Download MHC2TA Single Nucleotide Polymorphism and Genetic Risk for

0021-972X/06/$15.00/0
Printed in U.S.A.
The Journal of Clinical Endocrinology & Metabolism 91(10):4107– 4111
Copyright © 2006 by The Endocrine Society
doi: 10.1210/jc.2006-0855
MHC2TA Single Nucleotide Polymorphism and Genetic
Risk for Autoimmune Adrenal Insufficiency
Mehran Ghaderi, Giovanni Gambelunghe, Cristina Tortoioli, Annalisa Brozzetti, Ken Jatta,
Baback Gharizadeh, Annamaria De Bellis, Francesca Pecori Giraldi, Massimo Terzolo, Corrado Betterle,
and Alberto Falorni, on behalf of the Italian Addison Network
Department of Clinical Pathology and Cytology (M.G.), Karolinska University Hospital, SE-141 86 Stockholm, Sweden;
Department of Internal Medicine (G.G., C.T., A.B., A.F.), Section of Internal Medicine and Endocrine and Metabolic
Sciences, University of Perugia, 06126 Perugia, Italy; Division of Biomedicine (K.J.), Department of Clinical Medicine,
University of Örebro, SE-701 82 Örebro, Sweden; Stanford Genome Technology Center (B.G.), Stanford University, Palo
Alto, California 94305; Department of Clinical and Experimental Medicine and Surgery (A.D.B.) F. Magrassi, A. Lanzara,
Second University of Naples, 10-81100 Naples, Italy; Chair of Endocrinology (F.P.G.), University of Milan, Ospedale San
Luca, Istituto Auxologico Italiano Istituto di Ricovero e Cura a Carattere Scientifico, 7–20122 Milan, Italy; Medicina Interna
I (M.T.), Department of Clinical and Biological Sciences, University of Torino, ASO San Luigi, 185-10149 Orbassano, Italy;
and Department of Medical and Surgical Sciences (C.B.), University of Padova, 2-35122 Padova, Italy
Context: The polymorphism of class II HLA genes modulates the
genetic risk for several endocrine autoimmune diseases. The constitutive class II expression on antigen-presenting cells is under the
control of the MHC class II transactivator, encoded by the MHC2TA
gene, which is mapped to chromosome 16p13. The MHC2TA ⫺168
A3 G single nucleotide polymorphism (rs3087456) has been suggested to confer susceptibility to some autoimmune diseases.
Design: With the aim of testing whether this MHC2TA single nucleotide polymorphism is independently associated with autoimmune
Addison’s disease (AAD) and/or modulates the genetic risk conferred
by DRB1-DQA1-DQB1 haplotypes, we analyzed DNA samples from
128 AAD patients and 406 healthy control subjects from continental
Italy.
Results: Frequency of allele G of MHC2TA was significantly increased among AAD patients (39% alleles), compared with 29% in
E
NDOCRINE AUTOIMMUNE DISEASES, such as thyroid autoimmune diseases, autoimmune Addison’s
disease (AAD), type 1 diabetes mellitus, autoimmune premature ovarian failure, autoimmune hypophysitis, or autoimmune hypoparathyroidism, share a common genetic background (1). With the exception of the autoimmune
polyendocrine syndrome type 1 (APS I), which is caused by
mutations of the AIRE gene (2), located on chromosome 21,
all the other clinical manifestations of endocrine autoimmunity are positively associated with the polymorphism of class
II HLA genes DRB1, DQA1, and DQB1.
The constitutive as well as the interferon-␥-inducible class
II expression on antigen-presenting cells is under the control
First Published Online July 18, 2006
Abbreviations: AAD, Autoimmune Addison’s disease; APS I, autoimmune polyendocrine syndrome type I; CI, confidence interval; CIITA,
class II transactivator; IAN, Italian Addison Network; NF-Y, nuclear
factor Y; OR, odds ratio; RFX, regulatory factor X; SNP, single nucleotide
polymorphism.
JCEM is published monthly by The Endocrine Society (http://www.
endo-society.org), the foremost professional society serving the endocrine community.
healthy controls (P ⫽ 0.003). Similarly, the frequency of AG⫹GG
genotypes was significantly higher among AAD patients than among
healthy control subjects, in both a codominant (P ⫽ 0.012) and a
G-dominant model (P ⫽ 0.018). Multivariate logistic regression analysis showed that MHC2TA AG⫹GG continued to be positively associated with genetic risk for AAD (P ⫽ 0.028, odds ratio ⫽ 1.72, 95%
confidence interval ⫽ 1.06 –2.78), after correction for DRB1*03DQA1*0501-DQB1*0201,
DRB1*04
(not
0403)-DQA1*0301DQB1*0302 and DRB1*0403. Similar results were obtained when the
number of G alleles was included in the model (P ⫽ 0.004; odds ratio ⫽
1.65, 95% confidence interval ⫽ 1.17–2.32).
Conclusions: Our study provides the first demonstration of the association of the polymorphism of the MHC2TA gene with genetic risk
for AAD that appears to be independent from the well-known association with the polymorphism of HLA class II genes. (J Clin Endocrinol Metab 91: 4107– 4111, 2006)
of the class II transactivator (CIITA), the master regulator for
HLA-D gene expression (reviewed in Ref. 3). In humans,
CIITA exhibits cell-specific, cytokine-inducible, and differentiation-specific expression and is expressed in the same
cells that express class II molecules, such as B cells, monocytes, dendritic cells, and activated T cells (4). The CIITA
gene, named MHC2TA, has been mapped to chromosome
16p13 and is characterized by the presence of several single
nucleotide polymorphisms (SNPs) in both the promoter type
III (responsible for constitutive CIITA expression in B cells)
and the coding sequence (5, 6). One such SNP, the ⫺168
A3 G in the human type III promoter (position ⫺168 from
translation start or ⫺155 from transcription initiation,
rs3087456) has recently been suggested to confer susceptibility to rheumatoid arthritis and multiple sclerosis (7). Polymorphisms in the CIITA gene have been shown to be weakly
associated with multiple sclerosis also in another report (8).
However, the results of other studies (6, 9, 10) do not appear
to support the hypothesis of a significant association between
MHC2TA gene polymorphism (and more specifically, the
⫺168 A3 G SNP) and the development of human autoimmune diseases.
4107
4108
J Clin Endocrinol Metab, October 2006, 91(10):4107– 4111
Primary adrenal insufficiency is classified as AAD in the
presence of adrenal cortex autoantibodies and/or steroid21-hydroxylase autoantibodies (11), but occasionally these
markers have also been detected in patients with clear signs
of posttuberculosis Addison’s disease (12). To optimize the
criteria for the etiological classification of primary adrenal
insufficiency, the Italian Addison Network (IAN) has recently developed a comprehensive flow chart that takes into
consideration autoantibody levels, imaging datam, and biochemical parameters (IAN Study 1) (13). The accurate reclassification of patients affected by AAD enabled the demonstration that both DRB1*03-DQA1*0501-DQB1*0201 and
DRB1*04-DQA1*0301-DQB1*0302 are positively associated
and DRB1*0403 is negatively associated with genetic risk for
AAD (IAN Study 2) (14).
With the aim of testing whether MHC2TA-168 A3 G SNP
is independently associated with AAD and/or modulates
the genetic risk conferred by DRB1-DQA1-DQB1 haplotypes,
we analyzed a large set of genomic DNA samples from AAD
patients and healthy control subjects from continental Italy,
enrolled by the Italian Addison Network. The results of our
study indicate that MHC2TA-168 A3 G SNP is positively
associated with genetic risk for AAD, independently from
HLA class II gene polymorphism.
Subjects and Methods
Subjects
Genomic DNA was obtained from 128 AAD patients and 406 healthy
control subjects. IAN includes 14 endocrinological centers located in
nine regions of continental Italy (13). Between January 1998 and December 2005, IAN has enrolled 322 patients with primary adrenal insufficiency. According to a recent update of diagnostic criteria for the
etiological classification of primary adrenal insufficiency (13) and based
on the combined use of immunological, biochemical, and clinical data,
220 cases (68%) were reclassified as AAD. Of these 220 cases, DNA was
available for the present study from 128. Of these 128 patients (median
age at diagnosis: 32 yr, range 8 – 69 yr; male to female ratio: 0.83), 65 (51%)
had other autoimmune diseases. APS I was excluded in all cases on the
basis of clinical manifestations, and no APS I patient was included in our
study.
Blood samples collected during routine analyses, between March
1994 and December 2001, were available from 406 unrelated healthy
control subjects (median age: 30 yr, range 5– 62 yr; male to female ratio:
1.14) with no family history of endocrine autoimmune diseases. All
patients and healthy individuals gave their informed consent for the
study, and the study was approved by the local ethics committee.
HLA-DR and -DQ genotyping
HLA-DR and -DQ genotyping was performed by sequence-specific
oligonucleotide-dot blot analysis with modifications of a previously
described method (15), and using sequence-specific oligonucleotides,
3⬘-end-labeled with digoxigenin (Roche Diagnostics S.p.A., Monza,
Italy). A chemiluminescent signal was generated by using alkaline phosphatase-labeled anti-digoxigenin (Roche Diagnostics S.p.A.) and disodium 3(4-methoxyspiro{1,2-dioxetane-3,2⬘-(5⬘-chloro)tricyclo[3.3.1.13,7]decan}-4-yl)phenyl phosphate (CSPD) (Roche Diagnostics S.p.A.).
Chemiluminescence was measured in a microplate scintillation and
luminescence counter (TopCount NXT; Packard Instrument Company,
Meriden, CT). Each membrane contained 10 control samples with
known HLA genotype.
HLA-DRB1*04 subtyping was performed by PCR-SSP with sequencespecific primers, according to the method described by Zetterquist and
Olerup (16).
Ghaderi et al. • MHC2TA SNP in Autoimmune Adrenal Insufficiency
Genotyping of MHC2TA ⫺168 A3 G (rs3087456) SNP by 5⬘
nuclease assay for allelic discrimination
The ⫺168 A3 G SNP of the MHC2TA gene (rs3087456) was selected
for genotyping. Taq-Man MGB biallelic discrimination system was used
as described earlier (17, 18). Probes and oligonucleotides were synthesized in 40⫻ concentrations by Applied Biosystems (Foster City, CA)
using the Assay-by-Design ordering system (Table 1). PCRs were performed on ABI prism Sequence Detection System 7000 (Applied Biosystems). The 25-␮l PCR contained 1⫻ of the TaqMan Universal PCR
Master Mix, No AmpErase UNG, 1⫻ of the assay probe and primer mix,
and 25 ng of genomic DNA and was performed on 96-well optical PCR
plates. Each genotyping plate contained no DNA template controls, and
random samples were run as duplicates to confirm the successful genotyping process. SDS version 2.0 software was used to analyze real-time
data and end-point fluorescence. Genotyping data were exported from
SDS software into Excel data sheets for further analysis.
Statistical analysis
The odds ratio (OR) was calculated according to Woolf (19) and
Miettinen (20). Differences in allele/haplotype/genotype frequencies
between patients and healthy control subjects were tested by the ␹2
method. Yates’ correction or the Fisher’s exact test was used when
necessary. For the HLA haplotyping and DRB1*04 subtyping, the probability values were corrected for the number of comparisons, according
to the number of HLA-DRB1,-DQA1,-DQB1 alleles or haplotypes observed. For the MHC2TA gene polymorphism analysis, both a codominant model and a G-dominant model were applied.
The association of the dichotomous variables presence/absence of
DQA1*0501-DQB1*0201, DRB1*0403, DQA1*0301-DQB1*0302, and
MHC2TA AG⫹GG with AAD, and its dependence on other variables
such as sex and age at diagnosis, was tested by multivariate logistic
regression analysis using SPSS for Windows (SPSS Inc., Chicago, IL). In
a separate analysis, MHC2TA AG⫹GG was substituted by the number
of G alleles (0, homozygous AA; 1, heterozygous A/G; 2, homozygous
G/G).
Deviations from the Hardy-Weinberg equilibrium were tested by
comparison of observed and expected genotype frequencies. Although
class II gene loci and MHC2TA gene locus are located on different
chromosomes, pairwise linkage disequilibrium was also tested by using
a permutation test using the EM algorithm. A P value ⬍0.05 was considered significant in all tests.
Results
Allele G of MHC2TA ⫺168 was found significantly increased in the group of AAD patients, being detected in 39%
AAD alleles and in 29% of healthy control alleles (P ⫽ 0.003)
(Table 2). Thus, allele G was detected in 49% of healthy
control subjects and in 62% of Addison patients (in either
heterozygous or homozygous combination). The frequency
of the AG⫹GG genotypes was significantly higher among
AAD patients than among healthy control subjects, in both
the codominant model (P ⫽ 0.012) and in the G-dominant
model [P ⫽ 0.018; OR ⫽ 1.66, 95% confidence interval (CI) ⫽
1.11–2.49]. This association was not influenced by the presence/absence of other autoimmune diseases as allele G frequency was similar in isolated Addison’s and in Addison’s
plus other autoimmune diseases (40 vs. 39%, respectively).
TABLE 1. TaqMan assay designed oligonucleotides and allelespecific MGB probes for MHC2TA, rs3087456 genotyping
Primer
Sequence
5⬘
3⬘
VIC
FAM
TCTTCACCAAATTCAGTCCACAGT
ACCCTCTAATTTTACCACACTCCCTTA
CCCTCCCTACACCTC
CTCCCCACACCTC
Ghaderi et al. • MHC2TA SNP in Autoimmune Adrenal Insufficiency
J Clin Endocrinol Metab, October 2006, 91(10):4107– 4111
4109
TABLE 2. Genotype and allele frequencies for the MHC2TA ⫺168 A3 G SNP (rs3087456) in AAD
Genotype frequencies
Allele frequencies
AAD
Healthy controls
Codominant model
G dominant model
A
G
MAF
P value
AA
AG
GG
P value
AA
AG ⫹ GG
P value
OR (95% CI)
n
156
576
100
236
0.391
0.291
0.003
49
206
58
164
21
36
0.012
49
206
79
200
0.018
1.66 (1.11–2.49)
128
406
MAF, Minor allele frequency.
The HLA genotyping of the AAD patients revealed that
only DRB1*03-DQA1*0501-DQB1*0201 (46% in AAD vs. 13%
in healthy control subjects, corrected P ⬍ 0.003) and
DRB1*04-DQA1*0301-DQB1*0302 (23% in AAD vs. 8% in
healthy control subjects, corrected P ⬍ 0.003) were positively
and significantly associated with AAD.
Among DRB1*04 subtypes, both DRB1*0401 and *0402
were more frequent among patients than among healthy
control subjects, but the differences did not reach the statistical significance after correction of the P value. Similarly
DRB1*0404 was not significantly more frequent among AAD
patients than among healthy control subjects. DRB1*0403
was absent among 30 AAD DRB1*04-positive patients, but
was the most frequent DRB1*04 allele detected in healthy
controls (28% of DRB1*04-positive individuals) (P ⬍ 0.003).
Pairwise linkage disequilibrium analysis, with a permutation test using the EM algorithm, showed no significant
linkage disequilibrium between MHC2TA AG or GG and
DRB1*03-DQA1*0501-DQB1*0201 or DRB1*04-DQA1*0301DQB1*0302 in either the patient or the control group. None
of the tested variables showed significant deviations from
Hardy-Weinberg equilibrium in any group.
To define better the independent contribution of MHC2TA
to genetic susceptibility for AAD, we then performed multivariate logistic regression analysis. When the variables
found associated at the univariate analysis were included as
variables in the model, they were all found independently
associated with AAD, after correction for age and sex (Table
3). Thus, MHC2TA AG⫹GG continued to be positively associated with genetic risk for the disease (P ⫽ 0.028, OR ⫽
1.72, 95% CI ⫽ 1.06 –2.78), even after correction for DRB1*03DQA1*0501-DQB1*0201, DRB1*04 (not 0403)-DQA1*0301DQB1*0302 and DRB1*0403. The association of the MHC2TA
SNP with AAD was also confirmed when the multivariate
logistic regression analysis took into consideration the number of G alleles (0, homozygous AA; 1, heterozygous A/G;
2, homozygous G/G) (P ⫽ 0.004; OR ⫽ 1.65, 95% CI ⫽
1.17–2.32). In addition, the correction for age and sex in the
multivariate analysis also excludes the possibility that the
association of MHC2TA with AAD was influenced by a
different sex distribution among patients and healthy control
subjects.
Consistently, when the frequency of the AG⫹GG genotypes was stratified for HLA class II genotyping, no significant differences were observed among the different subgroups as ⫺168 MHC2TA AG⫹GG were detected in 61% of
Addison patients negative for both HLA-DRB1*0301-DQA1*0501DQB1*0201 and DRB1*04-DQA1*0301-DQB1*0302, in 65% of patients positive for HLA-DRB1*03-DQA1*0501-DQB1*0201, and in
63% of patients positive for HLA-DRB1*04-DQA1*0301DQB1*0302 (P ⫽ not significant).
Discussion
Primary adrenal insufficiency occurs in approximately
1/7000 to 1/8000 subjects in Europe (21, 22). Around 70% of
cases have an autoimmune origin and are classified as AAD
(13), with an estimated prevalence of AAD in the general
population of 1/10,000 to 1/11,000. AAD represents a major
component of the so-called autoimmune polyglandular syndromes, and clinical or biochemical features of other endocrine or nonendocrine autoimmune diseases can be detected
in over 50% of AAD patients (11). It is not surprising that
AAD shares common genetic markers with other endocrine
autoimmune diseases, namely the HLA-DRB1*03-DQA1*0501DQB1*0201 and the DRB1*04-DQB1*0301-DQB1*0302 haplotypes. However, given the frequency of the “high-risk” HLA
haplotypes in the general population (approximately 20% of
individuals are positive for HLA-DRB1*03-DQA1*0501DQB1*0201 and/or DRB1*04-DQB1*0301-DQB1*0302 in central Italy), only a small minority of positive individuals will
develop the clinical signs of AAD. Accordingly, other genes (as
well as environmental factors) must play a role in modulating
the risk conferred by HLA class II genes. One such genetic factor
is the DRB1*0403 allele that confers dominant protection from
AAD even when part of the high-risk DRB1*04-DQA1*0301DQB1*0302 haplotype (IAN Study 2) (14). Other MHC and
non-MHC genes, such as MHC class I-chain related A (23, 24),
CTLA-4 (25) and vitamin D receptor (26) may also modulate the
genetic risk conferred by DR and DQ haplotypes. Thus, genetic
studies are deemed important for both unraveling the molecular mechanisms of the pathogenesis of endocrine autoimmune
diseases and identifying novel markers for the discrimination
of subjects genetically at high risk for AAD.
TABLE 3. Results of multivariate logistic regression analysis for association with AAD
Factors
Estimate
SE
DRB1*03-DQA1*0501-DQB1*0201
DRB1*04 (not 0403)-DQA1*0301-DQB1*0302
MHC2TA AG⫹GG
DRB1*0403a
1.508
1.329
0.540
ⱕ2.494
0.257
0.418
0.245
ND
Wald ␹
2
P value
OR (95%CI)
34.442
10.117
4.845
⬍5.27
⬍0.001
⬍0.001
0.028
⬍0.02
4.52 (2.73–7.47)
3.78 (1.66 – 8.56)
1.72 (1.06 –2.78)
⬍0.08 (0.01– 0.69)
ND, Not determinable.
a
Parameters for this allele could only be estimated because of the absence of DRB1*0403 among AAD patients.
4110
J Clin Endocrinol Metab, October 2006, 91(10):4107– 4111
Modulation of the expression of HLA class II determinants
in antigen-presenting cells may represent a critical factor in
the activation and maintenance of the organ-specific autoimmune process. All the classical and nonclassical class II
promoters contain three elements denominated S, X, and Y
boxes (27). The regulatory factor X (RFX) binds to the X1 and
S boxes, whereas the Y element is bound by the heterotrimer
nuclear factor Y (NF-Y)/CCAAT binding factor (28), and X2
by cAMP response element binding protein (29). However,
RFX and NF-Y are expressed constitutively, and their presence alone is not sufficient for the interferon-␥-inducible and
developmental expression of MHC II genes. Rather, the interaction of the NF-Y/cAMP response element-binding protein/RFX factors determines the formation of a platform for
the allocation and action of the CIITA transactivator, which
does not bind the DNA itself, but interacts with other DNAbinding proteins, directing the initiation and elongation of
MHC class II transcription (30, 31).
The role of CIITA as a master regulator of HLA-D expression provides a sound rationale for the study of MHC2TA
gene polymorphism and its association with the development of human autoimmune diseases. So far, SNPs have been
identified in the promoter type III (the ⫺168 A3 G SNP
analyzed in our present study), in the coding region and in
an intronic region at nucleotide 485 (5, 6), with no demonstrable linkage disequilibrium among them (5). The four
SNPs identified in the coding region of MHC2TA are either
silent (at nt 2509, 2536, and 2791) or responsible for a conservative alanine to glycine substitution at amino acid 500,
which provides a weak rationale for a role of these polymorphisms in genetic predisposition for human autoimmune diseases. The more recently identified SNP in an intronic region at nucleotide 485 has been demonstrated in only
3% of Japanese healthy subjects (6), and only the study of
several hundred AAD patients would exclude an association
between this specific SNP and human diseases. Accordingly,
we have chosen to test the association of the ⫺168 A3 G SNP
with AAD.
In our study with 128 AAD patients and 406 healthy subjects from continental Italy, we demonstrate the presence of
the ⫺168 A/G substitution in 49% of healthy individuals,
with a G allele frequency of 29%. These frequencies are in line
with those reported in other Caucasian populations (5, 7, 10),
whereas a lower frequency of the G allele has been observed
in the Japanese population (6). On the other hand, we found
the G allele in 62% of patients with AAD, representing 45%
of heterozygous subjects and 17% of homozygous subjects.
In a Swedish study from Swanberg et al. (7), the presence
of the MHC2TA G allele was significantly increased in patients with multiple sclerosis or rheumatoid arthritis. A subsequent study in a German population (10) failed to confirm
this association, opening a controversy on the actual role of
the MHC2TA gene polymorphism in genetic predisposition
for human autoimmune diseases. More recently, Koizumi et
al. (6) have studied the polymorphism of the MHC2TA gene
in 100 Japanese patients with systemic lupus erythematosus
and in 100 Japanese healthy control subjects, but have failed
to demonstrate any significant association of the tested SNPs
with this human disease. Our study provides the first data
on the association of the MHC2TA gene polymorphism with
Ghaderi et al. • MHC2TA SNP in Autoimmune Adrenal Insufficiency
an organ-specific, endocrine autoimmune disease, such as
AAD. Our data can be interpreted to indicate that the presence of the ⫺168 A3 G substitution is positively associated
with genetic risk for AAD, with an estimated OR of 1.65–1.7.
The significant association observed at the univariate analysis was confirmed in the multivariate logistic regression
analysis, which demonstrated that the significant increase of
the G allele among Italian AAD patients was not dependent
on the presence of DRB1*0301-DQA1*0501-DQB1*0201,
DRB1*04-DQB1*0301-DQB1*0302, or DRB1*0403. This conclusion is further supported by the absence of significant
linkage disequilibrium between the MHC2TA SNP in the
promoter type III region and the studied HLA class II
haplotypes.
At present, we cannot rule out the possibility that the
observed association between MHC2TA ⫺168 SNP and AAD
is a consequence of linkage disequilibrium with a yet unidentified predisposing gene on chromosome 16. However,
in vitro stimulation experiments (7) have shown that the
MHC2TA ⫺168 G/G genotype is associated with the reduced induction of HLA-DRA and HLA-DQA1 genes by
inflammatory stimuli, and it has been speculated that this
MHC2TA-associated reduction of expression of MHC molecules may influence the risk for the development of autoimmune and inflammatory diseases (7). Although this hypothesis has not yet been substantiated, our demonstration
that MHC2TA gene polymorphism is associated with genetic
risk for AAD paves the way to further genetic studies with
other human endocrine autoimmune diseases.
Acknowledgments
In addition to the authors, the following members of the Italian
Addison Network contributed to the collection of data and blood samples from patients with primary adrenal insufficiency: B. Ambrosi (Milan), A. Angeli (Orbassano), G. Arnaldi (Ancona), E. Arvat (Turin), A.
Baccarelli (Milan), L. Barbetta (Milan), P. Beck-Peccoz (Milan), A. Bellastella (Naples), A. Bizzarro (Naples), M. Boscaro (Ancona), F. Cavagnini (Milan), C. Dal Prà (Padova), F. Dotta (Siena), E. Ghigo (Turin), R.
Giordano (Turin), S. Laureti (Perugia), R. Libè (Milano), F. Loré (Siena),
M. Mannelli (Florence), F. Mantero (Padova), G. Mantovani (Milan), P.
Paccotti (Orbassano), R. Perniola (Lecce), F. Santeusanio (Perugia), C.
Tiberti (Rome), P. Toja (Milan), M. Torlontano (S. Giovanni Rotondo), V.
Toscano (Rome), V. Trischitta (S. Giovanni Rotondo), and R. Zanchetta
(Padova).
Received April 20, 2006. Accepted July 11, 2006.
Address all correspondence and requests for reprints to: Alberto
Falorni, M.D., Ph.D., Department of Internal Medicine, Section of Internal Medicine and Endocrine and Metabolic Sciences, Via E. Dal Pozzo,
06126 Perugia, Italy. E-mail: [email protected].
References
1. Robles DT, Fain PR, Eisenbarth GS 2002 The genetics of autoimmune polyendocrine syndrome type II. Endocrinol Metab Clin N Am 31:353–368
2. Betterle C, Greggio NA, Volpato M 1998 Clinical review 93: autoimmune
polyglandular syndrome type 1. J Clin Endocrinol Metab 83:1049 –1055
3. LeibundGut-Landmann S, Waldburger JM, Krawczyk M, Otten LA, Suter T,
Fontana A, Acha-Orbea H, Reith W 2004 Specificity and expression of CIITA,
the master regulator of MHC class II genes. Eur J Immunol 34:1513–1525
4. Harton JA, Ting JP 2000 Class II transactivator: mastering the art of major
histocompatibility complex expression. Mol Cell Biol 20:6185– 6194
5. Patarroyo JC, Stuve O, Piskurich JF, Hauser SL, Oksenberg JR, Zamvil SS
2002 Single nucleotide polymorphisms in MHC2TA, the gene encoding the
MHC class II transactivator (CIITA). Genes Immun 3:34 –37
6. Koizumi K, Okamoto H, Iikuni N, Nakamura T, Kawamoto M, Momohara
S, Ichikawa N, Furuya T, Kotake S, Taniguchi A, Yamanaka H, Kamatani N
Ghaderi et al. • MHC2TA SNP in Autoimmune Adrenal Insufficiency
7.
8.
9.
10.
11.
12.
13.
14.
15.
2006 Single nucleotide polymorphisms in the gene encoding the major histocompatibility complex class II transactivator (CIITA) in systemic lupus erythematosus. Ann Rheum Dis 64:947–950
Swanberg M, Lidman O, Padyukov L, Eriksson P, Akesson E, Jagodic M,
Lobell A, Khademi M, Borjesson O, Lindgren CM, Lundman P, Brookes AJ,
Kere J, Luthman H, Alfredsson L, Hillert J, Klareskog L, Hamsten A, Piehl
F, Olsson T 2005 MHC2TA is associated with differential MHC molecule
expression and susceptibility to rheumatoid arthritis, multiple sclerosis and
myocardial infarction. Nat Genet 37:486 – 494
Rassmussen HB, Kelly MA, Clausen J 2001 Genetic susceptibility to multiple
sclerosis: detection of polymorphic nucleotides and an intron in the 3⬘ untranslated region of the major histocompatibility complex class II transactivator gene. Hum Immunol 62:371–377
Sartoris S, Brendolan A, Degola A, Testi MG, Chignola R, Scarpa A, Scardoni
M, Contreas G, Pinelli L, Lunardi C, Beri R, Pera C, Ferrara GB, Riviera AP,
Tridente G, Andrighetto G 2000 Analysis of CIITA encoding AIR-1 gene
promoters in insulin-dependent diabetes mellitus and rheumatoid arthritis
patients from the northeast of Italy: absence of sequence variability. Hum
Immunol 61:599 – 604
Akkad DA, Jagiello P, Szyld P, Goedde R, Wieczorek S, Gross WL, Epplen
JT 2006 Promoter polymorphism rs3087456 in the MHC class II transactivator
gene is not associated with susceptibility for selected autoimmune diseases in
German patient groups. Int J Immunogenet 33:59 – 61
Falorni A, Laureti S, Santeusanio F 2002 Autoantibodies in autoimmune
polyendocrine syndrome type II. Endocrinol Metab Clin N Am 31:369 –389
do Carmo Silva R, Kater CE, Dib SA, Laureti S, Forini F, Cosentino A, Falorni
A 2000 Autoantibodies against recombinant human steroidogenic enzyme
21-hydroxylase, side-chain cleavage and 17␣-hydroxylase in Addison’s disease and autoimmune polyendocrine syndrome type III. Eur J Endocrinol
142:187–194
Falorni A, Laureti S, De Bellis A, Zanchetta R, Tiberti C, Arnaldi G, Bini V,
Beck-Peccoz P, Bizzarro A, Dotta F, Mantero F, Bellastella A, Betterle C,
Santeusanio F 2004 Italian Addison Network study: update of diagnostic
criteria for the etiological classification of primary adrenal insufficiency. J Clin
Endocrinol Metab 89:1598 –1604
Gambelunghe G, Kockum I, Bini V, De Giorgi G, Celi F, Betterle C, Giordano R, Libè R, Falorni A 2005 Retrovirus-like long-terminal repeat DQ-LTR13
and genetic susceptibility to type 1 diabetes and autoimmune Addison’s disease. Diabetes 54:900 –905
Gambelunghe G, Ghaderi M, Tortoioli C, Falorni A, Santeusanio F, Brunetti
P, Sanjeevi CB, Falorni A 2001 Two distinct MICA gene markers discriminate
major autoimmune diabetes types. J Clin Endocrinol Metab 86:3754 –3760
J Clin Endocrinol Metab, October 2006, 91(10):4107– 4111
4111
16. Zetterquist H, Olerup O 1992 Identification of the HLA-DRB1*04, -DRB1*07,
and -DRB1*09 alleles by PCR amplification with sequence-specific primers
(PCR-SSP) in 2 hours. Hum Immunol 34:64 –74
17. Livak KJ, Marmaro J, Todd JA 1995 Towards fully automated genome-wide
polymorphism screening. Nat Genet 9:341–342
18. De La Vega FM, Lazaruk KD, Rhodes MD, Wenz MH 2005 Assessment of two
flexible and compatible SNP genotyping platforms: TaqMan SNP genotyping
assays and the SNPlex genotyping system. Mutat Res 573:111–135
19. Woolf B 1995 On estimating the relation between blood group and disease.
Ann Hum Genet 19:251–253
20. Miettinen OS 1976 The estimability and estimation in case-referent studies.
Am J Epidemiol 103:226 –235
21. Laureti S, Vecchi L, Santeusanio F, Falorni A 1999 Is the prevalence of
Addison’s disease underestimated? J Clin Endocrinol Metab 84:1762
22. Lovas K, Husebye ES 2002 High prevalence an increasing incidence of Addison’s disease in western Norway. Clin Endocrinol (Oxf) 56:787–791
23. Gambelunghe G, Falorni A, Ghaderi M, Laureti S, Tortoioli C, Santeusanio
F, Brunetti P, Sanjeevi CB 1999 Microsatellite polymorphism of the MHC class
I chain-related (MIC-A and MIC-B) genes marks the risk for autoimmune
Addison’s disease. J Clin Endocrinol Metab 84:3701–3707
24. Barker JM, Ide A, Hostetler C, Yu L, Miao D, Fain PR, Eisenbarth GS,
Gottlieb PA 2005 Endocrine and immunogenetic testing in individuals with
type 1 diabetes and 21-hydroxylase autoantibodies: Addison’s disease in a high
risk population. J Clin Endocrinol Metab 90:128 –134
25. Kemp EH, Ajjan RA, Husebye ES, Peterson P, Uibo R, Imrie H, Pearce SH,
Watson PF, Weetman AP 1998 A cytotoxic T lymphocyte antigen-4 (CTLA-4)
gene polymorphism is associated with autoimmune Addison’s disease in
English patients. Clin Endocrinol (Oxf) 49:609 – 613
26. Pani MA, Seissler J, Usadel KH, Badenhoop K 2002 Vitamin D receptor
genotype is associated with Addison’s disease. Eur J Endocrinol 147:635– 640
27. Ting JP, Trowsdale J 2002 Genetic control of MHC class II expression. Cell
109:S21–S33
28. Maity SN, de Crombrugghe B 1998 Role of the CCAATT-binding protein
CBF/NF-Y in transcription. Trends Biochem Sci 23:174 –178
29. Moreno CS, Beresford GW, Louis-Plence P, Morris AC, Boss JM 1999 CREB
regulates MHC class II expression in a CIITA-dependent manner. Immunity
10:143–151
30. Fontes JD, Kanazawa S, Nekrep N, Peterlin BM 1999 The class II transactivator CIITA is a transcriptional integrator. Microbes Infect 1:863– 869
31. Kanazawa S, Okamoto T, Peterlin BM 2000 Tat competes with CIITA for the
binding to P-TEFb and blocks the expression of MHC class II genes in HIV
infection. Immunity 12:61–70
JCEM is published monthly by The Endocrine Society (http://www.endo-society.org), the foremost professional society serving the
endocrine community.