Download Student

Integrated General
Biology
A Contextualized Approach
Active Learning Activities
FIRST EDITION
Jason E. Banks
Julianna L. Johns
Diane K. Vorbroker, PhD
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
Chapter 8 Protein Synthesis, DNA, and the Cell Cycle
Section 8.1 The Story of Our Lives
Directions for
the Student:
This lesson is designed for you to complete, on your own or in your study group. Use
your notes and follow along in the text, as you find necessary.
Objectives:
1. Identify DNA as the macromolecule that contains instructions for protein
formation and heredity in a cell.
2. Describe the structure of DNA as a twisted double helix.
3. Describe DNA as a polymer of nucleotides.
4. Identify the three parts of a nucleotide: a sugar, a phosphate group and a
nitrogenous base.
5. Identify and properly combine the four nitrogenous bases found on DNA: adenine,
thymine, cytosine and guanine.
The cell theory, formulated in the 1800s stated, among other things, that cells are the basic structure of
living things, and all cells come from other cells. That might sound obvious today, but before rigorous
testing and the invention of things like the microscope, the basic ideas of cells didn’t exist.
Not long after cells were described, scientists began to investigate the parts of cells, and the role of each
macromolecule in a cell. A hot debate in the early 1900s existed over whether proteins or nucleic acids
were the “information carrying” (genetic) macromolecules.
1. Answer these question about how it was proven that nucleic acids are the information-containing
molecules of cells.
What two scientists did an experiment using
bacteriophage viruses to prove that nucleic acids
are the genetic material?
Hershey and Chase
How did these scientists “mark” nucleic acids and
proteins?
radioactive sulfur marked the proteins, radioactive
phosphorous marked the nucleic acids
2. At the same time that the function of nucleic acids and proteins was being debated, other scientists
were studying the structures.
What scientist performed critical experiments
using X-ray crystallography to describe nucleic
acids?
Rosalind Franklin and her student, with Maurice
Wilkins
What two scientists are credited with being first to James Watson and Francis Crick
accurately describe DNA as a double-helix
structure?
The Story of Our Lives
2
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
The fact that nucleic acids are hereditary, or genetic material was published and accepted in 1952. The
general chemical structure and shape of DNA was published and accepted in 1953.
Nucleic acids are found in the nucleus of eukaryotic cells, which is where they were first discovered and
why they are called nucleic acids. But, nucleic acids are also found in prokaryotic cells (prokaryotic cells
don’t even have a nucleus), and they are found in things that are not considered to be alive, like viruses.
3. Since we are focused on eukaryotic cells and their nucleic acids, answer the following questions.
What are the two types of nucleic
acids?
The two nucleic acids are deoxyribonucleic acid (DNA) and
ribonucleic acid (RNA).
Which nucleic acid can leave the
nucleus and which nucleic acid cannot
leave the nucleus?
DNA is too large to leave the nucleus, but RNA is smaller and
can leave the nucleus.
All forms of nucleic acids are polymers. Some are extremely long; others are relatively short.
4. What are the monomers for the
polymers known as nucleic acids?
The monomers for nucleic acids are nucleotides.
5. Nucleotides are complex monomers. Label the three main parts of this nucleotide.
A
phosphate group
B
sugar
C
nitrogenous base
Which one of the parts of a nucleotide is different in
RNA and DNA? (represented by the “R” and “D” in
their names)
the sugar- it’s deoxyribose in DNA and ribose
in RNA
Which one of the parts has 4 variations in RNA and 4
variations in DNA?
the nitrogenous base
The Story of Our Lives
3
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
The definition of a polymer is that it is composed of a series of monomers that are linked together. In
DNA the linkage involves two of the three parts of a nucleotide.
The pattern of phosphate bonded sugar
Each carbon in deoxyribose can be numbered, to show
bonded to the next phosphate is considered how the polymer backbone is held together. A
the backbone of a DNA strand.
phosphate is bonded to the 5’ (“5-prime”) carbon of a
nucleotide. The 3’ carbon of the sugar is in the ring.
6. Check your understanding of two of the parts of a nucleotide.
How many carbon molecules are in deoxyribose?
What is the chemical formula for deoxyribose?
it is a pentose; 5 carbons- C5H1004
Which carbon is bonded to the phosphate group
of a nucleotide?
The 5’ carbon
What 3- word term describes the chain of linkages sugar-phosphate backbone
that hold nucleotides together in a polymer?
Which part of a nucleotide is not involved in the
covalent bonds between nucleotides?
the nitrogenous base
Do the sugar and phosphate parts of a nucleotide
contain the genetic information (the code)?
No
The Story of Our Lives
4
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
In English, we read the words on a page from left to right, but did you know that in Chinese the page is
read from right to left? DNA is the “story of your life” because it contains the information to tell a cell
how to make you. The orientation of the sugar-phosphate backbone in a DNA strand is important
because DNA must be read in a specific direction. As you will see in another section, the language of
DNA is read by enzymes in one direction only, from the 5’ to 3’ end.
The information contained in DNA or RNA is actually held in the part of a nucleotide known as a
nitrogenous base. Nitrogenous, because they contain many nitrogen atoms, and base because all those
nitrogen atoms give the molecule the properties of a base. There are 4 standard nitrogenous bases in
DNA and 4 in RNA.
7. Review the types of nitrogenous bases.
Which bases are
known as
purines?
adenine and guanine
Which bases are
pyrimidines?
cytosine, uracil, thymine
Which bases are
found in DNA?
Adenine, guanine,
cytosine, thymine
Which bases are
found in RNA?
adenine, guanine,
cytoside, uracil
What does the
letter “R”
represent on the
bases (or the
squiggly line on
the pair of bases
on the left?
These represent the
other part of a
nucleotide, the sugar
which is attached to a
phosphate.
Nitrogenous bases can pair with each other. In DNA the two sugar-phosphate backbones are held
together by the pairing of nitrogenous bases, if the sequence of bases is compatible.
The Story of Our Lives
5
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
8. How do nitrogenous bases pair up?
When nitrogenous bases pair up, do they pair
purine (2 rings) to pyrimidines (1 ring)
purine-to-purine and pyrimidine-to-pyrimidine, or
purine-to-pyrimidine?
Which nitrogenous base(s) can adenine pair with? thymine and uracil
Which nitrogenous base(s) can guanine pair with? cytosine
Which nitrogenous base(s) can uracil pair with?
adenine
What type of chemical bond holds two
nitrogenous bases together? Are they weak or
strong bonds?
hydrogen bonds, they are weak bonds
The way the nitrogenous
bases reach out to each
other causes them to be in
be in pairs; thus they are
called base pairs. This is
especially true in DNA, which
is usually double stranded.
If you look closely at the
picture showing the two
strands of DNA, you should
be able to pick out the sugar,
phosphate, and nitrogen
base part of each nucleotide.
Also, notice that there are
different bonding patterns
between each nitrogen base
pair- some have 2 dotted
lines, some have 3. This is
because of the way the
atoms can line up with each
other. It also means that the
bond between one pair is
stronger than the other pair.
This actually is important
when enzymes need to
“read” the DNA.
The Story of Our Lives
6
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
9. Closely examine the figure showing a double-stranded DNA molecule, and use the nitrogenous base
structure pictures to help with these questions.
How many base pairs are shown?
four
On each strand, label the 5’ and 3’ ends of
the sugar-phosphate backbone.
top left 5’, bottom left 3’
top right 3’, bottom right 5’
What term describes the way the two
antiparallel
strands are oriented opposite of each other?
What is the base pair sequence from top to
bottom (use single letters)?
TOP: A-T then C-G then G-C then T-A (bottom)
A, G, C, and T are the letters that are used to represent the information that is in DNA. Just like the order
of the letters of the English alphabet can come together to make words and sentences with a wide range
of meanings, these nitrogen-containing bases can come together in different orders to store information
to create different genes.
10. The last step in understanding DNA is learning how the DNA ladder is shaped.
What term is used to describe the twisted shape of a
double strand of DNA?
double helix
There is enough DNA in a human cell to, stretched
end-to-end, measure 6 feet long. How is it
compacted enough to fit into a tiny nucleus?
it is coiled tightly around a type of protein
known as histones
The molecular structure of DNA is intricate, specific, and elegant. It carries the story of your life (at least
your body!) But the way it functions in a cell is even more amazing!
The Story of Our Lives
7
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
Section 8.2 Making More DNA
Directions for
the Student:
This lesson is designed for you to complete, on your own or in your study group. Use
your notes and follow along in the text, as you find necessary.
Objectives:
1. Identify the purpose of DNA Replication
2. Describe the basic steps of DNA Replication and the enzymes that perform those
steps.
3. Explain why DNA Replication happens in two directions.
4. Define the term semi-conservative.
Stop and think about what your body is made of. Think beyond the big parts like arms, legs, or organs
and imagine down to the cellular level. It is estimated that we have 37.2 Trillion cells in our bodies. If you
drew a box on your skin that is 1-inch square, you would be looking at 3 million cells, not to mention the
nerves, blood vessels, sweat glands, heat and cold sensors that are there. Every one of those cells, with
the exception of red blood cells and dead cells, has a nucleus packed full of chromatin (DNA). But each
one of us started life as ONE cell, with one nucleus and one set of chromosomes. Each cell has
approximately 3 billion base pairs of DNA.
1. Put the number of cells in our body and the
number of base pairs per cell into scientific
notation.
3.72 x 1013
2. Use scientific notation to show how many
base pairs of DNA are in the human body.
1.116 x 1023 reduced from 11.16 x 10 22
3 x 109
3 x 3.72 = 11.16; add the exponents
In early research into the structure of DNA, one of the things scientists were looking for was a structure
that was easily copied by a cell. How does a DNA double helix satisfy this requirement?
3. If you know the sequence of one of the DNA
strands, do you know the other? Why?
Yes, because of base pairing rules
4. What type of bonds hold the two strands of
DNA together, and are they weak or strong
bonds?
hydrogen bonds (hold nitrogenous bases
together) and they are weak individually
Sometimes it’s useful to think of double-stranded DNA as a zipper- the stitching that holds the zipper to
the fabric is the sugar-phosphate backbone. The “teeth” of the zipper are the nitrogenous bases
reaching across to each other.
Making More DNA
8
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
5. Answer these questions about the general idea of copying DNA.
What is the name of the process that copies DNA? DNA replication
In your own words, what is a template?
answers will vary; a model or starting point, a
pattern to follow
Are there little “men” in our cells? What will do
the “work” of copying the DNA?
enzymes
Where in the cell is DNA copying taking place?
nucleus
In which cell cycle phase does copying take place? S or Synthesis phase (part of Interphase)
The two strands of a DNA double helix are known as complementary- they match up according to the
rules of base pairing. When DNA is copied, the new strand that is formed is complementary to the
strand that is being read, which is known as the template strand. Since this happens on both strands at
the same time, two identical copies of the original DNA double helix are made.
6. Answer these questions about opening up a double helix.
First, the double helix needs to be opened up, or
unzipped. What enzyme does this?
DNA helicase
What bonds is the enzyme breaking (temporarily)?
hydrogen bonds between nitrogenous bases
The DNA is opened small sections at a time, not from one end to the other. Each of the starting points is
known as an Origin of Replication. In long linear chromosomes, origins are spread out along the length
of the chromosome. In circular chromosomes, like in prokaryotic cells, there is just one. The “opening”
that has been created is known as the replication fork.
Making More DNA
9
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
The amazing thing about the process of copying DNA is that it is all chemistry; many different proteins
come in and perform specific functions by recognizing the chemical signature of the DNA. In other
words, DNA is the substrate. Since DNA prefers to be in a double helix, it will try to join back together.
But during replication, a part of the double helix needs to remain open for the two strands to be read
and copied. After helicase has opened a small section, a group of small proteins coat the DNA to block it
from closing up (called single strand binding proteins). Other proteins make sure the DNA in front of the
helicase does not get tangled. You may have experienced something like this yourself- by trying to
separate a piece of yarn for example. If you take the two or three strands that make up a piece of yarn
or rope and start to pull them apart, that is like a replication fork. But as you keep pulling, the area that
is still together will start the tighten up and eventually will block your “fork.” The enzyme topoisomerase
spins the DNA double helix in front of the helicase so DNA doesn’t get tangled during replication
Now that a single strand of DNA has been exposed, the next step is to make the complementary copy.
7. Review how this is done with these questions:
What enzyme reads the template strand and creates
the new strand?
DNA polymerase
If the enzyme sees an adenine in the template, what
nucleotide will it put into the new strand?
thymine
If the enzyme sees a thymine in the template, what
nucleotide will it put into the new strand?
adenine
If the enzyme sees a cytosine in the template, what
nucleotide will it put into the new strand?
guanine
What is the enzyme “grabbing” to add onto the
growing DNA strand?
free nucleotides that have been synthesized and
are floating around the nucleus
The polymerase enzyme that actually makes the copies will only do its job if there is a double strand to
start with though, so, before it can start, a short complementary RNA piece is made by the enzyme DNA
primase. This temporary DNA:RNA primer section is enough to satisfy the enzyme, and let it start
making the DNA copy.
In DNA Replication, both strands are being copied at the same time. But they are copied in different
directions. Therefore, DNA Replication is known as bi-directional.
Making More DNA
10
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
8. Demonstrate that you understand bidirectional replication.
What characteristic of DNA causes the problem
that makes DNA Replication bidirectional?
DNA has antiparallel orientation- 5’ to 3’ on one
strand but 3’ to 5’ on the other strand.
Which letter is labeling the strand that is copied
continuously? What term describes this copying
strand, and in what direction is the new strand
being synthesized?
A -The leading strand, making a strand 5’ to 3’
What letter is marking, and what term describes, C- The lagging strand
the strand that is copied in the opposite direction,
in small discontinuous sections?
What name is given to the small sections on the
discontinuous strand? Which letter is pointing to
those small sections?
B- Okazaki fragments
DNA replication happens in both directions from a replication fork, from the origin(s) of replication. But
the fragments that are created on the discontinuous strand and the long sections that are made on the
leading strand are not connected to each other.
9. What enzyme will connect all of the pieces?
DNA ligase
Making More DNA
11
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
The numbers in this Replication diagram are indicating some of the important enzymes and pieces that
are involved.
10. Use the replication diagram to complete the chart.
Chart #
Name
1 (strand)
Lagging strand
2 (strand)
Leading strand
3 and 8 (making new strands)
4 (connecting new pieces)
DNA polymerase
DNA ligase
5
free nucleotide
6
RNA primase
7
Okazaki fragment
9 (opening the fork)
DNA helicase
10
single strand binding proteins (protect from the double helix zipping
closed)
11
DNA topoisomerase (keeps the DNA double helix from getting overwound and tangled in front of the fork)
As a replication fork proceeds and new double stranded sections are completed, notice that the new
DNA is closed and twists into a double helix immediately. This is a more stable state for the DNA, and
Making More DNA
12
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
the bonds between the nucleotides on each strand are immediate. Each “bubble” of DNA replication
continues until it runs into the next one. Then the two sections are linked together, and the enzymes
that have been attached to the double helix are released.
Recall that, in prokaryotes, the chromosome is circular and there is one origin of replication. So, when
the two directions of synthesis run into each other halfway around the circle, replication is complete.
Two complete circles of double helix DNA fall apart, and the cell is ready to divide.
In eukaryotes, however, with linear chromosomes, the two pieces of DNA stay together.
11. What holds the two strands together in a
chromosome?
the centromere
12. In your own words, describe the term ‘semiconservative’ replication.
each new double-stranded DNA molecule is
made up of one old, or original strand and one
newly synthesized strand. Half of the old strand
was “saved”
Overall, the Replication of DNA seems pretty simple, and it is in a
lot of ways. It can be broken down into a few stages: Initiation,
Elongation, and Termination. Sometimes DNA Replication is
referred to as a bio-machine. The steps and enzymes come
together into a series of intricate steps, whirling swiftly down the
open double helix. The rate of DNA synthesis is very fast, up to
1000 base pairs per second. That’s a fast machine!
It’s very important that DNA Replication goes perfectly. But the
speed of allows DNA polymerase to make mistakes. It is
estimated that it pairs up the wrong nucleotide once in every one
million base pairs. But “DNA polymerase” is actually a complex of
several peptides, and each peptide has its own job. One of the
peptides actually “proofreads” what nucleotide was added, and
can stop replication very briefly to make DNA polymerase correct
the mistake. If it doesn’t, a mutation may occur.
The next step in the cell cycle will be to accurately separate the
duplicated chromosomes, which we will cover in another section.
Making More DNA
13
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
Section 8.3 Central Dogma
Directions for
the Student:
This lesson is designed for you to complete, on your own or in your study group. Use
your notes and follow along in the text, as you find necessary.
Objectives:
1. Explain the steps of protein synthesis, including transcription and translation.
2. Be able to compare and contrast DNA and RNA molecules
3. Describe and be able to use the genetic code while being able to identify the start
and stop codons
The general flow of information within organisms is shown below. This is known as the "central dogma
of biology." The word ‘dogma’ comes from a Greek word that means “that which is known to be true.”
DNA  RNA  Protein
Information from DNA is transferred to RNA and then from RNA to protein.
As you may remember, proteins are an important molecule in biology.
1. Draw an example of a protein below and describe its function.
Picture:
Varies
An example would be hemoglobin, could be a nondescript shape but holding an iron
atom and oxygen
Function:
Depends upon the picture
Hemoglobin-carries oxygen through the body.
Central Dogma
14
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
Let’s back up and review macromolecules. Below are two molecules that should be familiar to you.
2. Identify each of these molecules. (Use additional resources, as necessary.)
Molecule Name: Amino Acid
Molecule Name: Nucleotide
Amino acids and nucleotides can both exist in the monomer form shown above but they can both also
form polymers.
3. Using the information you see in each molecule, answer the following questions.
Which type of macromolecule
(polymer) is made from the monomer
shown on the right?
Nucleic acids, or DNA and RNA
Which type of macromolecule
(polymer) is made from the monomer
shown on the left?
A polypeptide or protein
(polypeptide refers to the primary structure, the polymer;
protein can be used to refer to a polypeptide or a complete
protein (in its quaternary form)
The ability to store and access information is absolutely critical for the survival and reproduction of cells
and organisms. The integrity of the information must be maintained or the cells will not be able to
effectively manufacture products and maintain homeostasis.
4. Which of the biological polymers is responsible
primarily for information storage?
DNA
5. Which of the biological polymers has the most
diverse functions such as support, movement,
metabolic regulation, and defense?
Proteins
Central Dogma
15
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
RNA is a nucleic acid that is very similar to DNA.
6. Using the picture and your
textbook, identify three
differences between DNA
and RNA.
1) RNA uses uracil instead of thymine.
2) DNA contains Deoxyribose while RNA contains ribose as the
sugar.
3) DNA is usually double stranded and RNA is usually single
stranded.
The first half of the Central Dogma is:
DNA  RNA
DNA stores the instructions for proteins. There is an intermediate step between DNA and protein.
7. What is the name of the process
that creates this intermediate
polymer and what molecule is
made?
Transcription is the process, and it makes a mRNA
Central Dogma
16
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
All RNA is derived from DNA. The RNA is made as a complementary copy of the template strand, and its
synthesis is very similar to what happens in DNA replication.
8. Examine this overview of transcription to answer the questions.
What enzyme complex is making the RNA transcript?
RNA polymerase
In what part of the cell does Transcription take place?
in the nucleus
Don’t worry about the terms antisense and sense, they the antisense (top) strand
are too technical for this course. But, in this picture,
which strand is what we would call the “template
strand,” the ‘antisense,’ or ‘sense’ strand?
Look at the sequence of bases carefully. Is the RNA
transcript complementary to, or the same as the top
‘antisense’ strand?
complementary to the antisense (TEMPLATE)
strand
Compare the RNA transcript to the bottom ‘sense’
strand- are they different, and if so how?
they are the same sequence except all the Ts
in the DNA are replaced with a U
Once the RNA is made, what will happen to the DNA
double helix?
the double helix will close back up- RNA
transcription is like a bubble in the middle of a
chromosome
Central Dogma
17
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
What are two differences between Replication and
Transcription?
RNA polymerase vs DNA polymerase
Replication makes DNA, Transcription makes
RNA
RNA does not stay attached like the newly
synthesizes DNA does in Repl.
In some ways, DNA is like a hard drive on a computer where all of your files are stored. Messenger RNA
is like a flash drive that you store only the files that are important for the short-term task. DNA stores all
of the instructions for the proteins, and mRNA is created by base pairing with an active DNA strand. An
RNA transcript is a copy of a specific section of DNA that codes for a specific product, not all 3 billion
base pairs (in humans). RNA takes the message to where it needs to go, and in the case of making
proteins, that is to the ribosomes.
The second part of the Central Dogma is:
RNA  Protein
Many different parts have to come together to decode the RNA into a protein. Ribosomes are like little
machines that perform the specific task of matching up two types of RNA: tRNA and mRNA. The product
of the ribosome machine is a polypeptide, or polymer of amino acids (also known as a protein!).
9. Answer these questions to test your understanding of protein synthesis on a ribosome.
What do the “t” and “m” stand for in tRNA and transfer RNA and messenger RNA
mRNA?
What is the job of the tRNA?
bring amino acids to match up with mRNA codons
Use your textbook as a reference to name the A. Messenger RNA (mRNA)
structures in this image of an active ribosome. B. Transfer RNA (tRNA)
C. Ribosome
D. Growing Protein
E. free Amino Acids
Central Dogma
18
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
Why is this process of protein synthesis
sometimes called "translation"? (Which
languages are involved?)
Translation is occurring between the language of
nucleotides to the language of amino acids.
On which of the molecules in the image would Codons are found on mRNA., which is labeled “A”
we find the codon?
(pink)
How many nucleotides are read together (at
one time) in a codon during translation?
Three together, in a codon
What does one codon correspond to in a
protein?
Each codon corresponds to a particular amino acid.
During this process of protein synthesis, amino acid monomers are being attached together by covalent
bonds. This process requires an energy input.
10. Is protein synthesis anabolic or
catabolic?
Anabolic
11. Where does the energy to fuel
protein synthesis come from?
(Include the name of the
molecule.)
Catabolism. During cellular respiration glucose is broken down
and energy is released and captured by the cell.
The triplets, or codons on an mRNA molecule are read in succession to put together the correct order of
amino acids in the new protein. Researchers have estimated that the DNA in our cells makes over
25,000 different proteins. There are twenty different amino acids that can put together in different
sequences, proportions and lengths to make many different proteins.
12. What makes one protein different
from another?
All proteins are chains of amino acids. The order of these
amino acids and lengths of the chain vary among different
types of protein. Also, the three-dimensional shape of proteins
is greatly affected by the order of the amino acids and length
of the chains.
13. What is the name for a section of
This unit is known as a gene.
nucleotides that is transcribed as a
unit and makes a single protein?
Central Dogma
19
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
This figure summarizes the two-step
process that makes a protein. This
process is constantly happening in every
cell in your body, to make the proteins
that give your cells structure, enzymes
that break down nutrients into energy,
and proteins that act as transporters
across membranes, to name a few
examples. Transcription and translation
even make the proteins that DO
transcription and translation! Once the
linear sequence of a protein has been
made, it is released from the ribosome
and folds to create a 3-dimensional
shape. The amino acids in the protein
determine the shape, and the shape
determines what function the protein will
perform.
Practice the Central Dogma
During transcription, the DNA double helix is unzipped and the template strand is copied to produce the
mRNA. The mRNA is complementary to the DNA template strand, except that the mRNA will contain
Uracil in place of Thymine.
14. Practice transcribing these triplets of DNA nucleotides.
What mRNA codon is transcribed from the DNA
sequence TTG ?
the mRNA would contain AAC
What mRNA codon is transcribed from the DNA
sequence TAC?
the mRNA would contain AUG
What mRNA codon is transcribed from the DNA
the mRNA would contain GGU
sequence CCA ?
15. Transcribe this short sequence, which has been split into triplets for you:
TACCCCGATTTACCTGGGAAC
DNA:
TAC
CCC
GAT
TTA
CCT
GGG
AAC
mRNA:
AUG
GGG
CUA
AAU
GGA
CCC
UUG
The genetic code is a sort of answer key to determine what amino acid each nucleotide codon will
produce during translation. Once the codon sequence of a gene is determined, the sequence of amino
Central Dogma
20
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
acids in a protein can be determined. There are 64 different codons, thus each amino acids matches up
with many codons. Find a genetic code chart online or in your textbook to do the part of a ribosome.
16. Determine the amino acids that are coded for by this mRNA: AUGGGGCUAAAUGGACCCUUG (It has
been separated into codons for you below.)
mRNA:
AUG
GGG
CUA
AAU
GGA
CCC
UUG
amino
acid:
methionine
glycine
leucine
asparagine
glycine
proline
leucine
There are a few special codons in the genetic code, like the Start and Stop codons. During translation,
when a ribosome reads the Start codon, it knows to start adding amino acids. The tRNA that has the
amino acid methionine attached to it enters the ribosome, then the next codon is read to bring in the
next amino acid, and so on. Methionine is temporarily at the beginning of every protein, but it can also
be anywhere else in a protein. When the ribosome reads a Stop codon, it stops adding amino acids and
releases the mRNA and the new protein, so that no more amino acids are added.
17. Practice transcribing and translating again using the DNA sequence below.
DNA
template
TAC
AAA
TGA
CTA
TAC
ACT
GTT
TCC
transcribed AUG
mRNA:
UUU
ACU
GAU
AUG
UGA
CAA
AAG
leucine
asparagine methionine STOP
translated methionine glycine
amino
acid:
not
not
translated translated
Did you make a short peptide containing five amino acids?
Proteins come in all different lengths and shapes. A gene can range from 200 to 20,000 nucleotides long.
If you know the length of an mRNA, from start codon to stop codon, can you determine the length
(number of amino acids) in a protein?
Follow along with this example: How many amino acids are coded for by an mRNA that is 102
nucleotides long?
•
•
•
•
First, remove the 3 nucleotides that account for the stop codon. 99 nucleotides will actually be
translated.
Then, calculate the number of amino acids that will be translated: 1 amino acid/3 nucleotides =
x amino acids/99 nucleotides
A simpler way to think of it might be to subtract 3 (for the stop codon), then divide the number
of nucleotides by 3.
Therefore, a 102-nucleotide mRNA will make a protein 33 amino acids long.
Central Dogma
21
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
18. Now try this one:
If an mRNA, from Start thru Stop, is 3120 base
pairs long, how long will the protein it codes for
be?
a 3120 nucleotide mRNA will make a protein 1039
amino acids long.
The Central Dogma is true in all but a few strange organisms, such as retroviruses and prions. By
understanding how DNA is transcribed and a protein is translated, you understand the core of what
makes each living organism unique. The source of many human disorders, especially those that are
hereditary, can be traced back to a change in a DNA sequence. For example, in diseases such as cystic
fibrosis and sickle cell anemia, a single protein has been damaged because of a change in the DNA
sequence in that individual. It’s amazing how one small change, maybe of just one nucleotide, can have
profound effects. Changes in a DNA sequence, known as mutations, will be discussed in another section.
Central Dogma
22
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
Section 8.4 From One to Trillions—The Cell Cycle
Directions for
the Student:
Objectives:
This lesson is designed for you to complete, on your own or in your study group. Use
your notes and follow along in the text, as you find necessary.
1. Describe the life history of a cell and break it down into the correct stages
2. Briefly describe how DNA is replicated
3. Describe the events of mitosis
4. Explain the major differences between prokaryotic and eukaryotic cell division
Humans begin life as just one cell. From that one fertilized egg cell we develop into complex
multicellular organisms made up of trillions of cells. Many of these cells specialize to carry out a wide
variety of tasks. In another course, like Anatomy and Physiology, you may learn about the specialized
cells and how they interact with each other. But first, answer this fundamental question.
1. What needs to happen for one cell The one cell must divide over and over again.
to become trillions?
As you may remember cell theory states that all cells come from preexisting cells. Since cells only come
from preexisting cells and new cells are continuously being created by organisms, then cells must divide
in order to create new cells. In order for cells to reproduce they require matter, energy and
organization.
2. Which of the major macromolecules is used primarily as Carbohydrates
a source of immediate energy in human cells?
3. If we think about cells as a factory which of the major
macromolecules is the product of our factory? These
molecules also carry out most of the “work” of a cell
Proteins
4. Which of the major macromolecules is used to store
genetic information?
Nucleic Acids (DNA)
When cells divide of course they need to have enough energy to move molecules around and energy
and building blocks to build proteins. Another very important part of a cell that is duplicating itself is
making a copy of all of the genetic material. With only a few exceptions all cells in your body contain all
of the genetic information stored in the order of nucleotides in DNA. This set of information is known as
a genome, and in humans it contains over 3 billion nucleotides. Those nucleotides are in sections known
as chromosomes, which consist of the DNA and a protective network of proteins. The process of
duplicating the chromosomes needs to be done methodically because any mistakes made in the copying
process will be carried on to the new cell. This process is similar to making a copy of all of the files on
your hard drive. The life cycle of a cell can be divided into sections, depending on how the cell is
preparing to divide (of course it is doing all its normal activities in the meantime!)
From One to Trillions—The Cell Cycle
23
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
The Cell Cycle
The cell cycle is a series of processes that a cell goes through. We divide this cycle up into two broad
steps. These are shown by the outer ring in the diagram above.
5. What is the name of the broad non-dividing
state labeled with an "I" in the diagram?
Interphase
This non-dividing period of a cell’s life can be broken down into three more specific phases. You can
think of these as "sub-phases" of interphase.
6. Fill in the chart below with information about these "sub-phases."
Phase Abbreviation
Phase Name
Description of Activities
G0
Gap 0, or quiescent
Cell no longer will divide, this can be temporary or
permanent, as in cells of the heart
G1
Gap 1 phase
More organelles are made; cell grows
S
Synthesis phase
DNA replication occurs, other crucial elements
duplicated or expanded
G2
Gap 2 phase
Centrioles are finished replicating
From One to Trillions—The Cell Cycle
24
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
Recall that before a cell can divide it must make an accurate copy of its DNA. This is a carefully
orchestrated process that requires actions of many different molecules including several enzymes.
7. Describe enzymes in more detail.
What do enzymes do?
Speed up chemical reactions (Lower activation energy) without
themselves being destroyed
Which category of macromolecule
do enzymes fall into?
Protein
When DNA is wrapped around histones, like it is in all eukaryotic cells, it is known as chromatin. In
Interphase, the chromatin in the nucleus is loose and jumbled, like a bowl of noodles. For humans, that
means that there are 46 long noodles, or strands of chromatin (chromosomes). To get ready for cell
division, each of those noodles needs to be copied, so that both of the two new cells gets a full set of
chromosomes. Examine the diagram of DNA replication below. Refer to your textbook for information
on the unlabeled structures.
8. Fill in the chart below regarding replication enzymes.
Enzyme #
2
1, 8
9
Enzyme Name
Enzyme Function
DNA ligase
Joins together Okazaki fragments
DNA -Polymerase
Links together nucleotides to build a complementary
DNA strand
Helicase
unwinds and separates the strands of DNA
From One to Trillions—The Cell Cycle
25
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
Once replication is complete, each chromosome now has 2 strands, held together by a centromere.
Next, we will go into the part of the cell cycle in which the cell is actively dividing.
9. What is the name for the part of the cell cycle Mitosis
that separates copies of the chromosomes and
results in two identical nuclei?
To really understand the steps of division, it is helpful
to draw it out, but drawing out 46 chromosomes like
human’s have would be tedious. In the next pages,
work through an understanding of this type of cell
division using a cell that has 4 pairs of chromosomes. In
Interphase, the mother cell might look like the one
shown here. In this picture, a lot of cell structures have
been left out on purpose. Notice that the
chromosomes are like single “noodles” of chromatin,
and the centrioles are shown outside the nucleus. You
can see a pair of blue, a pair of red, a pair of yellow,
and a pair of green chromosomes. Also notice that they
are different lengths.
10. Answer the following questions using the picture of a single chromosome.
Is this chromosome from
a cell before or after it has
gone through S phase?
How do you know?
After it has gone through S phase,
and we know that because the
chromosome has 2 arms
(chromatids).
Identify the structures
labeled #1 and #2.
1- A chromatid
Why are different
chromosomes different
lengths?
Due to the number of genes each
contains (but evolutionarily we aren’t
sure why)
2- The centromere
From One to Trillions—The Cell Cycle
26
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
In drawings of cell division you can simplify even further, by drawing only the nucleus and centrioles,
since in cell division the focus is on chromosomes and how they are separated. Also, it’s easier to see
the chromosomes if you draw them as compact, “straight” lines, like in the nuclei shown below.
13. At the end of mitosis, when two new cells are On the left, the cell will enter G1 with single-armed
formed, will their chromosomes look like
chromosomes.
those in the nucleus on the left, or right?
14. What structure does the blue circle
represent?
The nuclear membrane.
This dividing phase can be further broken down into "sub-phases."
11. DRAW the nucleus and chromosomes of a cell with 4 pairs of chromosomes as they would look in
each subphase.
Prophase (and prometaphase)
Metaphase
From One to Trillions—The Cell Cycle
27
Protein Synthesis, DNA, and the Cell Cycle
Anaphase
Active Learning Activities
Telophase
Now that you have a good visual idea of mitosis, make sure you can describe the activities of each
phase. What is happening to the nuclear membrane? Where are the centrioles? Are the chromosomes
separated yet, and how are they separated?
15. Match the word or phrase with its description.
Term
A. prophase
B. telophase
Definition
C
The center line where chromosomes line up during cell division
F
Spindle fibers have grabbed onto each chromosome from both sides at
the centromere and lined them up in the middle.
B
The chromosomes have been pulled all the way to the poles, the
spindle fibers break apart and let go of the chromosomes and new
nuclear membranes begin to form and
A
The chromosomes condense and the nuclear membrane breaks down.
Centrioles separate and move toward opposite “poles.”
E
Chromosomes begin to separate; the spindle fibers are pulling the sister
chromatids apart.
D
The center line between the two daughter cells where the cellular
membrane is pinching off to separate them.
C. metaphase plate
D. cleavage furrow
E. anaphase
F. metaphase
At the end of telophase, the chromosomes have completed their journey and the centrioles have done
their job. But the two new cells need a few repairs to be whole and separate cells.
From One to Trillions—The Cell Cycle
28
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
16. What is the name of the process that finishes
the job of mitosis, by reforming membranes
and separating the two daughter cells?
cytokinesis
17. After the end of the “M” part of the cell cycle, G1 of Interphase
what specific sub-phase will both new
daughter cells enter?
The goal of mitosis, as we said at the beginning, is to accurately divide a cell in half so that each
daughter cell gets the proper amount of DNA. In growth, or repairing a wound, the two new daughter
cells can continue on through their own cell cycle and divide. So, mother cells produce two daughter
cells, which themselves become mother cells, and so on. The cell cycle gives an overview of how one cell
can divide over and over again eventually becoming an organism consisting of trillions of cells.
Throughout the cell cycle there are various checkpoints that help to regulate the rate of cell division.
Sometimes cells rarely divide while others divide rapidly for example during healing or growth.
18. What do you think might occur if the
mechanisms that regulate the cell
cycle are somehow altered due to a
DNA mutation?
Unregulated growth of cells. (Cancer)
Another type of nuclear division is called meiosis. This type of division relates to reproductive cells which
are not genetically identical to the mother cell.
19. What are the two types of human
reproductive cells?
Eggs and sperm
Prokaryotic cells do not have a nucleus, and only have one chromosome that is circular. They don’t need
mitosis. But if you’ve ever had any kind of infection you know that they do divide!
20. Answer a few questions about prokaryotic cell division.
What is the term for the type of cell
division that prokaryotic cells do?
Binary fission
What is the technical term for name a
prokaryotic cell’s circular chromosome?
the nucleoid
Is prokaryotic cell division faster or slower faster because it is less complicated. There are no
than eukaryotic cell division? Why?
chromosomes to condense, centrioles to move around,
membranes to break down, spindle fibers, etc.
From One to Trillions—The Cell Cycle
29
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
Section 8.5 Changing You
Directions for
the Student:
This lesson is designed for you to complete, on your own or in your study group. Use
your notes and follow along in the text, as you find necessary.
Objectives:
1.
2.
3.
4.
Differentiate between induced and spontaneous mutations
Identify gene mutations and their effect on the protein that is coded for
Discuss the pros and cons of mutations
Explain the statement “everyone is a mutant”
The word “change” often makes people uncomfortable. If a friend changes their hairstyle, does it throw
you off? What if a bus schedule changed, or McDonald’s™ changed their fries? On a more positive note,
it might be a good idea if someone changed their eating habits or moved away from a toxic roommate.
This isn’t a philosophy or psychology class, but it’s important to think about change in Biology, and that
it can be both good and bad. Take a look at these faces, some may be familiar to you. What do they have
in common?
At first you might say that they have nothing in common, except maybe some fame. But if you
remember that you are in a Biology class, talking about Genetics, you should realize that they are all
mutants. As a matter of fact, you are too! Biology doesn’t always get thigns right. When it comes to the
story of your life, or your DNA code, it’s not hard for a cell to make mitsakes. In some cases, the changes
are very small or or insignificant, but in other cases it’s major and life-changing for the organism. In
humans we tend to notice “disorders” or “diseases” that are obvious; the people shown above
represent albinism, achondroplasia (dwarfism), sickle cell disease, Marfan syndrome, and BRCA
mutation (the gene that causes a person to be more likely to have breast cancer). In your family, you
might have someone with a crooked toe, someone who is allergic to dairy products, or some such minor
change. How does that happen? (by the way, did you notice the three mistakes in this paragraph?)
Changing You
30
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
Previously you learned about DNA structure, and how DNA is copied.
1. Refresh a few facts before we talk about changes in DNA.
What is the name of the process that
copies DNA?
DNA replication
What enzyme does most of the work to
copy a DNA strand?
DNA polymerase
What are the base-pairing rules for DNA?
(which nucleotides pair up?)
A with T, C with G
DNA is the code, found in the nucleus of eukaryotic cells. But it just sits there in your nucleus, like a
blueprint. It’s the way that code is read that gives an organism its features.
2. Answer the following about DNA and genetic coding.
What two processes occur to read the
DNA and create the protein product?
Transcription and Translation
What is a codon?
the 3- nucleotide set that tells the ribosome what amino
acid to add to a growing protein
In your own words, what it the genetic
code?
the translation of RNA codons to amino acids; which amino
acid is added when a certain triplet of nucleotides is read.
The end result of reading the DNA blueprint is a protein. Proteins, like DNA, have a specific sequence to
them.
3. What monomers give a protein its “sequence?”
amino acids
In thinking about proteins, remember that they are made of a sequence, but the way a protein folds is
critical to its function. There is a saying in Biology- “shape determines function.” How does a protein get
its shape? Well, the chemical properties of the amino acids force it to fold a certain way. For example,
remember there are transmembrane proteins that are embedded in the lipid bilayer of cell membranes.
4. Describe the following behaviors of proteins and enzymes.
What chemical property of a protein would allow it to
“hide” in the lipid bilayer away from water?
if it is hydrophobic
If part of a protein is sticking out of the membrane, or if if it is hydrophilic
the protein is free in the cytoplasm, what property allows
it to be in this watery environment?
Changing You
31
Protein Synthesis, DNA, and the Cell Cycle
Enzymes have very specific shapes to perform their
function. What part of an enzyme interacts with a
substrate so the enzyme can catalyze a reaction?
Active Learning Activities
the active site
Each of the 20 amino acids has a chemical property, such as positive or negative charge, afraid of water,
likes water, etc. This chemical property forces the protein into a certain shape. For example, if an amino
acid has a charge, or is polar, the protein will fold so it will be on the outer surface (to interact with
water); but if an amino acid is hydrophobic, the protein will fold so that it is in the interior, or that part
of the protein might associate with lipids.
You might be asking, what does this have to do with change?
5. Fill in the blanks to summarize how change, or a mutation, happens in a cell or organism:
If a _____________ doesn’t work right, it’s probably because it folded wrong.
protein
If it folded wrong, it’s probably because the ____________ of amino acids was
changed.
sequence
If an amino acid changed, it’s because the 3- ______________ codon in the
mRNA was changed.
nucleotide
If the codon changed, it’s because the nucleotides in the ________ sequence
changed.
DNA
A disorder like albinism or dwarfism can be spontaneous, meaning that the parent didn’t have the
mutation but their child did. In the case of both of these disorders, the difference comes down to one
nucleotide. This type of spontaneous change happens because one of the parents had a mutation in
their gametes. The nucleotide change happens during DNA replication, in other words the DNA
polymerase made a mistake in the cell cycle that led up to the gametes being made.
Induced mutations are different. “Duce” or “duct” means to lead, which helps to understand words like
conductor or produce. They are caused by an outside force or agent.
6. What common type of outside force induces
pyrimidine dimers in DNA?
UV radiation
7. Name at least 2 other forces or chemicals that X-rays, nuclear radiation, chemicals from tobacco
can cause DNA damage.
or illegal drugs; medicines like thalidomide,
viruses like Zika
Whether a change in DNA sequence is spontaneous or induced, the good news is that there is a way to
fix them. Different organisms have different DNA Repair mechanisms to handle damage caused by a
variety of forces. Also, DNA polymerase has a proofreading power, like a spell check, that can catch
Changing You
32
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
problems during DNA replication. But not all mistakes are repaired; sometimes the repair mechanisms
just can’t keep up. That’s when there might be a problem.
8. Answer the following questions related to mutagens.
Define the word mutagen
an agent that can cause a change in DNA
Name a mutagen that can cause skin cancer
UV light, sunlight
Name a mutagen that can cause lung cancer
smoking, asbestos, coal dust
9. Looking at DNA changes more closely, use the genetic code to answer these questions.
If the DNA sequence is TAC, what will the RNA
codon be? What amino acid and/or function does
this RNA codon code for?
AUG, codes for methionine and is the START codon
What RNA codon(s) code for the amino acid
arginine (ARG)?
CGU, CGC, CGA, CGG, AGA, AGG
What RNA codon codes for tryptophan (TRP)?
RNA: UGG, came from DNA: ACC
What was the DNA sequence that was transcribed
to make this codon? (backwards transcribe it)
If the last nucleotide (letter) in the TRP codon
changes to a “U,” will the amino acid stay the
same, or what change will occur?
no- UGU codes for cysteine so the amino acid will
change.
If the last nucleotide (letter) in the TRP codon
changes to an “A,” will the amino acid stay the
same, or what change will occur?
This is a STOP codon, the protein translation will
stop
What term describes a change in DNA that is very
small, and only one or two nucleotides have
changed from the original sequence?
point mutation
In eukaryotic cells, there is a lot of “noncoding” DNA that isn’t transcribed or translated into protein. In
some cases, we know that these areas are controls for when genes are expressed, or maybe how a
Changing You
33
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
section of DNA is coiled. A mutation in a noncoding area won’t affect the sequence of a protein, but it
might affect the expression levels of a protein.
10. Examine more closely how DNA changes in a coding gene affect the protein by answering these
questions.
Write the codon for the DNA sequence ATA then UAU change the last nucleotide (letter) to A or G so
change only one nucleotide so that it codes for an it will become UAA or UAG
RNA codon that is a STOP codon.
If a codon changes to cause an mRNA to have a
STOP codon instead of a codon for an amino acid,
what type of protein mutation is this?
This is a nonsense mutation
(above a tyrosine changes to STOP)
Write the RNA codon(s) for histidine then change CAU or CAC becomes CAG which codes for
the last letter to a “G.” What changes, if anything, glutamine
in the protein that is produced?
If a codon changes and it causes the amino acid
sequence of the protein to change, what type of
protein mutation is this?
This is a missense mutation. There is a “mistake” in
the protein
Have you noticed that most amino acids have several codons? Biologists call this redundant, and it
actually is a protection from mutations. In many cases the last nucleotide, or letter, of a codon is the
most important when it comes to causing changes in a protein. That means that, in a coding sequence of
a gene, a change in the first two nucleotides of a codon might not change the protein. This is why people
have different DNA sequences, even though they might have the same protein sequences.
11. Answer these questions about changes in DNA that don’t change the protein.
Think about these two options for a codon in the
gene for the protein collagen (found in skin and
nails): GAA and ATT
DNA because the one contains a “T”
Are these DNA or RNA sequences? How do you
know?
Let’s say your gene for collagen has the sequence
GAA and your friend’s has the sequence AAT.
the RNA codons will be CUU and UUA
both code for the amino acid leucine
2 out of 3 of your nucleotides are different. What
amino acid(s) do your proteins have?
What type of protein “mutation” does this
illustrate? Explain.
silent mutation, the DNA changed but the protein
didn’t
Some organisms inherit a mutation that causes a protein to change drastically. It only takes a few
incorrect amino acids to mess up the function of a protein. The change can be good for the organism,
like when the influenza viruses has a mutation that makes it stronger, or a bacterium has a mutation
Changing You
34
Protein Synthesis, DNA, and the Cell Cycle
Active Learning Activities
that makes it resist an antibiotic (both are bad for us!) Maybe the change allows the organism to survive
better in the wild, like an animal who is better camouflaged due to a change in a protein in their fur. Of
course, a change can also be bad for the organism, like a person born with a debilitating disease.
12. Answer a few questions about sickle cell anemia.
What protein is mutated in a person with
sickle cell anemia?
beta hemoglobin
With respect to the protein, What TYPE of
mutation causes sickle cell anemia?
it is a missense mutation
What specific amino acid(s) have changed in
the protein, and how specifically does the
DNA code for the mutant gene differ from
the “normal” gene?
in codon #6 a GAG changes to a GTG in the DNA
(Also a point mutation)
This cause the RNA to change from coding for
Glutamine to coding for Valine.
How does this mutation in one protein cause the protein folds incorrectly and clumps together to
the disease sickle-cell anemia?
cause the red blood cells to take on a sickle shape.
Which person in the pictures at the beginning Top right, Tiki Barber, former running back in NFL for NY
of this section has sickle cell anemia?
Giants
Changing You
35