where little or no D N A homology may be detectable, it is reasonable to suppose
that highly conserved localities within a protein sequence may correspond to
important elements in the protein’s structure or function (see McGeoch et al. 1986a).
The comparisons should therefore be of value in detailed molecular genetic analysis
of the genes. Lastly, over large tracts of a pair of genomes, differences in the pattern
of gene homologies must reflect relative changes in organization which have occurred
since divergence of the two virus species from a common ancestor (McGeoch, 1984;
Davison & McGeoch, 1986).
The overall views which have so far emerged are as follows. The first regions of
HSV-1 and VZV to be compared were the S segments (McGeoch, 1984; Davison &
McGeoch, 1986). The HSV-1 Us region contains ten genes wholly and the major
parts of two more, while each copy of Rs contains one gene. In VZV, Ug contains
two complete genes and the major parts of two more, while each copy of Rs contains
three complete genes. Comparisons of predicted amino acid sequences showed that
each V ZV gene had an HSV-1 counterpart, but that six of the HSV-1 genes had no
VZV homologues. The layout of the genes differed in the two cases, and this was
interpreted as showing that the inverted repeat sequences were capable of large scale
The genome of herpes simplex virus
83
expansion or contraction in the course of evolution. By ‘expansion’ is meant that a
region in the unique sequence adjacent to the repeat can be duplicated in inverted
orientation at the other end of the unique sequence and is thus now regarded as part
of the repeat. A model using partially illegitimate recombination was proposed to
account economically for the changes.
Although the genome sequence of HSV-1 is presently unfinished in U l , it is clear
from the available data that the HSV-1 and VZV L regions correspond quite closely
in their content and arrangement of homologous genes, more so than the S segments.
VZV U l is predicted to contain 60 genes, on the basis of D N A sequence
interpretation, and we think at present that four of these have no counterparts in
HSV-1; conversely, we know of three HSV-1 L region genes without VZV
counterparts (unpublished data). Both these numbers may possibly rise a little when
the HSV-1 U l sequence is complete. Next, VZV possesses no large scale equivalent
of H SV R l , but one of the VZV U l genes is equivalent to HSV-1 IE gene 1, in R L
(Perry et al. 1986). These differences are illustrated in Fig. 6. The main conclusions
from these comparisons are that: (1) despite their large difference in base
composition, the genomes of HSV-1 and VZV are closely comparable in gene
arrangement; (2) there are, however, differences in gene content, and many of these
are closely associated with differences in repeat structure; and (3) the major repeats
are clearly highly dynamic structures on an evolutionary time scale.
Comparisons between an alphaherpesvirus genome and that of the gammaherpes­
virus EBV were initiated with HSV -l/EBV examples, but are now most completely
illustrated by the V ZV /E B V analysis of Davison & Taylor (1987). The results
obtained in such comparisons are illustrated at two levels of detail in Fig. 7. In
summary, these exercises show the following. EBV and VZV possess twenty nine
pairs of genes which exhibit amino acid sequence homology. These range from
strongly conserved to barely conserved examples. In addition, another fourteen pairs
of genes are regarded as probably homologous, from their positions and from
properties such as distribution of hydrophobic residues, although amino acid
sequence homology was not quantifiable. This, then, accounts for forty three of
V Z V ’s presently recognized complement of sixty seven unique genes, and it is certain
that each virus possesses a number of genes without counterparts in the other. All of
these related genes are located in the U L regions of the two genomes: the repeat
elements and the short regions appear unrelated. W ithin U L, conserved genes are
located in three major regions. W ithin each of these, gene arrangement is generally
conserved, but with some local rearrangements. However, the three large blocks
differ in their relative locations in the two genomes. Thus, as a broad synthesis of
both th e H S V /V Z V and V ZV /EBV analyses, the L segment appears to represent the
core of the general herpesvirus complement of genes, although by no means all of the
genes found there are conserved. The S regions, on the other hand, are characteristic
of sub-groups and also of species within these.
Examining the HSV-1 D N A replication genes in the light of these comparisons,
we see that all seven genes identified by Challberg have counterparts in the U l region
of VZV (Table 1). In some of these the sequence homologies are among the highest
D. J. McGeoch
84
registered in comparing these genomes. In EBV, homologues can be identified to
only four of the genes. This may reflect the roles and relative importances of these
proteins in central processes of DNA replication.
Comparison of replication origins between the genomes is also instructive. As
mentioned above, VZV possesses a counterpart of ons but not, apparently, of onL.
The EBV sequence possesses no element resembling the alphaherpesvirus origin
sequences. A qualification here results from the observed tendency of HSV onL to
delete on cloning into bacterial plasmids: perhaps the EBV ori has deleted, without
detection, in the clones used for sequence analysis. Present knowledge about EBV
D N A replication during the lytic cycle of the virus is limited. However, EBV DNA
exists in transformed, latently infected lymphocytes as a circular, nuclear episome,
u,
UL
TRl
IR l
HSV-1 L [E
_ i _ i __ i-i
• . :o
jjjj
5 kb
VZV L
IRl
UL
UL
TRc
Us
IRs
TRl
HSV-1 S
i- ii_i
oo o
-1
.
5 kb
VZV S
IRs
TRS
Fig. 6. Comparisons of gene arrangements of HSV-1 and VZV. In the upper part of the
figure, the arrangement of HSV-1 genes adjacent to the two extremities of the L region is
compared with the layout of the corresponding parts of VZV’s L region. In order to align
the standard VZV map with the prototype orientation of HSV-1 L, the VZV layout is
presented with the S region at the left. In the lower part of the figure, the arrangements of
genes in the two S regions are compared. Coding regions of genes are shown as arrows.
Homologous pairs of genes are joined by dotted lines. For genes in repeat regions, only
one homologue is indicated. Genes without homologues are marked ‘O ’. More infor­
mation on the gross structure of VZV D N A is given in the legend to Fig. 7. Data are from
McGeoch (1984); Davison & McGeoch (1986); Davison & Scott (1986); Chou &
Roizman (1986); Perry et al. (1986); Perry (1986); also unpublished data.
The genome of herpes simplex virus
85
and there is a second, ‘maintenance’ mode of EBV D N A replication active in this
situation. It has been found that in this case the only czs-acting element necessary is
located in the U s region (Yates et al. 1984). This is a structure called oriV, which
consists of two separable parts. The first is a tandem array of imperfect repeats of a 21
base pair sequence. The second comprises a palindromic sequence related to the
repeat unit (Reisman et al. 1985). The only essential, trans-acting factor supplied by
EBV is the EBNA-1 protein (which has no counterpart in H SV or VZV) and it is
known that this can bind specifically to the repeat units of on'P (Yates et al. 1985;
Lupton & Levine, 1985; Rawlins et al. 1985). This system thus differs very
significantly from the alphaherpesvirus origins, and can be rationalized as represent­
ing replication in phase with cell division, a capability not known to be required by
H SV or VZV.
Relations o f herpesvirus genes with other genes
All of the differences so far discussed have referred to processes of change within
lines of descent of present day herpesviruses, and the existence of some pre-existing,
ancient herpesvirus genome has been implicit in this. In general, there do not exist
recognizable ‘fossil’ forms of viruses by which we could hope to reconstruct earlier
evolutionary events, and we do not have any real idea as to the nature of a ‘pre­
herpesvirus’ genome, or as to what genetic entities have contributed to herpesvirus
genetic material. However, comparisons of predicted amino acid sequences of
herpesvirus genes with non-herpesvirus sequences have now revealed several
instances of homology between genes of herpesviruses and those from prokaryotic or
eukaryotic cell genomes. The examples found are of particular interest and relevance
to thinking about virus D N A replication. First, it is clear that both subunits of R R
from H SV, VZV and EBV are homologous to R R subunits of eukaryotic and
prokaryotic organisms (Caras et al. 1985; Standart et al. 1985). The same is also true
of the thymidylate synthase of VZV and of the gammaherpesvirus HVS (Davison &
Scott, 1986; Honess et al. 1986). Thus, it is plausible that an earlier herpesvirus or
pre-herpesvirus obtained these genes, directly or indirectly, from a cellular genome.
More instructive for our present purpose is the recent finding that there is an
extended similarity between the D N A polymerases of herpesviruses and of vaccinia
virus (Earl et al. 1986). Vaccinia virus is a member of the Poxviridae, large D N A
viruses which replicate in the cytoplasm. The strategy and details of their replicative
processes are very distinct from those of herpesviruses, and this is the first finding of
gene homology between the groups. Thus, the finding of a similarity in these D N A
polymerases, strongly indicative of a common origin, most simply suggests that both
may have originated from a cellular gene. The best present candidate for this is the
catalytic subunit of D N A polymerase a of eukaryotes. It should be noted that
homologies have been described between other vaccinia virus genes and their cellular
counterparts (see Earl et al. 1986). The homology between polymerases of
herpesviruses and vaccinia virus is considerably more extensive than a previously
found local similarity between herpesvirus polymerases and that of adenovirus,
whose significance was then unclear (Quinn & McGeoch, 1985). However, the
86
D. J. McGeoch
argument on cellular origin also applies, but with less force at present, to adenovirus
D N A polymerase. Apart from these examples, of proteins concerned with synthesis
of D N A and its precursors, the only remaining herpesvirus homology known in this
class is that of the alphaherpesvirus-specific gene proposed to encode a protein kinase
with amino acid sequence homology to members of the eukaryotic protein kinase
family (McGeoch & Davison, 1986a).
The idea that herpesvirus D N A polymerases may be related to the cell’s replicative
polymerase should be illuminating for future work on virus D N A replication. It also
encourages us to speculate that other genes, among those required for virus D N A
synthesis but of presently unidentified function, may bear similarities to factors in
eukaryotic D N A replication, and that this may contribute towards recognition of
functions of the virus genes as the eukaryotic gene sequences become available.
Processes o f herpesvirus genome evolution
The comparisons of herpesvirus genomes which have just been outlined demon­
strate that large changes in herpesvirus DN As must have occurred during evolution.
Among these, the large scale rearrangements, the qualitative changes in major repeat
elements present, and the alterations in extent of major repeat elements are all
reasonably attributable to the aberrant activities of one or more recombination
systems. At a finer level, the genomes have evidently been subjected to very extensive
processes of point mutation and small addition/deletion events during development
of the present day forms. An obvious candidate for introduction of such alterations is
the genome replicative system. Evidence has been presented in support of the idea
that the D N A polymerase of H SV is relatively error prone, namely that mutants exist
which give rise to a lower rate of mutations in the genome than does the wild type
enzyme (Hall et al. 1985). However, consideration of the wide range of base
compositions found in herpesvirus DNAs shows that processes of generation and
fixation of mutations in these genomes are more complex than just indicated.
At the whole genome level, herpesvirus D N A base compositions lie in the range of
32 to 75 % G + C (Honess, 1984). For the D N As of viruses discussed in this paper,
HSV-1 is 67 %, V ZV is 46 % and EBV is 60 % G + C. For HSV-1 and VZV we thus
Fig. 7. Comparison of gene arrangements in the genomes of VZV and EBV. (A) The
gross structures of the VZV and EBV genomes are shown. At this level, the genome of
VZV resembles that of HSV, except that the Ri, element is only eighty eight base pairs,
there is no counterpart of the a sequence, and proportions of the four genome isomers are
not all equally abundant (Davison, 1*984). EBV D N A possesses at each terminus, and in
the same orientation, a set of tandem repeat sequences, shown jointly as ‘T R ’. Internally
there is another set of direct repeats, marked ‘I R ’. There is only one orientation isomer
(see Baer et al. 1984). The locations in the three genomes of the three major blocks (A, B
and C) of corresponding genes are indicated. In EBV D N A the A block is relatively
inverted and is marked as ‘A ” . (B) The arrangements of genes in the U l regions of the
VZV and EBV genomes are shown, with the EBV genome rearranged to align blocks A, B
and C with the continuous VZV sequence. Lengths are marked in kilobase pairs, and for
EBV refer to the non-rearranged sequence. Coding regions and orientations of all
predicted genes are indicated, and pairs of genes which show amino acid sequence
homology are joined by dotted lines. Data are from Baer et al. (1984); Davison & Scott
(1986); Davison & Taylor (1987).
The genome of herpes simplex virus
87
A
A
VZV
B
C
l------- li-------- Il------------------- 1
I-------------------------------trl
ul
ir l
ir s
trs
Us
C
A'
B
I--------------------- II-------il--------- 1
EBV
□ ---------------------------------------------------------r u l l i l i
TR
UL
i t t i -----
IR
Us
l
<
0
H
A
><
20
10
30
TR
I
20 kb
VZV
□
40
*
EBV
H|
90
<
■■■■"I .
"■
■
■
80
A
|
100
> <
_ l_
T”
—r-
10
20
30
Fig. 7
|
110
B
70
60
50
—1_
VZV
........................................
70
-I I r
>
80
_k_
90
—L.
“ I—
40
120
100
— I—
—r—
50
60
>
■Cl
88
D. J. McGeoch
have the remarkable result that two genomes which are clearly related, with very
similar genetic organization over most of their length, differ by 21 percentage points
in gross base composition, the difference being distributed rather evenly over the
whole of the comparable sequences. The phenomenon of base compositional
variation also occurs at an intragenomic level: for example, the R s element of HSV-1
D N A is 79-5% G + C, while the adjacent Ug is 64-3% (McGeoch et al. 1985,
19866). The nature of evolutionary forces responsible for such extensive effects are at
present quite obscure. It is evident from detailed examination of the sequences that
requirements of polypeptide coding are not in general primarily responsible, but
that, in contrast, evolution to an extreme of G + C content has affected amino acid
composition. This is most clearly shown by comparing the HSV-1 and VZV versions
of the transactivator gene in Rs (McGeoch et al. 1986a).
Although the ‘why’ of this phenomenon remains unknown, we can discuss ‘how’:
that is, the nature of the biochemical machinery responsible. Possession of an error
prone D N A polymerase cannot in itself be sufficient, since it would be difficult to
account for large differences in base composition between extensive regions within
one genome by this means. We have previously classified elements of the machinery
responsible under three functional headings, as a mutation producer, a biasing
mechanism and a disseminating mechanism. D N A polymerase certainly may be
important in the production of mutations. The biasing mechanism is required to
impart directionality. Whatever its nature, this must be metastable over evolutionary
time periods. It is possible that D N A polymerase could be involved here also.
Another suggestion is that virus coded enzymes for nucleotide synthesis could
influence frequency and direction of substitution mutations by altering dN T P pool
sizes (Honess et al. 1986). We have proposed a model whereby directionality is
imparted by recombination in the D N A molecules in an infected cell, by a form of
biased gene conversion in which survival of alleles is affected by their base
composition (McGeoch et al. 1986a). This notion had its roots in ideas on the
concerted evolution of multigene families of eukaryotes (Dover, 1982). Whether or
not directionality is mediated by recombination, we wish to invoke recombination as
a disseminator of mutations through an intracellular population of D N A molecules,
in order to explain differences in base composition between repeat and unique
sequences. The abundance of repeat sequences is, by definition, higher than that of
unique elements. More potentially fixable mutations therefore occur at a given
sequence position over the whole repeat population, and the occurrence of
recombination for dissemination of these mutations should also be higher, resulting
in a more rapid evolution of repeat sequences. We conclude by re-emphasizing that
these speculations have been concerned only with how base composition changes
might have been implemented, but do not at all approach the question of why they
should represent favourable or even survivable operations.
Thanks are due to M. D. Challberg, A. J. Davison, V. G. Preston and S. K. Weller for access to
unpublished data, and to N. D. Stow for discussion. References to unpublished HSV-1 sequences
determined in the author’s laboratory included work by M. A. Dalrymple, A. Dolan, M. C. Frame,
D. McNab and L. J. Perry.
The genome of herpes simplex virus
89
REFERENCES
S ., E v e l e g h , M. J., M u i r h e a d , B . & S p e c t o r , T. (1984). Immunological
characterization of herpes simplex virus type 1 and type 2 polypeptide(s) involved in viral
ribonucleotide reductase activities. J ’. Virol. 49, 591-593.
B a e r , R., B a n k i e r , A . T . , B i g g i n , M. D . , D e i n i n g e r , P. L., F a r r e l l , P. J., G i b s o n , T . J.,
H a t f u l l , G ., H u d s o n , G. S ., S a t c h w e l l , S . C., S e g u i n , C., T u f f n e l l , P. S. & B a r r e l l ,
B . G. (1984). D N A sequence and expression of the B95-8 Epstein-Barr virus genome. Nature,
Lond. 310, 207-211.
B e n -Po r a t , T. & R i x o n , F. J. (1979). Replication of herpesvirus D N A. IV. Analysis of
concatemers. Virology 94, 61-70.
B e r g s m a , D . J., O l i v e , D . M ., H a r t z e l l , S . W. & S u b r a m a n i a n , K. N. (1982). Territorial
limits and functional anatomy of the simian virus 40 replication origin. Proc. natn. Acad. Sci.
U.S.A. 79, 381-385.
B i s w a l , N., F e l d a n , P. & L e v y , C. C. (1983). A D N A topoisomerase activity copurifies with the
D N A polymerase induced by herpes simplex virus. Biochim. biophys. Acta 740, 379-389.
C a r a s , I. W . , L e v i n s o n , B. B., F a r b r y , M ., W i l l i a m s , S . R . & M a r t in , D. W . (1985). Cloned
mouse ribonucleotide reductase subunit M l cDNA reveals amino acid sequence homology with
Escherichia coli and herpesvirus ribonucleotide reductases. J . Biol. Chem. 260, 7015-7022.
C h a l l b e r g , M. D . (1986). A method for identifying the viral genes required for herpesvirus D N A
replication. Proc. natn. Acad. Sci. U.S.A. 83 , 9094-9098.
C h a r t r a n d , P., S t o w , N. D ., T im b u r y , M. C . & W i l k i e , N. M. (1979). Physical mapping of
p a a T mutations of herpes simplex virus type 1 and type 2 by intertypic marker rescue. J. Virol.
31, 265-276.
C h o u , J. & R o i z m a n , B . (19 85 ). Isomerization of herpes simplex virus 1 genome: Identification of
the cw-acting and recombination sites within the domain of the a sequence. Cell 41, 803-811.
C h o u , J . & R o i z m a n , B . (1986). The terminal a sequence of the herpes simplex virus genome
contains the promoter of a gene located in the repeat sequences of the L component. J'. Virol. 57,
629-637.
C o e n , D . M ., A s c h m a n , D . P., G e l e p , P. T ., R e t o n d o , M. J., W e l l e r , S . K . & S c h a f f e r ,
P. A . (1984). Fine mapping and molecular cloning of mutations in the herpes simplex virus
D N A polymerase locus. J . Virol. 49, 236-247.
C o e n , D . M ., F u r m a n , P. A., G e l e p , P. T. & S c h a f f e r , P. A. (1982). Mutations in the herpes
s im p le x v iru s D N A p oly m e rase gene can co nfer resistance to 9-/3-D-arabinofuranosyladenine.
J . Virol. 41, 909-918.
C o h e n , G. H. (1972). Ribonucleotide reductase activity of synchronized KB cells infected with
herpes simplex virus. J . V irol. 9, 408—418.
C o n l e y , A. J., K n i p e , D . M ., I o n e s , P. C . & R o i z m a n , B . (1981). Molecular genetics of herpes
simplex virus. V II. Characterization of a temperature-sensitive mutant produced by in vitro
mutagenesis and defective in D N A synthesis and accumulation of y polypeptides. J . Virol. 37,
191-206.
C o s t a , R. H . , D r a p e r , K . G ., K e l l y , T. J. & W a g n e r , E . K . (1985). A n u n u s u a l s p lic e d herpes
B a c c h e t t i,
s im p le x v iru s ty p e
1 tra n s c r ip t
w ith sequence h o m o lo g y to E pste in- B arr v iru s D N A . J .
Virol. 54,
317-328.
P., S u b a k -Sh a r p e , J. H. & W i l k i e , N. M . (1980). Resistance
of herpes simplex virus to acycloguanosine - genetic and physical analysis. Virology 105,
171-184.
D a l z i e l , R. G. & M a r s d e n , H. S. (1984). Identification of two herpes simplex virus type 1induced proteins (21K and 22K) which interact specifically with the a sequence of herpes
simplex virus D N A ._ 7 . gen. Virol. 65, 1467-1475.
DAVISON, A. J. (1984). Structure of the genome termini of varicella-zoster virus, jf. gen. Virol. 65,
1969-1977.
D a v i s o n , A. J. & M c G e o c h , D . J. (1986). Evolutionary comparisons of the S segments in the
genomes of herpes simplex virus type 1 and varicella-zoster virus.,7. gen. Virol. 67, 597-611.
D a v i s o n , A . J. & S c o t t , J. E . (1986). T h e c o m p le te D N A sequence o f varicella-zoster viru s.
C r u m p a c k e r , C . S ., C h a r t r a n d ,
J . gen. Virol. 67,
1759-1816.
90
D. J. McGeoch
A. J . & T a y l o r , P. (1987). Genetic relations between varicella-zoster virus and EpsteinBarr virus. J . gen. Virol, (in press).
D a v i s o n , A. J. & W i l k i e , N. M. (1981). Nucleotide sequences of the joint between the L and S
segments of herpes simplex virus types 1 and 2. J. gen. Virol. 55, 315-331.
D a v is o n ,
D a v i s o n , A . J . & W i l k i e , N . M . (1 9 8 3 a ). In v e rs io n o f the tw o segm ents o f the herpes s im p le x
v iru s g e n o m e in in te rty p ic re c o m b in a n ts . J .
gen. Virol. 64,
1-18.
A. J . & W i l k i e , N. M. (19836). Either orientation of the L segment of the herpes
simplex virus genome may participate in the production of viable intertypic recombinants.
J . gen. Virol. 64, 247-250.
D a v i s o n , A. J . & W i l k i e , N. M. (1983c). Location and orientation of homologous sequences in the
genomes of five herpesviruses. J'. gen. Virol. 64, 1927-1942.
D o v e r , G. (1982). Molecular drive: a cohesive mode of species evolution. Nature, Lond. 299,
111-117.
D u t ia , B . M . (1983). Ribonucleotide reductase induced by herpes simplex virus has a virus
specified constituent.^, gen. Virol. 65, 513-521.
E a r l , P. L., J o n e s , E . V. & Moss, B. (1986). Homology between D N A polymerases of
poxviruses, herpesviruses, and adenoviruses: nucleotide sequence of the vaccinia virus D N A
polymerase gene. Proc. natn. Acad. Sci. U.S.A. 83, 3659-3663.
D a v is o n ,
E l i a s , P ., O ’D o n n e l l , M . E . , M o c a r s k i , E . S . & L e h m a n , I . R . (1986). A D N A - b in d in g p ro te in
specific fo r a n o r ig in o f re p lic a tio n o f herpes s im p le x v iru s ty p e 1.
83,
Proc. natn. Acad. Sci. U.S.A.
6322-6326.
R. D . (1984). Transactivation of transcription of herpes virus products; requirements for
two HSV-1 immediate early polypeptides for maximum activity. E M B O J. 3, 3135-3141.
E v e r e t t , R. D . (1986). The products of herpes simplex virus type 1 (HSV-1) immediate early
genes 1, 2 and 3 can activate HSV gene expression in trails. J . gen. Virol. 67, 2507-2513.
F i e l d , H. J. & W i l d y , P. (1978). The pathogenicity of thymidine kinase-deficient mutants of
herpes simplex virus in mice. J . Hygiene 81, 261-277.
F i s h e r , F . B. & P r e s t o n , V. G. (1986). Isolation and characterisation of herpes simplex virus type
1 mutants which fail to induce dUTPase activity. Virology 148, 190-197.
F r a m e , M . C., M a r s d e n , H . S . & D u t ia , B. M . (1985). The ribonucleotide reductase induced by
herpes simplex virus type 1 involves minimally a complex of two polypeptides (136K and 38K).
J. gen. Virol. 66, 1581-1587.
F r a n c k e , B. & G a r r e t t , B. (1982). The effect of a temperature-sensitive lesion in the alkaline
DNase of herpes simplex virus type 2 on the synthesis of viral D N A . Virology 116, 116-127.
F r i e d m a n n , A., S h l o m a i , J . & B e c k e r , Y . (1977). Electron microscopy of herpes simplex virus
D N A molecules isolated from infected cells by centrifugation in CsCl density grandients. J . gen.
Virol. 34, 507-522.
G e l m a n , I. H . & S il v e r s t e in , S . (1985). Identification of immediate early genes from herpes
simplex virus that transactivate the virus thymidine kinase. Proc. natn. Acad. Sci. U.S.A. 82,
5265-5269.
G ib b s , J. S ., C h i o u , H . C . , H a l l , J. D ., M o u n t , D. W . , R e t o n d o , M . J., W e l l e r , S. K. &
C o e n , D . M . (1985). S e q ue nc e a n d m a p p in g analyses o f the herpes s im p le x viru s D N A
E verett,
p o ly m e ras e gene p re d ic t a C - te rm in al substrate b in d in g d o m a in .
Proc. natn. Acad. Sci. U.S.A.
82, 7969-7973.
T., S t o c k w e l l , P., G i n s b u r g , M. & B a r r e l l , B. (1984). Homology between two EBV
early genes and HSV ribonucleotide reductase and 38K genes. Nucl. Acids Res. 12, 5087-5099.
G r a y , C. P. & K a e r n e r , H . C. (1984). Sequence of the putative origin of replication in the
region of herpes simplex virus type 1 A N G D N A . J . gen. Virol. 65, 2109—2119.
H a l l , J. D ., F u r m a n , P . A., S t C l a i r , M . H . & K n o p f , C . W . (1 9 85 ). R e d u c e d in vivo
m u ta g e n e s is b y m u ta n t herpes s im p le x D N A poly m e rase invo lve s im p r o v e d n u c le o tid e
G ib s o n ,
sele ctio n.
Proc. natn. Acad. Sci. U.S.A. 82,
3889-3893.
J. & S u b a k -Sh a r p e , J. H . (1976). Mutants of herpes simplex virus types 1 and 2 that are
resistant to phosphonoacetic acid induce altered D N A polymerase activities in infected cells.
J. gen. Virol. 31, 145-148.
H o f f m a n n , P. J. (1981). Mechanism of degradation of duplex D N A by the DNase induced by
herpes simplex virus. J . Virol. 38, 1005-1014.
.
H ay,
The genome of herpes simplex virus
91
P. J. & C h e n g , Y.-C. (1978). The deoxyribonuclease induced after infection of KB
cells by herpes simplex virus type 1 or type 2. J . Biol. Chem. 253, 3557-3562.
H o f f m a n n , P. J. & C h e n g , Y.-C. (1979). DNase induced after infection of KB cells by herpes
simplex virus type 1 or type 2. II. Characterization of an associated endonuclease activity.
jf. Virol. 32, 449-457.
"
H o n e s s , R. W. (1984). Herpes simplex and ‘the herpes complex’: diverse observations and a
unifying hypothesis. J . gen. Virol. 65, 2077-2107.
H o n e s s , R . W. & R o i z m a n , B. (1974). Regulation of herpesvirus macromolecular synthesis.
I. Cascade regulation of the synthesis of three groups of viral proteins. J . Virol. 14, 8-19.
H o n e s s , R. W ., B o d e m e r , W ., C a m e r o n , K. R., N i l l e r , H .- H . & F l e c k e n s t e in , B . (1986). The
A + T-rich genome of herpesvirus saimiri contains a highly conserved gene for thymidylate
synthase. Proc. natn. Acad. Sei. U.S.A. 83, 3604-3608.
H o n e s s , R. W ., P u r if o y , D . J. M ., Y o u n g , D ., G o p a l , R., C a m m a c k , N. & O ’H a r e , P . (1984).
Single mutations at many sites within the D N A polymerase locus of herpes simplex viruses can
confer hypersensitivity to aphidicolin and resistance to phosphonoacetic acid. J. gen. Virol. 65,
1-17.
J a c o b , R . J . , M o r s e , L . S. & R o i z m a n , B . (1979). Anatomy of herpes simplex virus DNA.
X II. Accumulation of head-to-tail concatemers in nuclei of infected cells and their role in the
generation of the four isomeric arrangements of viral D N A. J . Virol. 29, 448-457.
J a m i e s o n , A. T., G e n t r y , G . A. & S u b a k -Sh a r p e , J . H. (1974). Induction of both thymidine and
deoxycytidine kinase activity by herpes viruses. J. gen. Virol. 24, 465-480.
J o n g e n e e l , C. V. & B a c h e n h e i m e r , S. L . (1981). Structure of replicating herpes simplex virus
D N A . J . Virol. 39, 656-660.
K a e r n e r , H . C., M a i c h l e , I. B., O tt , A. & S c h r ö d e r , C. H. (1979). Origin of two different
classes of defective HSV-1 Angelotti D N A . Nucl. Acids Res. 6, 1467-1478.
K e i r , H . M . & G o l d , E . (1963). D e o x y rib o n u c le ic a c id nu cle o tid y ltra nsfe rase a n d d e o x y r ib o n u ­
H offm ann,
clease fr o m c u ltu r e d cells infe c te d w ith herpes s im p le x viru s.
Biochim. biophys. Acta 72,
263-276.
K i e f f , E. D . , B a c h e n h e i m e r , S. L . & R o i z m a n , B. (1971). Size, composition and structure of the
deoxyribonucleic acid of herpes simplex virus subtypes 1 and 2. J. Virol. 8, 125-132.
K i t , S . & D u b b s , D . R . (19 63 ). A c q u is itio n o f t h y m id in e kinase a c tiv ity b y he rpe s sim p le x
in fe c te d m o u s e fib ro b la s t cells.
Biochem. Biophys. Res. Comm. 11,
55-59.
(1979). Properties of herpes simplex virus D N A polymerase and characterization of
its associated exonuclease activity. E u r.J . Biochem. 98, 231-244.
L it t l e r , E., P u r if o y , D ., M i n s o n , A. & P o w e l l , K. L . (1983). Herpes simplex virus nonstructural proteins. III. Function of the major DNA-binding protein..?, gen. Virol. 64, 983-995.
L o c k s h o n , D. & G a l l o w a y , D. A. (1986). Cloning and characterization of oh'l 2 , a large
palindromic D N A replication origin of herpes simplex virus type 2 .J . Virol. 58, 513-521.
L o n g n e c k e r , R . & R o i z m a n , B. (1986). Generation of an inverting herpes simplex virus 1 mutant
lacking the L-S junction a sequences, an origin of D N A synthesis, and several genes including
those specifying glycoprotein E and the alpha 47 gene. J. Virol. 58, 583-591.
L u p t o n , S. & L e v i n e , A. J. (1985). Mapping genetic elements of Epstein-Barr virus that facilitate
extrachromosomal persistence of Epstein-Barr virus-derived plasmids in human cells. Mol. cell.
Biol. 5, 2533-2542.
M a t t h e w s , R. E. F. (1982). Classification and nomenclature of viruses. Intervirology 17, 1-200.
M c G e o c h , D . J . (1984). The nature of animal virus genetic material. In The Microbe 1984, part 1,
Viruses (ed. B. W. J. Mahy & J. R. Pattison), pp. 75-107. Cambridge: Cambridge University
Press.
M c G e o c h , D . J. & D a v i s o n , A. J. (1986a). Alphaherpesviruses possess a gene homologous to the
protein kinase gene family of eukaryotes and retroviruses. Nucl. Acids Res. 14, 1765-1777.
M c G e o c h , D . J. & D a v i s o n , A. J. (1986£>). D N A sequence of the herpes simplex virus type 1 gene
encoding glycoprotein gH, and identification of homologues in the genome of varicella-zoster
virus and Epstein-Barr virus. Nucl. Acids Res. 14, 4281-4292.
M c G e o c h , D . J., D o l a n , A . , D o n a l d , S. & B r a u e r , D . H. K. (1986a). Complete D N A
sequence of the short repeat region in the genome of herpes simplex virus type 1. Nucl. Acids
Res. 14, 1727-1745.
K n o p f , K .- W .
92
D. J. McGeoch
J., D o l a n , A ., D o n a l d , S. & R i x o n , F. J. (1985). Sequence determination and
genetic content of the short unique region in the genome of herpes simplex virus type 1. J . mol.
Biol. 181, 1-13.
M c G e o c h , D . J., D o l a n , A . & F r a m e , M . C . (19 86 6). D N A sequence o f the re g io n in th e g e n o m e
M cG eoch , D .
o f h e rpe s s im p le x v iru s type 1 c o n ta in in g the exonuclease gene a n d n e ig h b o u r in g genes.
Nucl.
Acids Res. 14, 3435-3447.
J. & C l e m e n t s , J. B . (1983). Organization of the herpes simplex virus type 1
transcription unit encoding two early proteins with molecular weights of 140000 and 40 000.
J . gen. Virol. 64, 997-1006.
M o c a r s k i , E. S. & R o i z m a n , B . (1982). Structure and role of the herpes simplex virus D N A
termini in inversion, circularization and generation of virion D N A. Cell 31, 89-97.
M o r r i s o n , J. M . & K e i r , H. M . (1968). A new DNA-exonuclease in cells infected with herpes
virus: partial purification and properties of the enzyme. J. gen. Virol. 3, 337-347.
Moss, H. (1986). The herpes simplex virus type 2 alkaline DNase activity is essential for
replication and growth. J . gen. Virol. 67, 1173—1178.
Moss, H . , C h a r t r a n d , P ., T im b u r y , M. C . & H a y , J. (1979). Mutant of herpes simplex virus
type 2 with temperature-sensitive lesions affecting virion thermostability and DNase activity:
identification of the lethal mutation and physical mapping of the nuc~ lesion. J . Virol. 32,
140-146.
M u l l e r , M . T., B o l l e s , C. S. & P a r r i s , D. S. (1985). Association of type I D N A topoisomerase
with herpes simplex virus, jf. gen. Virol. 66, 1565-1574.
M u r c h i e , M.-J. & M c G e o c h , D. J. (1982). D N A sequence analysis of an immediate-early gene
region of the herpes simplex virus type 1 genome (map coordinates 0.950 to 0.978).^. gen. Virol.
62, 1-15.
O ’H a r e , P . & H a y w a r d , G. S . (1985). Evidence for a direct role for both the 175,000 and 110,000
molecular weight immediate-early proteins of herpes simplex virus in the trans activation of
delayed-early promoters. J'. Virol. 53, 751-760.
P e l l e t t , P . E., B i g g i n , M. D . , B a r r e l l , B. & R o i z m a n , B. (1985). Epstein-Barr virus genome
may encode a protein showing significant amino acid and predicted secondary structure
homology with glycoprotein B of herpes simplex virus 1. Jf. Virol. 56, 807-813.
P e r r y , L . J. (1986). D N A sequence analysis of the repeat and adjoining unique region o f the long
segment of herpes simplex virus type 1. P h D Thesis, University of Glasgow.
P e r r y , L. J., R i x o n , F. J., E v e r e t t , R . D ., F r a m e , M . C. & M c G e o c h , D . J. (1986).
Characterization of the IEllO gene of herpes simplex virus type 1.J .g e n . Virol. 67, 2365-2380.
P o f f e n b e r g e r , K. L. & R o i z m a n , B. (1985). A noninverting genome of a viable herpes simplex
virus 1: Presence of head-to-tail linkages in packaged genomes and requirements for circulariz­
ation after infection. J. Virol. 53, 587-595.
P o w e l l , K. L . & P u r if o y , D. J. M. (1977). Nonstructural proteins of herpes simplexvirus.
I. Purification of the induced D N A polymerase. J'. Virol. 24, 618-626.
P o w e l l , K . L . , L it t l e r , E . & PURIFOY, D .J.M .(1 9 8 1 ). Nonstructural proteins of herpes simplex
virus. II. Major virus-specific DNA-binding protein J ’. Virol. 39, 894-902.
P r e s t o n , C . M., C o r d i n g l e y , M. G. & S t o w , N. D . (1984). Analysis of D N A sequences which
regulate the transcription of a herpes simplex virus immediate early gene. J . Virol. 50, 708-716.
P r e s t o n , V. G. & F i s h e r , F . B . (1984). Identification of the herpes simplex virus type 1 gene
encoding the duTPase. Virology 138, 58-68.
P r e s t o n , V. G ., P a l f r e y m a n , J. W. & D u t ia , B. M. (1984). Identification of a herpes simplex
virus type 1 polypeptide which is a component of the virus-induced ribonucleotide reductase.
J . gen. Virol. 65, 1457-1466.
P u r if o y , D . J. M. & P o w e l l , K. L . (1981). Temperature-sensitive mutants in two distinct
complementation groups of herpes simplex virus type 1 specify thermolabile D N A polymerase.
J . gen. Virol. 54, 219-222.
Q u i n n , J . P . & M c G e o c h , D . J. (1985). D N A sequence o f the re g io n in the g e n o m e o f h e rpes
s im p le x v iru s ty p e 1 c o n ta in in g th e genes fo r D N A poly m e rase a n d the m a jo r D N A b in d in g
p r o te in . Nucl. Acids Res. 13, 8143-8163.
R a p p , F . & W i g d a h l , B. (1983). Herpesvirus target considerations for the design of antiviral
agents. In Targets fo r the design o f antiviral agents (ed. E . De Clercq & R . T . Walker), pp.
29-60. New York: Plenum Press.
M cL auchlan ,
The genome of herpes simplex virus
93
D. R . , M i l m a n , G., H a y w a r d , S. D. & H a y w a r d , G. S. (1985). Sequence-specific
D N A binding of the Epstein-Barr virus nuclear antigen (EBNA-1) to clustered sites in the
plasmid maintenance region. Cell 42, 859-868.
R e i s m a n , D ., Y a t e s , J. & S u g d e n , B. (1985). A putative origin of replication of plasmids derived
from Epstein-Barr virus is composed of two as-acting components. Mol. cell. Biol. 5, 1822-1832.
R i x o n , F. J. & C l e m e n t s , J. B. (1982). D e ta ile d s tru c tu ra l analysis o f tw o sp lice d HSV-1
im m e d iate - e a rly m R N A s . Nucl. Acids Res. 10, 2241-2256.
R i x o n , F. J. & M c G e o c h , D. J. (1984). A 3' co- term inal fa m ily of m R N A s fr o m th e herpes
s im p le x v iru s ty p e 1 s h o rt re g io n : T w o o v e rla p p in g re a d in g fram e s e nc od e u n re la te d
R a w l in s ,
p o ly p e p tid e s o ne o f w h ic h has a h ig h ly reiterated a m in o acid sequence.
Nucl. Acids Res. 12,
2473-2487.
'
R i x o n , F . J . & M c G e o c h , D . J . (1985). D e ta ile d analysis o f the m R N A s m a p p in g in th e short
u n iq u e re g io n o f herpes s im p le x viru s type 1. Nucl. Acids Res. 13, 953-973.
R i x o n , F. J., C a m p b e l l , M. E. & C l e m e n t s , J. B. (1984). A tandemly reiterated D N A sequence
in the long repeat region of herpes simplex virus type 1 found in close proximity to immediateearly m R N A 1.J . Virol. 52, 715-718.
R o i z m a n , B. (1979). The structure and isomerization of herpes simplex virus genomes. Cell 16,
481-494.
R o i z m a n , B. (1982). The family herpesviridae: General description, taxonomy, and classification.
In The herpesviruses , vol. 1 (ed. B. Roizman), pp. 1-23. New York and London: Plenum Press.
S h e l d r i c k , P. & B e r t h e l o t , N. (1974). Inverted repetitions in the chromosome of herpes simplex
virus. Cold Spring Harbor Symp. Quant. Biol. 39, 667-678.
S p a e t e , R. R. & F r e n k e l , N. (1982). The herpes simplex virus amplicon: a new eukaryotic
defective-virus cloning-amplifying vector. Cell 30, 295-304.
S t a n d a r t , N . , B r a y , S . J., G e o r g e , E. L., H u n t , T . & R u d e r m a n , J. V. (1985). T h e sm all
s u b u n it o f rib o n u c le o tid e reductase is e n c o d e d b y one of the m o st a b u n d a n t tra n s la tio n a lly
re g u la te d m a te rn a l R N A s in c la m a n d sea u r c h in eggs. J . Cell Biol. 100, 1968—1976.
Stow, N. D . (1982). Localization of an origin of D N A replication within the T R g/lR g repeated
region of the herpes simplex virus type 1 genome. E M B O J. 1, 863-867.
S t o w , N. D . (1985). Mutagenesis of a herpes simplex virus origin of D N A replication and its-effect
on viral interference. .7- gen. Virol. 66, 31-42.
S t o w , N . D . & D a v i s o n , A . J. (1986). Identification of a varicella-zoster virus origin of D N A
replication and its activation by herpes simplex virus type 1 gene products. J . gen. Virol. 67,
1613-1623.
S t o w , N. D . & M c M o n a g l e , E . C. (1983). Characterization of the T R g / l R g origin of DN A
replication of herpes simplex virus type 1. Virology 130, 427-438.
S t o w , N . D . , M c M o n a g l e , E. C. & D a v is o n , A . J. (1983). Fragments from both termini of the
herpes simplex virus type 1 genome contain signals required for the encapsidation of viral D N A .
Nucl. Acids Res. 11, 8205-8220.
S t r o b e l -F i d l e r , M. & F r a n c k e , B. (1980). Alkaline deoxyribonuclease induced by herpes
simplex virus type 1: Composition and properties of the purified enzyme. Virology 103, 493-501.
V a r m u z a , S . & S m i l e y , J. R. (1985). Signals for site-specific cleavage of HSV D N A : Maturation
involves two separate cleavage events at sites distal to the recognition sequences. Cell 41,
793-802.
V a u g h a n , P . J., P u r if o y , D. J. & P o w e l l , K. L. (1985). DNA-binding protein associated with
herpes simplex virus D N A polymerase. J. Virol. 53, 501-508.
V l a z n y , D . A. & F r e n k e l , N. (1981). Replication of herpes simplex virus D N A : localization of
replication recognition signals within defective virus genomes. Proc. natn. Acad. Sci. U.S.A. 78,
742-746.
V l a z n y , D . A., K w o n g , A. & F r e n k e l , N. (1982). Site-specific cleavage/packaging of herpes
simplex virus D N A and the selective maturation of nucleocapsids containing full-length DNA.
Proc. natn. Acad. Sci. U.S.A. 79, 1423-1427.
W a g n e r , E. K. (1985). Individual HSV transcripts: Characterization of specific genes. In The
herpesviruses , vol. 3 (ed. B. Roizman), pp. 45-104. New York and London: Plenum Press.
W a g n e r , M. J. & S u m m e r s , W . C. (1978). Structure of the joint region and the termini of the
D N A of herpes simplex virus type 1. J'. Virol. 27, 374-387.
94
D. J. McGeoch
R. J., P r e s t o n , C . M. & C l e m e n t s , J. B. (1979). Separation and characterization of
herpes simplex virus type 1 immediate-early mRNAs. J . Virol. 31, 42-52.
W e l l e r , S . K ., L e e , K. J., S a b o u r i n , D . J. & S c h a f f e r , P. A. (1983). Genetic analysis of
temperature-sensitive mutants which define the gene for the major herpes simplex virus type 1
DNA-binding protein. J . Virol. 45, 354-366.
W e l l e r , S . K ., S p a d a r o , A., S c h a f f e r , J. E., M u r r a y , A. E., M a x a m , A. M . & S c h a f f e r ,
P. A. (1985). Cloning, sequencing, and functional analysis of onL, a herpes simplex virus type 1
origin of D N A synthesis. Mol. cell. Biol. 5, 930-942.
W h it t o n , J. L. & C l e m e n t s , J. B. (1984). Replication origins and a sequence involved in
coordinate induction of the immediate early gene family are conserved in an intergenic region of
herpes simplex virus. Nucl. Acids Res. 12, 2061-2079.
W OHLRAB, F . & FRANCKE, B. (1980). Deoxyribopyrimidine triphosphatase activity specific for
cells infected with herpes simplex virus type 1. Proc. natn. Acad. Sci. U.S.A. 77, 1872-1876.
Y a t e s , J., W a r r e n , N ., R e i s m a n , D . & S u g d e n , B. (1984). A cis acting element from the
Epstein-Barr viral genome that permits stable replication of recombinant plasmids in latently
infected cells. Proc. natn. Acad. Sci. U.S.A. 81, 3806-3810.
Y a t e s , J. L., W a r r e n , N. & S u g d e n , B. (1985). Stable replication of plasmids derived from
Epstein-Barr virus in various mammalian cells. Nature, Lond. 313, 812-815.
W atson,