Download Molecular Identification of a SNAP-25

EUKARYOTIC CELL, Aug. 2008, p. 1387–1402
1535-9778/08/$08.00⫹0 doi:10.1128/EC.00012-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Vol. 7, No. 8
Molecular Identification of a SNAP-25-Like SNARE Protein
in Paramecium䌤
Christina Schilde,* Kaya Lutter,† Roland Kissmehl, and Helmut Plattner
Department of Biology, University of Konstanz, 78457 Konstanz, Germany
Received 8 January 2008/Accepted 25 May 2008
proteases which, by cleaving SNARE proteins, inhibit neurotransmitter release. The structural basis for the specificity of
SNAP-25 cleavage by BoNT/A and BoNT/E has been solved,
and the interacting amino acids have been mapped (13, 15).
Most SNAREs possess a carboxy-terminal transmembrane
domain, whereas others, like the SNAP-25 protein and the
R-SNAREs of the Ykt6 family, are attached to the membrane
by fatty acid modification. Mammalian SNAP-25 is membrane
attached by palmitoylation on a conserved stretch of cysteine
residues situated between the two SNARE motifs (75). However, such a cysteine cluster is absent from the vertebrate
proteins SNAP-29 and SNAP-47 (31, 67), as well as from all
SNAP-25 homologues outside of the metazoans, and the
modes of membrane attachment, if any, of those proteins remain to be determined. Homologues to mammalian SNAP-25
have been found in a variety of organisms ranging from unicellular organisms to plants, fungi, and higher eukaryotes (40).
Disassembly of the fully assembled SNARE complex is performed by the SNARE-specific chaperone NSF, an AAA-type
ATPase (64), and SNAPs recruit NSF to the SNARE complex
(59). The exact time point of NSF action before or after membrane fusion has been debated, and it is possible that different
requirements for regulation are met in various membrane fusion events (25, 44, 63, 72, 78).
SNARE-mediated fusion is a common feature of all eukaryotic cells, and all of the above-mentioned components of the
SNARE fusion machinery have also been identified in the
ciliated protozoan Paramecium tetraurelia (22, 36, 37, 61). Paramecium, which must perform all of the autonomous functions
of an entire organism, possesses highly diversified membrane
trafficking pathways (53). P. tetraurelia is capable of a fast
synchronous release of dense core vesicles, defensive organelles called “trichocysts,” that has striking similarities to
dense core vesicle exocytosis of neuroendocrine cells (52, 74).
Like many other ciliates, P. tetraurelia has regularly arranged
Membrane trafficking in eukaryotic cells involves budding of
vesicles from a donor compartment and transport to and fusion
with the acceptor compartment. The soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs)
are of central importance in the mediation of membrane fusions (32). The crystal structure of the synaptic SNARE complex has been resolved (70). The ternary synaptic SNARE
complex consists of the SNARE motifs of synaptobrevin-2
(VAMP2) and syntaxin-1A and the two SNARE motifs from
the synaptosome-associated protein of 25 kDa (SNAP-25).
Structures of different SNARE complexes revealed a highly
conserved four-helix structure, with the difference that the
positions of the two SNARE motifs from SNAP-25 can be
contributed by two different SNARE proteins (7). The highly
conserved pattern of SNARE pairing has led to the so-called
3Q-plus-1R rule (21). According to this rule, fusogenic
SNARE complexes always contain three SNARE motifs containing a glutamine residue in the center of the SNARE motif
(Q-SNARE) and one SNARE displaying an arginine at the
same position (R-SNARE). Furthermore, Qa-, Qb-, Qc-, and
R-SNAREs can be recognized by specific sequence features
(40).
Identification of the SNARE components of the synaptic
SNARE complex and functional analysis have been greatly
facilitated by the availability of specific inhibitors, e.g., by Clostridium botulinum neurotoxins (BoNTs), that specifically cleave
certain neuronal SNAREs (46). BoNTs are zinc-dependent
* Corresponding author. Mailing address: Department of Biology,
University of Konstanz, P.O. Box 5560, 78457 Konstanz, Germany.
Phone: 49-7531-88-4230. Fax: 49-7531-88-2245. E-mail: christina
[email protected].
† Present address: Institut für Biochemie und Molekularbiologie I,
Universitätsklinikum Düsseldorf, Moorenstrasse 5, 40225 Düsseldorf,
Germany.
䌤
Published ahead of print on 13 June 2008.
1387
Downloaded from ec.asm.org at 68523327 on January 15, 2009
Using database searches of the completed Paramecium tetraurelia macronuclear genome with the metazoan
SNAP-25 homologues, we identified a single 21-kDa Qb/c-SNARE in this ciliated protozoan, named P. tetraurelia SNAP (PtSNAP), containing the characteristic dual heptad repeat SNARE motifs of SNAP-25. The
presence of only a single Qb/c class SNARE in P. tetraurelia is surprising in view of the multiple genome
duplications and the high number of SNAREs found in other classes of this organism. As inferred from the
subcellular localization of a green fluorescent protein (GFP) fusion construct, the protein is localized on a
variety of intracellular membranes, and there is a large soluble pool of PtSNAP. Similarly, the PtSNAP that
is detected with a specific antibody in fixed cells is associated with a number of intracellular membrane
structures, including food vacuoles, the contractile vacuole system, and the sites of constitutive endo- and
exocytosis. Surprisingly, using gene silencing, we could not assign a role to PtSNAP in the stimulated exocytosis
of dense core vesicles (trichocysts), but we found an increased number of food vacuoles in PtSNAP-silenced
cells. In conclusion, we identify PtSNAP as a Paramecium homologue of metazoan SNAP-25 that shows several
divergent features, like resistance to cleavage by botulinum neurotoxins.
1388
SCHILDE ET AL.
EUKARYOT. CELL
TABLE 1. Oligonucleotides used for amplification and expression of PtSNAP
SNAP type
Oligonucleotides for RT-PCR
Dei-1
SNAP-A
SNAP-B
SNAP-C
SNAP-D
SNAP-E
SNAP-F
SNAP-G
SNAP-H
SNAP-I
SNAP-K
SNAP-L
SNAP-M
SNAP-O
SNAP-P
SNAP-Q
SNAP-R
Xho
Spe
Xho
Xba
Spe
Spe
Spe
Spe
Xho
Nco
cortical structures and organelles, such as ciliary bases, “alveolar sacs” (calcium stores), sites of constitutive endo- and exocytosis (“parasomal sacs”), early endosomes (“terminal cisternae”), and trichocysts, all of which are arranged in a highly
regular pattern. This feature facilitates the identification of
organelles and membrane interaction sites. For instance, the
⬃1,000 trichocysts are predocked in a fusion-ready state at
precisely predictable sites. Food vacuole uptake and processing
occur in a highly ordered manner by transformation through
defined stages while moving on a fixed route through the cell
(“cyclosis”) (2–5). Many of the membrane interaction sites
involved are endowed with different SNAREs (37). Furthermore, P. tetraurelia possesses a pair of contractile vacuole systems for osmo- and ion regulation, each consisting of a collecting system of five to seven radial canals that empty through
ampullae into a central contractile vacuole (1). NSF and different SNAREs of the R- and Q-types were also found in the
contractile vacuole system (37, 61).
Oligonucleotide
AACTGGAAGAATTCGCGGCCGCGGAATTTTTTTTTTTTTTT
CCGCTCGAGATCCTTTAATGATTTTTTTTGTTTTTTC
GGACTAGTAAGCTTATGCAATAATAACAAATATAAAACAG
TTAATCACACAAAAATCTCTATTAAAA
GCCGCATTAAATTAAGAACAAGAA
CCGCTCGAGGTTTTTTCATTCTACTTGGAC
GCTCTAGAAAGATCGATTACATTTTGGATG
GGACTAGTAAGCTTATGGATCTCAAGTATTCTACTATC
GTTCGTCATTGGAGTTTCATCG
CACATCTTATGGAGTCAAGTCTC
GGACTAGTAAGCTTATGTTCTCTTATCTGTCAATTA
CAGATTACTTGTTGTTCTTCG
GGACTAGTAAGCTTATGTCTTATATTTAACATCTCAATA
GGACTAGTAAGCTTATGTTCAGCCTCAGCAACAAAT
GCGAGCTTACTAATCAATATGTG
GTGATTCGCAATTACGGATCTCC
CTCCTCTTGTTCTTATTC
GCGCTCGAGTCCTTTAATGATTTTTTTTGTTTTTTC
GTTGCTCAGGATTTCTTGTTGTTG
GGCAGATTGTTGATTTATTTGGTAC
CTTATGTAATTTCTGTTGATTTTGATC
GAAGAGTGCTTTAAATTGGCCCC
GTATTTGTTGTTTTTGATCATCTTTC
GACCTGCCTTTGGGGTGGTTGTTG
CATTTGATTTGTTTGATTAATCATCTC
GATTTGTTAAGAGCTGTTGGTATTTC
CTTTTGGTTTATTCTATCTAATTGGGTA
CATTCTGCTTGGACATTTGGACAG
GCGCCATGGATCAAGCCGCATTAAATCAAGAAC
CAACAACAAGAAATCCTGAGCAAC
GTACCAAATAAATCAACAATCTGC
GATCAAAATCAACAGAAATTACATAAG
GGGGCCAATTTAAAGCAGTCTTC
GAAAGATGATCAAAAACAACAAATAC
CAACAACCACCCCAAAGGCAGGTC
GAGATGATTAATCAAACAAATCAAATG
GAAATACCAACAGCTCTTAACAAATC
TACCCAATTAGATAGAATAAACCAAAAG
CTGTCCAAATGTCCAAGCAGAATG
Here, we investigated the properties and subcellular localization of a homologue of the SNARE protein, SNAP-25, in P.
tetraurelia. So far, SNAP-25 homologues have been investigated only in metazoans, fungi, and plants (11, 14, 16, 30), and
the present work is the first study of a SNAP-25 homologue in
a unicellular organism.
MATERIALS AND METHODS
Cell culture. Wild-type strains of P. tetraurelia were stocks of 7S and d4-2,
derived from stock 51S (65). Cells were cultivated in a bacterially inoculated
medium as described previously (38). For permeabilization experiments, cells
were permeabilized in Dryl’s buffer (2 mM sodium citrate, 1 mM NaH2PO4, 1
mM Na2HPO4, 1.5 mM CaCl2 [pH 6.8] [19]) supplemented with 0.2% bovine
serum albumin (BSA) with 0.2%, 0.5%, or 1% Triton X-100, 0.1% or 0.3%
digitonin, or 0.01% saponin. To demonstrate the acidification of food vacuoles,
P. tetraurelia cells were fed with pHrodo (Invitrogen, Karlsruhe, Germany) Escherichia coli bioparticles for 20 min and results were analyzed by using epifluorescence microscopy using an Axiovert 100TV microscope equipped with filter
set number 9 and a plan-Neofluar ⫻40 oil immersion objective (numerical
Downloaded from ec.asm.org at 68523327 on January 15, 2009
Oligonucleotides for fusion PCR
for heterologous expression
of SNAP
SNAP-1
SNAP-2
SNAP-3
SNAP-4
SNAP-5
SNAP-6
SNAP-7
SNAP-8
SNAP-9
SNAP-10
SNAP-11
SNAP-a
SNAP-b
SNAP-c
SNAP-d
SNAP-e
SNAP-f
SNAP-g
SNAP-h
SNAP-i
SNAP-j
SNAP-k
Restriction
recognition sites
1389
SNAP-25 IN PARAMECIUM
VOL. 7, 2008
Downloaded from ec.asm.org at 68523327 on January 15, 2009
1390
SCHILDE ET AL.
(numerical aperture, 1.3) and a ProgRes C10 plus camera system from Jenoptik.
Excitation light was produced by a 100-W HBO lamp. Images were processed
with either Axiovision software (Zeiss) or Adobe Photoshop (Adobe Systems,
San Jose, CA). Confocal images were acquired with an LSM510 Meta confocal
scanning microscope (Zeiss) equipped with a plan-Neofluar ⫻63 oil immersion
objective (numerical aperture, 1.4).
Gene silencing by feeding. The coding sequences of the PtSNAP gene, either
as a ⬃300-bp fragment from genomic DNA or as a full-length cDNA sequence,
were amplified by PCR using the PtSNAP-specific oligonucleotides (Table 1) and
cloned into the double T7 promoter plasmid pL4440 (71) over the SpeI and XhoI
restriction sites. Plasmids were introduced in the E. coli Ht115 strain, and
Paramecium cells were fed with these strains as described in detail by Galvani
and Sperling (23) and by Wassmer et al. (77). The Paramecium cells were
analyzed after 24 to 96 h of feeding. The cells’ capability for trichocyst exocytosis
was routinely tested with a saturated solution of picric acid (56).
Recombinant expression of PtSNAP in E. coli. For heterologous expression of
PtSNAP, we selected a part of the coding region of PtSNAP (Q11-K175; EMBL
accession number CAK57530). After the mutated Paramecium glutamine codons
(TAA and TAG) were substituted for the universal glutamine codons (CAA and
CAG) by PCR methods (18) (Table 1 lists oligonucleotides), this region of
PtSNAP was cloned into the NcoI/XhoI restriction sites of the pRV11 expression
vector (79), a derivative of the pET system from Novagen (Madison, WI), which
adds an eight-amino-acid peptide to the C terminus of the selected sequence,
including a His6 tag for purification of the recombinant peptides. PtSNAPQ11-K175
was then recombinantly expressed in E. coli BL21(DE3)-pLysS cells.
Purification of the recombinant PtSNAP and preparation of polyclonal antibodies. The recombinant PtSNAPQ11-K175 protein was purified by affinity chromatography on Ni2⫹-nitrilotriacetate agarose under denaturing conditions, as
recommended by the manufacturer (Novagen, Madison, WI). The recombinant
peptide was eluted at pH 4.5 with a buffer containing 8 M urea, 100 mM
NaH2PO4, and 10 mM Tris-HCl (pH 4.5) supplemented with 1 M imidazole. The
collected fractions were analyzed on sodium dodecyl sulfate (SDS)-polyacrylamide gels, and those containing the purified recombinant protein were pooled,
dialyzed against phosphate-buffered saline (PBS; pH 7.4), and used for the
immunization of a rabbit. After the rabbit received several boosts, positive sera
were taken and affinity purified by two subsequent chromatography steps as
described previously (38).
Cell fractionation. For subcellular fractionation, cells were grown in axenic
culture medium at 25°C and harvested at the late logarithmic phase as previously
described (39). Whole-cell homogenates were prepared in 20 mM phase buffer
(20 mM Tris-maleate, 20 mM NaOH, 20 mM NaCl, 250 mM sucrose [pH 7.0])
as described previously (38). Soluble and particulate fractions were separated by
centrifugation at 100,000 ⫻ g for 60 min at 4°C. A protease inhibitor cocktail
containing 15 ␮M pepstatin A, 100 mU/ml aprotinin, 100 ␮M leupeptin, 0.26
mM N ␣-(p-toluene sulfonyl)-L-arginine methyl ester (TAME), 28 ␮M E64, and
0.2 mM Pefabloc SC (all from Sigma-Aldrich, Schnelldorf, Germany) was used
throughout the preparation. Similarly, P. tetraurelia homogenates were separated
on a 10 to 30% Optiprep (Axis-Shield PoC AS, Oslo, Norway) gradient at 46,000
⫻ g for 18 h at 4°C.
BoNT treatment of cell lysates. BoNT/A (Sigma-Aldrich) and BoNT/E (List
Biological Laboratories, Campbell, CA) were reconstituted in sterile doubledistilled H2O, supplemented with 1 mg/ml BSA to 0.1 mg/ml and activated in 200
mM Tris-HCl (pH 8.0), 500 mM NaCl, and 50 ␮M ZnCl2 with 5 mM dithiothreitol for 30 min at 37°C. Approximately 30 ␮g of protein of crude cell lysates
from P. tetraurelia or PC12 cells or 5 ␮g of purified recombinant PtSNAP or
rabbit SNAP-25 control peptide (List Biological Laboratories) was incubated
with 20 ng of the respective BoNTs for 1 h at 37°C. The protein was methanol
precipitated and analyzed by SDS-polyacrylamide gel electrophoresis
(PAGE) (see below). Rabbit SNAP-25 was detected on Western blots with an
anti-human SNAP-25 mouse monoclonal antibody (clone SP12; Upstate Biotechnology, NY).
FIG. 1. (A) Nucleotide and deduced amino acid sequences of PtSNAP. The bases are numbered referring to the position of the start ATG
codon (bold). The locations of oligonucleotide primers used in this study are indicated below the underlined nucleotide sequence. The hypothetical
N-terminal extended amino acid sequence is indicated in gray capital letters. The first, a Qb-SNARE motif, is marked in yellow, and the second,
a Qc-SNARE motif, is marked in blue. Hyphens mark the positions of the introns, and stars mark the translation stop codons TGA. (Ba) Homology
between the region containing PtSNAP on scaffold_105 (continuous red line) and the corresponding region of scaffold_121 (below). A color bar
indicating the degree of sequence similarity and a nucleotide ruler are shown above. (Bb) Schematic illustration of the position of PtSNAP (blue)
on scaffold_105 and the deletion in the respective region from the sister scaffold_121 below. Numbers above and below refer to the base pair
number within the respective scaffold.
Downloaded from ec.asm.org at 68523327 on January 15, 2009
aperture, 1.3) and imaging with a ProgRes C10 plus camera system (Jenoptik,
Jena, Germany).
Annotation and characterization of the P. tetraurelia SNAP gene. The Paramecium genome database (http://paramecium.cgm.cnrs-gif.fr) was BLASTP
searched with the amino acid sequences of the SNAP-25 homologues from other
organisms obtained from NCBI (http://www.ncbi.nlm.nih.gov). The “supercontigs” of positive hits were identified by BLASTN searches, and the gene sequence
was manually completed, starting with an ATG start codon and terminating with
a TGA stop codon. Putative introns, which, in Paramecium, are 18 to 35 nucleotides long and flanked by conserved 5⬘-GT and 3⬘-AG sequences (57), were
manually annotated using MapDraw (DNA Star, Madison, WI) software. The
resulting predicted protein sequence was reciprocally analyzed by BLASTP
searches of the NCBI database (6). Conserved motif searches were performed
with either PROSITE (9) or BLAST-RPS software, using Pfam entries of the
corresponding CDD database (12, 45). We also used PSIPRED (34) and MEMSAT 2 (33, 35), two software methods for secondary structure prediction (included with the server at http://bioinf.cs.ucl.ac.uk/psipred/ [47]).
PCR of genomic DNA and cDNAs. Total wild-type DNA from strain 7S for
PCR was prepared from log-phase cultures as reported by Godiska et al. (24).
The open reading frame of the P. tetraurelia SNAP (PtSNAP) gene was amplified
by reverse transcriptase (RT) PCR, using total RNA prepared according to
Haynes et al. (29). RT-PCR was performed in a programmable T3 model thermocycler (Biometra, Göttingen, Germany), using a 3⬘ oligo(dTT) primer
(5⬘-AACTGGAAGAATTCGCGGCCGCGGAATTTTTTTTTTTTTT-3⬘)
and a SuperScript III RT (Invitrogen) for first-strand cDNA synthesis. The
subsequent PCR was performed with Advantage 2 cDNA polymerase mixture
(Clontech, Palo Alto, CA) using the PtSNAP-specific oligonucleotides (Table 1)
with or without the artificial SpeI/XhoI or XbaI/XhoI restriction site added at
their ends. In general, amplifications were performed with one cycle of denaturation (95°C, 1 min), 40 to 42 cycles of denaturation (95°C, 30 s) and annealing (54
to 58°C, 45 s), and an extension step (68°C, 3 min), followed by a final extension
step at 68°C for 5 min. PCR products were subcloned into the pCR2.1 plasmid
by using a TOPO-TA cloning kit (Invitrogen) according to the manufacturer’s
instructions. After clones were transformed into E. coli (TOP10F⬘) cells, positive
clones were sequenced as described below.
Sequencing. Sequencing was done by MWG Biotech (Martinsried, Germany)
custom sequencing service. DNA sequences were aligned by the CLUSTAL W
feature integrated in the DNAStar Lasergene software package (DNAStar, Madison, WI).
Construction and microinjection of GFP expression plasmids. PtSNAP-specific PCR products obtained with the oligonucleotides SNAP-O and SNAP-A or
SNAP-K and SNAP-A (Table 1) were cloned into the enhanced green fluorescent protein (eGFP) expression plasmid pPXV-GFP (27) in front of the eGFP
gene, as described by Wassmer et al. (77), between the SpeI and XhoI restriction
sites of the plasmid, using conventional cloning procedures (58). Thus, because
the actual start codon was unknown in the beginning, a short version and a long
version of a GFP fusion protein were constructed. For microinjection of cells, the
pPXV-SNAP-GFP fusion plasmids were linearized with SfiI, which cuts in between the Tetrahymena thermophila inverted telomeric repeats, thus helping to
stabilize the DNA in the macronucleus after injection (28). DNA to be injected
was isopropanol precipitated and resuspended to a concentration range of 1 to
5 ␮g/␮l in MilliQ water. For microinjection, postautogamous cells were used,
which were allowed to grow for three or four generations in bacterially preinoculated medium. To avoid disturbing the transformation process, we also
treated cells with 0.2% aminoethyldextran (AED) to remove trichocysts (54) and
equilibrated in Dryl’s buffer (19) supplemented with 0.2% BSA. DNA microinjections were made with glass microcapillaries, using an Axiovert 100TV phasecontrast microscope (Zeiss, Oberkochen, Germany). Expression of GFP fusion
proteins in clonal descendants of microinjected cells was analyzed after 24 to 48 h
by epifluorescence microscopy with an Axiovert 100TV microscope (Zeiss)
equipped with filter set 13 or 9, a plan-Neofluar ⫻40 oil immersion objective
EUKARYOT. CELL
Downloaded from ec.asm.org at 68523327 on January 15, 2009
1391
1392
SCHILDE ET AL.
RESULTS
Identification of PtSNAP. The developing Paramecium genome database (http://paramecium.cgm.cnrs-gif.fr) based on the
Paramecium genome project (8, 17, 66, 80) was tBLASTN
searched with the amino acid sequence of SNAP-25 homologues
from other organisms. The search with leech (Hirudo medicinalis)
SNAP-25 (GenBank accession no. gb|AAC47499) first returned
three Qc-SNAREs, PtSyx14-1 (emb|CAK58342), PtSyx14-2
(emb|CAK88055), and PtSyx15-1 (emb|CAK79412) (37) as major hits. Eventually, a single SNAP-25-like sequence could be
identified on scaffold_105, and the corresponding coding region
was completed using flanking sequence information of the respective supercontig (SuperContig_11387). The putative ATG start
codon and the TGA stop codon were manually assigned, as well
as the position of a single 25-bp conventional intron (Fig. 1A).
This gene structure prediction fitted well with the automatically
annotated gene model (GSPATT00028565001; emb|CAK57530)
published later (8). Reciprocal BLASTP searches with the
PtSNAP sequence against those of GenBank confirmed the
annotation of PtSNAP as a SNAP-25-like protein, in which
the closest matches were the Anopheles gambiae strain PEST
AGAP001394-PA (gb|EAA01106.5), Drosophila pseudoobscura GA21816-PA (gb|EAL27731.1), the Aedes aegypti synaptosome-associated protein (EAT44027.1), and the Drosophila melanogaster SNAP-24 protein (gb|AAF73834.1).
Generally, the sequence conservation between PtSNAP and
homologues of other species is low (expectation values of
ⱖ0.21). However, this holds true for many SNAREs, since
the SNARE motif is structurally conserved, i.e., not necessarily with a high degree of sequence homology.
Owing to a recent whole-genome duplication, Paramecium
genes often occur as pairs of closely related orthologues (8),
and we previously described a great diversification of the QaSNARE and R-SNARE families (37, 61). However, we were
not able to identify any other SNAP-25-like protein in the
Paramecium genome. We searched the corresponding sister
scaffold_121 for the presence of a PtSNAP orthologue, but in
the respective region, a deletion seems to have occurred (Fig.
1B). Sequence searches of the genome for the related ciliate T.
thermophila (20) revealed a gene (TTHERM_00526630) similar to that which encodes PtSNAP. So far, we were not able to
identify SNAP-25 homologues in other ciliates in the Ciliate
Ortholog Database (http://oxytricha.princeton.edu/COD/).
An algorithm specifically trained on SNARE motifs has
been developed (40), and when the respective SNARE database was searched with PtSNAP, matches with expectation
values of e⫺11 for the consensus SNAP-25 Qb/c motifs were
obtained (Fig. 2A). Furthermore, when reverse PSI-BLAST
(rpsBLAST) was performed with PtSNAP, high similarity was
found with a number of motifs from SNAP-25 homologues
from different species (Fig. 2B). Importantly, conservation of
the characteristic SNARE motif heptad repeats was observed
for PtSNAP (Fig. 2B). In a phylogenetic tree constructed from
the orthologues, PtSNAP consistently grouped within this
group (Fig. 2C), and different methods of tree construction
gave identical branching patterns. A hydrophilicity plot for
PtSNAP shows no clear indication of membrane attachment
sites (Fig. 2D).
The neuronal SNAP-25 and SNAP-23 homologues are normally membrane attached by means of palmitoylation on a
FIG. 2. (A) SNARE motif score for PtSNAP with the SNARE motif trained algorithm (SNARE-DB [40]). Shown are the scores for the
SNAP.b and SNAP.c motifs and the homology to the consensus motifs. Conserved residues are shaded in black; similar residues are in gray. The
position of the SNARE motif heptad repeats is indicated above the sequence. (B) Alignment of the Qb- and Qc-SNARE motifs of SNAP-25 with
the Qb/c-SNARE motifs of other SNAP-25 homologues: Tetrahymena thermophila TTHERM_00526630 (Tt00526630; GenBank accession no.
gi|89309844); Plasmodium falciparum SNAP-23 (PfSNAP23; gi|23615361); Dictyostelium discoideum GRAM-domain-containing protein
(DDB0237970; gi|66827589); Homo sapiens synaptosome-associated protein 23 (HsSNAP23; gi|1374813), SNAP-25 (HsSNAP25; gi|14714976),
and SNAP-29 (HsSNAP29; gi|6685982); Hirudo medicinalis SNAP-25 homologue (HmSNAP25; gi|1923252); Caenorhabditis elegans resistance to
inhibitors of cholinesterase (RIC-4) family member (CeY22F5A.3; gi|32567202); protein K02D10.5 with two t-SNARE domains (CeK02D10.5;
gi|17554000); Drosophila melanogaster synaptosome-associated protein 24 (DmSNAP24; gi|8163739), SNAP-25 (DmSNAP25; gi|548941); Schizosaccharomyces pombe SNAP-25 homologue (SpSNAP25; gi|3650385); Saccharomyces cerevisiae t-SNARE component Sec9 (ScSec9p; gi|730733),
SNAP-25 homologue Spo20p (ScSpo20p; gi|6323659); Arabidopsis thaliana synaptosome-associated protein SNAP25-like SNAP-29 (AtSNAP29;
gi|15241436), SNAP-30 (AtSNAP30; gi|15222976), and SNAP-33 (AtSNAP33; gi|15240163). The heptad amino acid repeats of the SNARE motif
are shaded black, and the conserved residues are gray. Amino acid positions of the corresponding proteins are indicated on both sides. Presumptive
cleavage sites for BoNT/A and BoNT/E are indicated below. (C) Neighbor-joining tree (with 1,000 bootstrap replicates) of phylogenetic
relationships between SNAP-25 homologues. Species names and protein identifiers are the same as those shown in panel A. Bootstrap support
values for the nodes are shown, and evolutionary distances are indicated by the scale bar below. (D) Kyte-Doolittle hydrophilicity plot of PtSNAP.
Amino acid positions are indicated by the ruler above.
Downloaded from ec.asm.org at 68523327 on January 15, 2009
SDS-PAGE and immunoblotting. Protein samples were denatured by boiling
for 5 min in SDS sample buffer and subjected to electrophoresis in 15% SDSpolyacrylamide gels, using a discontinuous buffer system described previously
(36). Electroblotting onto nitrocellulose membranes and immunobinding were
carried out as described previously (38) by using affinity-purified antibodies
against PtSNAP. Bound antibodies were detected with a peroxidase-conjugated
secondary antibody (anti-rabbit immunoglobulin G [IgG]), using an ECL detection system (Amersham, München, Germany). The anti-proteindisulfide-isomerase (anti-PDI) antibody was kindly provided by E. Ladenburger (University of
Konstanz).
Immunofluorescence analysis. Immunofluorescence analyses were performed
with permeabilized cells. Cells suspended in piperazine-N,N⬘-bis(2-ethanesulfonic acid) (PIPES)–HCl buffer (5 mM; pH 7.2) supplemented with 1 mM KCl
and 1 mM CaCl2 were fixed in 4% (wt/vol) freshly depolymerized formaldehyde
in the same buffer solution. Following fixation, cells were permeabilized with
0.5% digitonin (Sigma-Aldrich) for 30 min at 20°C, washed in PBS, and then
incubated twice in PBS supplemented with 50 mM glycine and finally in PBS plus
1% BSA. Samples were then exposed to affinity-purified anti-PtSNAP antibodies
(1:50) or to monoclonal anti-␣-tubulin antibodies (clone DM1A; Sigma-Aldrich),
followed by AlexaFluor488- or AlexaFluor594-conjugated F(ab⬘)2 fragments of
goat anti-rabbit and goat anti-mouse IgG (Invitrogen), both diluted 1:100 in PBS
plus 1% BSA. For controls, either preimmune serum was used or primary
antibodies were omitted. Samples were mounted with Mowiol supplemented
with N-propylgallate to reduce fading. Fluorescence was analyzed with an
LSM510 Meta model confocal laser scanning microscope (Zeiss) equipped with
a plan-apochromat ⫻63 oil immersion objective (numerical aperture, 1.4) or in
a conventional epifluorescence microscope (see above). Images acquired with
the LSM510 software were processed with Photoshop software (Adobe Systems).
EUKARYOT. CELL
VOL. 7, 2008
SNAP-25 IN PARAMECIUM
1393
FIG. 3. Amplification of the PtSNAP gene from genomic DNA and cDNA. The downstream primer is always SNAP-A. For the position of the
SNAP primers used, refer to Fig. 1A. (A) Amplification of PtSNAP from genomic DNA (gDNA) and cDNA, with upstream oligonucleotide
primers SNAP-B or SNAP-C, amplifies products of the expected size. (B) Amplification of PtSNAP from gDNA and cDNA, with upstream
oligonucleotide primer SNAP-G or SNAP-H, also amplifies products of the expected size. (C) Upstream primers SNAP-K, SNAP-L, and SNAP-M
are able to amplify products from gDNA but not from cDNA. The DNA size marker used throughout all experiments is a 1-kb ladder, and band
sizes (in bp) are indicated to the left.
When used in Western blots against P. tetraurelia cell lysates,
the anti-PtSNAP antibody recognized two major bands with
apparent molecular masses of 20 and 21 kDa (Fig. 4A), confirming the predicted ATG start position at the second possible
start codon. An additional immunoreactive band of about 46
kDa was present only when the lysates had been boiled for 5
min at 95°C and probably represents aggregates of PtSNAP
(Fig. 4A), as such irreversible aggregation of membrane proteins in SDS at ⱖ50°C has been described before (60). When
P. tetraurelia cell lysates were fractionated into soluble and
insoluble fractions, the 20-kDa band preferentially stayed in
the 16,000 ⫻ g supernatant, whereas the 21-kDa band went
with the pellet fraction. PtSNAP could be extracted from the
pellet with 1% Triton X-100, 2 M NaCl, and 4 M urea or 100
mM NaCO3 but not by treatment with 1 M hydroxylamine
(Fig. 4B), a deacylating reagent that attacks thioester bonds of
palmitoylated proteins (48, 51). These data suggest that the
higher molecular weight form of PtSNAP is not palmitoylated
and probably not myristoylated but is bound to membranes by
means of protein-protein interactions. However, we cannot
exclude the possibility that the smaller molecular weight form
represents a degradation product of full-length PtSNAP.
When P. tetraurelia cell lysates were separated on 10 to 30%
Optiprep gradients (55), the 21-kDa band segregated with
membrane fractions to the top of the gradient, whereas the
20-kDa PtSNAP immunoreactive band segregated to the bottom of the gradient, where soluble material accumulates (Fig.
4C). The boiling-induced 46-kDa PtSNAP immunoreactive
band was situated in the middle of the gradient (Fig. 4C). We
conclude that the two forms of PtSNAP have distinct distributions in the cell and possibly also function in different complexes. However, the type of modification (or degradation) of
PtSNAP remains unknown, as with many PtSNAP-25 homologues from other organisms.
We also tested PtSNAP for susceptibility to cleavage by
BoNTs. Whereas the cleavage site for BoNT/E (15) is conserved in PtSNAP, the site for BoNT/A (13) is not. When we
tested with cell extracts (Fig. 4D) or recombinantly expressed
PtSNAP (Fig. 4E), we could not find any cleavage of PtSNAP,
either by BoNT/A or by BoNT/E. Activity of the respective
Downloaded from ec.asm.org at 68523327 on January 15, 2009
stretch of four conserved cysteine residues (41, 75). However,
such a palmitoylation site is absent from the other mammalian
SNAPs, SNAP-29 and SNAP-47. Likewise, we found no palmitoylation signal in PtSNAP. In fact, there is not a single
cysteine residue in the amino acid sequence of PtSNAP on
which fatty acid modification could occur.
Experimental verification of PtSNAP by PCR and RT-PCR
methods. To verify the existence of the in silico-identified
PtSNAP gene and its in vivo expression, the genomic and
cDNA sequences of PtSNAP were amplified (Fig. 3A) with
specific PCR primers (Table 1 and Fig. 1, SNAP-B plus SNAPA), subcloned, and fully sequenced. Thus, the expression of the
gene, as well as the predicted intron position, was verified.
Since initially there were several possibilities for the position of
the ATG start codon, we also tried to obtain PCR products
from cDNA with primers covering an ATG further upstream
(SNAP-G plus SNAP-A) (Fig. 3B). The amplification products
were checked for the presence or absence of the intron by
sequencing or digestion with the restriction enzyme NsiI which
cuts within the intron sequence. Surprisingly, amplifications
from cDNA could be obtained with primers lying as far as 184
bp upstream of the predicted translation start point (SNAP-H
plus SNAP-A) (Fig. 3B). No RT-PCR products were obtained
with primers lying more than 184 bp upstream from the assumed starting ATG codon (SNAP-K/L/M/O/P plus SNAP-A)
(Fig. 3C). Thus, there were only two possible localizations of
the ATG start codon: at bp position 1 or at bp position ⫺116
(Fig. 1), resulting in a 20.8-kDa or a 25.3-kDa protein, respectively. To address this question, an antibody was raised against
amino acids Q11 to K175 of PtSNAP.
Detection of PtSNAP in Western blots. PtSNAPQ11-K175 was
recombinantly expressed in E. coli cells. This required substituting 19 TAA and TAG glutamine codons of Paramecium for
the CAA and CAG codons of the universal genetic code by PCR
methods (18). The recombinantly expressed PtSNAPQ11-K175
containing a C-terminal hexahistidine tag was purified by
affinity chromatography on Ni2⫹-nitrilotriacetate agarose
under denaturing conditions and was used for immunization
of a rabbit. Polyclonal antibodies were affinity-purified from
the final serum.
1394
SCHILDE ET AL.
EUKARYOT. CELL
botulinum toxins was demonstrated by the cleavage of endogenous SNAP-25 of PC-12 cells, detected with an anti-human
SNAP-25 antibody, or by the cleavage of recombinant mammalian SNAP-25. Using a negative control for BoNT/A cleavage, we also tested mutated BoNT/A* (E224Q), which is unable to cleave SNAP-25 (Fig. 4D and E). The mutated
BoNT/A* was also not active with PtSNAP but gave rise to
some higher-molecular-weight bands that are immunoreactive
with anti-PtSNAP, as if it were irreversibly binding to the
protein (Fig. 4D).
PtSNAP is distributed ubiquitously over the cell. Since initially there were two possibilities for the localization of the
ATG start codon of the PtSNAP gene, we cloned two versions
with a C-terminal GFP tag, one starting at ATG at bp position
1 and the other one starting at ATG bp position ⫺116. When
they were microinjected into P. tetraurelia macronuclei, both
versions resulted in identical localization patterns, and there
was no effect on cell viability. Both constructs gave a high
cytosolic GFP fluorescence, with exclusion of the macronucleus and the food vacuole lumen (Fig. 5A and B). Above the
strong cytosolic signal, staining of food vacuole membranes
and smaller vesicles and along the radial canals of the contrac-
tile vacuole system was observed (Fig. 5A and B, enlargement).
Attempts to reduce the strong cytosolic GFP fluorescence by
permeabilizing the cells with Triton X-100, digitonin, or saponin resulted in a complete loss of GFP fluorescence. Thus, the
majority of PtSNAP appears to be (detergent) soluble.
To visualize internal membrane structures, we fixed
PtSNAP-GFP expressing cells and analyzed them by confocal
microscopy. This reduced the cytosolic background fluorescence, and the staining of internal membranes became visible.
By using this method, we were able to visualize the food vacuole membranes, the cell surface membranes, the radial canals,
and the central vacuole of the contractile vacuole system (Fig.
5C and D). Unexpectedly, there was also signal from cilia and
from within the macronucleus. The presence of this signal
contrasts with that observed from living cells, where the macronucleus was devoid of GFP fluorescence (Fig. 5A, B), while
staining of cilia in living cells could not be resolved due to their
movement, which was faster than the camera frame-grabbing
rate. In both cases, we suspect a redistribution of soluble
PtSNAP upon fixation.
We also found PtSNAP-GFP staining between docked trichocysts but not on trichocyst tips (Fig. 5E and F). Enhanced
Downloaded from ec.asm.org at 68523327 on January 15, 2009
FIG. 4. Western blot detection of PtSNAP in P. tetraurelia cell lysates. (A) An affinity-purified anti-PtSNAP antibody recognizes two bands of 20 and
21 kDa (white and gray arrowheads) each. An additional PtSNAP-cross-reactive band (black arrowhead) of ⬃46 kDa is induced by boiling (⫹) the
samples and is not present when boiling is omitted (⫺; right lane). Asterisks indicate probable degradation products of PtSNAP. (B) Distribution of the
20- and 21-kDa PtSNAP-immunoreactive bands is indicated by white and gray arrowheads in cell fractionations (L, lysate; S1, supernatant; P1, pellet)
and in samples treated (S2, supernatant; P2, pellet) with 1% Triton X-100, 2 M NaCl, 4 M urea, 100 mM NaCO3 and 1 M hydroxylamine. (C) Differential
distribution of the 20- and 21-kDa PtSNAP immunoreactive bands in a 10 to 30% Optiprep gradient after equilibrium centrifugation. Dense membranes
segregate to the top of the gradient (left); less dense membranes and soluble material accumulate at the bottom (right). Arrowheads indicate distribution
as described in the legend to panel A. (D) Treatments of P. tetraurelia cell lysates (L, left) or control reactions of PC12 cell lysates (L, right) with BoNT/A,
mutated inactive BoNT/A* (E224Q), and BoNT/E are shown. The mutated BoNT/A* gave rise to some higher-molecular-weight bands that are
immunoreactive with anti-PtSNAP antibody. (E) Coomassie blue-stained gels of recombinant PtSNAP (rPtSNAP, top) and a recombinant mammalian
SNAP-25 test substrate (rSNAP-25, bottom) treated with BoNT/A, mutated inactive BoNT/A* (E224Q), and BoNT/E.
VOL. 7, 2008
SNAP-25 IN PARAMECIUM
1395
Downloaded from ec.asm.org at 68523327 on January 15, 2009
FIG. 5. GFP fluorescence in live cells microinjected with a long version (PtSNAP-lv-GFP) (A) and a short version (PtSNAP-sv-GFP) (B), with
enlarged details of stained vacuole membranes (middle) and corresponding bright field image (far right). Note that the stained food vacuole (fv)
1396
SCHILDE ET AL.
EUKARYOT. CELL
staining at a position diagonal and posterior to trichocysts
possibly represents parasomal sacs or other vesicles of the
endosomal system (Fig. 5F).
To consolidate the data obtained from GFP overexpression,
we used the affinity-purified anti-PtSNAP antibody for localization of PtSNAP by immunostaining. Staining of food vacuole membranes (Fig. 6A) and along the radial canals and of the
central vacuole of the contractile vacuole system (Fig. 6B)
could be confirmed. Staining peripherally between trichocysts
(Fig. 6A) was also found and probably represents endoplasmic
reticulum (ER) subdomains. Furthermore, we also observed
staining with anti-PtSNAP in the macronucleus, confirming the
results obtained from fixed PtSNAP-GFP-expressing cells (Fig.
6B). Staining of the sites of constitutive endo- and exocytosis
(parasomal sacs) with anti-PtSNAP is visible when we focused
on the cell surface (Fig. 6C). To correctly address the punctate
surface staining pattern, we also performed confocal microscopy imaging with cells double stained for PtSNAP and ␣-tu-
has moved during the objective lens change in the enlargement shown at the right compared to that shown at the left. mac, unstained macronucleus.
(B, middle panel) A vacuole (vac) is located on top of the dark appearing macronucleus. The radial canals (rc) and ampullae (amp) of the
contractile vacuole system are also weakly stained. (C to F) Confocal image slices (thickness, 1 ␮m) of fixed PtSNAP-sv-GFP-expressing cells. (C)
Median slice showing staining of the membrane of food vacuoles, in the vicinity of trichocysts (tr; the dark, carrot-shaped cortical objects), on cilia
(ci) and inside the macronucleus. (D) Median slice showing staining of radial canals and the central contractile vacuole of the contractile vacuole
system, between trichocysts and inside the macronucleus. (E) Superficial slice showing staining of dot-like structures and the whole cell surface.
cs, cytostome. (F) Enlarged image of a superficial slice showing staining of the whole cell surface and on the regularly arranged parasomal sacs
(ps; encircled, between dark trichocysts) but not on trichocyst tips (trt) (indicated by arrows), whose positions can be extrapolated from their
regular pattern. Scale bars ⫽ 10 ␮m.
Downloaded from ec.asm.org at 68523327 on January 15, 2009
FIG. 6. Immunostaining with an affinity-purified anti-PtSNAP antibody. Left panels show the whole cells, and right panels show an enlargement
of the indicated areas. (A) Median view showing staining of food vacuole membranes (fv) alongside the cytostome (cs) and between trichocysts.
(B) Median view showing staining of the radial canals (rc) and central pulsating vacuole of the contractile vacuole system, as well as staining of
the macronucleus (mac). (C) Surface focus showing staining of regularly arranged parasomal sacs. Occasional doublets of parasomal sacs, indicated
by arrows, may possibly represent division situations. Scale bars ⫽ 10 ␮m.
VOL. 7, 2008
SNAP-25 IN PARAMECIUM
1397
Downloaded from ec.asm.org at 68523327 on January 15, 2009
FIG. 7. Confocal microscopy image slices (0.9 ␮m, thickness) of a P. tetraurelia cell double stained with anti-PtSNAP (green) and anti-␣-tubulin
(red) antibodies. (A) Overview of a slice from the cortical region. The outline of the cell is indicated by a thin white oval line, with the anterior
end of the cell orientated at the top. (B, C, and D) Enlarged details from the boxed regions of panel A. The regular staining pattern probably
represents parasomal sacs (green), generally one juxtaposed to duplicate basal bodies (red, arrows). Scale bar ⫽ 10 ␮m.
bulin (Fig. 7). We observed PtSNAP antibody staining at the
cytostome (Fig. 7B), where a great number of parasomal sacs
are located (R. D. Allen, electron micrograph [http://www5
.pbrc.hawaii.edu/allen/ch10/14-pca740125-18.html]), and on
the cell surface in very close apposition to basal bodies (Fig. 7C
and D). However, discriminating between the 20- and 21-kDa
forms of PtSNAP was not possible with this method. In summary, we found PtSNAP in a regular cortical pattern, at food
vacuoles, between trichocysts, and on the radial arms and central vacuole of the contractile vacuole system.
Dissection of PtSNAP function by gene silencing. Owing to
its homology to SNAP-25, the SNARE involved in stimulated
exocytosis in neuronal cells, and because Paramecium is capa-
ble of stimulated exocytosis of dense core vesicles, we first
concentrated on the effects of the PtSNAP posttranscriptional
gene silencing on the exocytosis of trichocysts. Surprisingly,
however, we could find no such effect for PtSNAP. Exocytosis
stimulated with picric acid (a fixing agent used for rapid genetic screening) or with the secretagogue AED occurred to the
same extent as that of the wild-type control cells (Fig. 8A, B).
Also, neither the docking of trichocysts nor their ability to
decondense their contents was affected in PtSNAP-silenced
cells. However, when those cells were examined with a light
microscope, they appeared completely filled with food vacuoles (Fig. 8D and G). There was also no effect of PtSNAP
silencing on cell viability. We even observed a consistent, al-
1398
SCHILDE ET AL.
DISCUSSION
Number of SNAP-25 genes. The SNAP-25-like proteins belonging to the class of Qb/Qc-SNAREs are the only examples
known so far of dual-SNARE-motif-containing proteins (40).
Here, we identify and characterize a single SNAP-25 homologue in the ciliate P. tetraurelia. Like all SNAREs of ciliates
(37, 61), it shares only a low degree of overall sequence homology with mammalian homologues. However, a gene similar
to the SNAP-25 gene (TTHERM_00526630) exists in the related ciliate T. thermophila, and it will be interesting to see if
there are similar homologues found in other ciliates. This
would be important to ascertaining an evolutionary origin of
SNAP-25-like genes before the emergence of multicellular organisms. Three SNAP-25 homologues have also been identified in the plant Arabidopsis thaliana (30), a genus that
branched off in the phylogenetic tree well before the fungus/
animal split (10). There is, however, no evidence so far for a
role of those SNAP-25 homologues in stimulated exocytosis
outside the animal kingdom. So, if SNAP-25-like genes were
part of the original gene repertoire of the last common eukaryotic ancestor, what was their exact role? Were they originally involved in membrane fusion or associated with other
cellular processes? A more comprehensive sampling of SNAP25-like genes from other taxa will be necessary to answer these
questions.
The PtSNAP gene apparently has retained no sister isoform from the recent genome duplication (8). Instead, there
is a deletion in the corresponding region of the sister scaffold_121. Similarly, there is only a single SNAP-25 gene
homologue present in the genome of T. thermophila
(TTHERM_00526630) (20). This finding was surprising because mammals contain at least four SNAP-25 homologues,
SNAP-23, SNAP-25, SNAP-29, and SNAP-47 (40), which can
be functionally diversified further by alternative splicing. Ciliates, however, possess no alternative splicing, and, therefore,
all Qb/c-SNARE functions have to be performed by a single
PtSNAP gene product.
Posttranslational modification. All plant SNAP-25-like proteins lack the conserved cysteine cluster of mammalian
SNAP-25 that could act as attachment points for palmitate
residues. However, the A. thaliana SNAP-33 (AtSNAP-33)
protein, which is also devoid of a central cysteine cluster, at
least was shown to localize to the plasma membrane (30),
although the mechanism of its membrane attachment is also
not known. There is evidence for an N-myristoylation sequence
motif (G83-L88) at an equivalent position of the cysteine cluster in PtSNAP, but this localization between the two SNARE
motifs does not agree with conventional N-terminal co- or
posttranslational myristoylation. On the other hand, it has
been reported that myristoyl residues can be posttranslationally attached to lysine residues (68, 69), so it is possible that
myristoylation on one or several of the numerous lysine residues of PtSNAP could occur. Likewise, palmitoylation of lysine
residues had been found in adenylate cyclase toxin by mass
spectrometry (26). At this point, we cannot exclude the possibility that this modification pathway is used in Paramecium.
Because myristoylation or palmitoylation on lysine residues is
through O-ester and not through thioester bonds, the treatment with 1 M hydroxylamine at a neutral pH would not
necessarily have hydrolyzed these bonds. Therefore, we cannot
with certainty exclude fatty acid modification of PtSNAP. Another possibility is that the smaller PtSNAP immunoreactive
band simply represents a proteolytic degradation product of
the full-length protein, because the relative ratios detected
between those two bands showed some variability between
experiments.
Insensitivity of PtSNAP to botulinum toxins. Using biochemical methods, we find PtSNAP is not cleaved by BoNT/A
or BoNT/E, even though the site of BoNT/E cleavage is conserved in the primary amino acid sequence of PtSNAP. However, because the recognition motif of BoNTs is a conformational rather than an amino acid motif (13, 15), the great
evolutionary distance to mammals may entail that PtSNAP is
not a substrate for those toxins. Earlier analyses in our laboratory showed that injection of BoNT/A into Paramecium cells
had no effect on wild-type cells (75a), while it prevented redocking of trichocysts after chemically induced undocking with
cytochalasin B in nd9-1 cells at nonpermissive temperatures,
where trichocysts are attached to the cortical Ca2⫹ stores, but
not at the plasma membrane (50). These effects of BoNTs on
the redocking of detached trichocysts in nd9-1 cells may be
explained by unspecific cleavage of other proteins.
Localization of PtSNAP. We found that on Western blots,
PtSNAP appears in two different forms and that the highermolecular-weight form clearly behaves as a membrane-associated protein, even though any possible type of modification on
PtSNAP remains so far unknown. However, we cannot tell
which one of the two forms is posttranslationally modified or
whether both forms are posttranslationally modified. Both
PtSNAP forms sediment with different fractions on a density
gradient. We also found evidence for a dynamic distribution of
PtSNAP between a soluble cytosolic and a membrane-bound
pool, whereas the functional significance of this is still unclear.
Downloaded from ec.asm.org at 68523327 on January 15, 2009
though not statistically significant, increase in the division rate
of PtSNAP-silenced cells compared to that of controls (Fig. 8E
and F). The number of food vacuoles was increased (P ⬍
0.013) after 72 to 96 h of silencing compared to that of control
cells that were fed with the same strain of bacteria, while the
number of acidified food vacuoles, as determined by feeding
with pH-sensitive fluorophore-labeled bacteria, was unchanged (Fig. 8G). Efficient silencing was demonstrated by the
downregulation of PtSNAP levels after 72 h of silencing, as
probed in Western blots with the specific anti-PtSNAP antibody (Fig. 8H).
These results were surprising because of the central role of
mammalian SNAP-25 homologues in stimulated exocytosis
and because PtSNAP is the only candidate for a SNAP-25
gene-like gene identified in Paramecium so far. Additionally,
PtSNAP posttranslational gene silencing in exocytosis-deficient nd9-1 cells, where the trichocyst docking sites are not
formed, did not lead to a morphological undocking of trichocysts (data not shown).
According to the localization of PtSNAP in parasomal sacs,
we suspected it might have a function in the constitutive exocytosis of surface antigens. However, we could find no differences between the presence and expression patterns of surface
antigens A, B, D, and H of PtSNAP-silenced cells compared to
that of control cells (data not shown).
EUKARYOT. CELL
VOL. 7, 2008
SNAP-25 IN PARAMECIUM
1399
Downloaded from ec.asm.org at 68523327 on January 15, 2009
FIG. 8. Posttranscriptional gene silencing of PtSNAP (PtSNAP-RNAi). Stimulation of trichocyst release with picric acid in a control (A) and
a typical PtSNAP-silenced cell (B), both showing complete discharge of trichocysts. (C and D) Bright field images of a typical control cell (C) and a
PtSNAP-silenced cell (D) showing moderate enrichment of vacuoles in the latter. Scale bars ⫽ 10 ␮m. (E) Division rates of controls (black) and
PtSNAP-silenced cells (gray) from one set of experiments. Asterisks indicate a reduced division rate during the first 24 h of silencing due to a lag
effect after transfer from normal medium to feeding solution. Note the increased division rate of PtSNAP-silenced cells from 48 h onward. (F)
1400
SCHILDE ET AL.
EUKARYOT. CELL
FIG. 9. Paramecium trafficking network (based on data from R. D. Allen and A. K. Fok [3]) superimposed with PtSNAP distribution (green).
Dotted lines mark the path of organelles, whereas continuous arrows mark vesicle delivery pathways. Question marks indicate putative trafficking
pathways for which PtSNAP involvement has not been demonstrated so far. Abbreviations: as, acidosome; ci, cilium; cp, cytoproct; cph,
cytopharynx; cs, cytostome; cvc, contractile vacuole complex; ds, decorated spongiome of the cvc; dv, discoidal vesicle; ee, early endosome (terminal
cisterna); er, endoplasmic reticulum; fv, food vacuole; ga, Golgi apparatus; gh, ghost; pm, plasma membrane; ps, parasomal sac (coated pit); rv,
recycling vesicles; ss, smooth spongiome of the cvc; tr, trichocyst; trp, trichocyst precursor.
Native PtSNAP (molecular mass, 20.8 kDa), as well as the
GFP-fused molecule (molecular mass, 46.8 kDa), are small
enough to diffuse freely through nuclear pore complexes. We
assume an active mechanism for the retention of PtSNAP in
the cytosolic compartment, which becomes inactivated upon
fixation.
Functional aspects. Unlike the role expected from its homology to mammalian SNAP-25, we could not find a role for
PtSNAP in the stimulated exocytosis of dense core vesicles
(trichocysts). This was unexpected, because PtSNAP exists as a
single transcript and successful gene silencing could be demonstrated by Western blotting with the specific anti-PtSNAP
antibody. However, Paramecium contains several other Qband Qc-SNAREs (C. Schilde, unpublished results), so there
could be redundancy of function. Such a functional redundancy has been observed for SNAREs in many other cases (43,
62, 76). Accordingly, in certain mammalian cell types, posttranscriptional gene silencing or expression of a dominantnegative mutant form of SNAP-23 has not led to any phenotypic defects in secretion, even though SNAP-23 is the only
SNAP-25 homologue normally present in those cells (49). In
conclusion, from our data, we cannot exclude the possibility
that redundancy of function masked a possible effect of
PtSNAP on trichocyst exocytosis.
We observed an increase in the number of food vacuoles per
cell in PtSNAP-silenced Paramecium cells. Feeding of silenced
cells with pH indicator Congo red-stained yeast cells showed
that this is due to an increased uptake of food vacuoles (data
not shown), not to a defect in food vacuole processing and/or
defecation, and we could exclude a defect in the acidification of
The averaged percentage difference in division rate between the control and PtSNAP-silenced cells is statistically significantly increased. Bar,
standard error of the mean (SEM); P value, from paired t test. (G) Increase in the total number of food vacuoles in PtSNAP-silenced cells. Shown
are averages of the number of food vacuoles per cell in control (black) and PtSNAP-silenced cells (gray). No change in the number of acidified
vacuoles was found (hatched columns). Bars, SEM P value, from unpaired t test. (H) Demonstration of successful PtSNAP gene silencing by
Western blotting of lysates from cells with different durations of silencing detected with the anti-PtSNAP antibody. In PtSNAP-silenced cells,
PtSNAP becomes highly reduced from the third day of silencing onward (bottom). No decrease is seen in the loading control detected with an
anti-proteindisulfide-isomerase (anti-PtPDI) antibody (top).
Downloaded from ec.asm.org at 68523327 on January 15, 2009
We could localize PtSNAP on a number of internal membranes, i.e., the membranes of food vacuoles, the contractile
vacuole system, and the internal ER subdomains and parasomal sacs, as well as on the plasma membrane (Fig. 9). Furthermore, there is a large cytosolic pool of PtSNAP. This suggests
the involvement of PtSNAP in a number of membrane fusion
processes. We could not detect any accumulation of PtSNAP
on trichocyst tips, where exocytic fusion sites are preformed.
However, we saw an overall labeling of the cell surface in fixed
PtSNAP-GFP-expressing cells equivalent to the localization of
SNAP-25 in neuronal and neuroendocrine cells. Labeling of
PtSNAP-GFP in the vicinity of trichocysts probably represents
peripheral ER extensions. The pronounced labeling of the sites
of constitutive endo- and exocytosis, the parasomal sacs, with
both the PtSNAP-GFP construct and the anti-PtSNAP antibody suggests the involvement of PtSNAP in membrane trafficking there. Because several other SNAREs were found in
those compartments (37, 61; C. Schilde, unpublished results),
we expect that PtSNAP is a SNARE partner in several different SNARE complexes there. A challenging finding is the
occurrence of PtSNAP in the contractile vacuole system.
Again, several other SNAREs (37, 61; C. Schilde, unpublished
data), as well the SNARE-specific chaperone NSF (36), localize to the contractile vacuole system as if there was a high
extent of membrane trafficking. At this time, we can only speculate about the function of SNAREs in the osmoregulatory
system.
The observation of macronuclear PtSNAP after fixation of
cells but not before needs further explanation. Most likely
there is a redistribution of soluble PtSNAP during fixation.
VOL. 7, 2008
SNAP-25 IN PARAMECIUM
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
ACKNOWLEDGMENTS
We thank T. Wassmer (presently, University of Bristol, United
Kingdom) for microinjection of the PtSNAP-GFP constructs, E. Ladenburger (University of Konstanz) for provision of the anti-PDI antibody, M. Simon (Technical University of Kaiserslautern, Germany) for
the surface antigen antibodies, and E. May for access to the Zeiss
LSM510 Meta confocal microscope (University of Konstanz). We
thank N. Dierdorf, D. Loeffler, and A. Stemke for technical support
and R. Vögele for the gift of the pRV11 expression vector (all, University of Konstanz). We also acknowledge early access to the P.
tetraurelia genome sequence provided by J. Cohen and L. Sperling
(CGM, CNRS, Gif-Sur-Yvette, France).
This work was supported by Deutsche Forschungsgemeinschaft TRSFB11 project C4 and grant PL78/20-3, both to H.P.
REFERENCES
1. Allen, R. D. 2000. The contractile vacuole and its membrane dynamics.
Bioessays 22:1035–1042.
2. Allen, R. D. 1974. Food vacuole membrane growth with microtubule-associated membrane transport in Paramecium. J. Cell Biol. 63:904–922.
3. Allen, R. D., and A. K. Fok. 2000. Membrane trafficking and processing in
Paramecium. Int. Rev. Cytol. 198:277–318.
4. Allen, R. D., and A. K. Fok. 1983. Phagosome fusion vesicles of Paramecium.
I. Thin-section morphology. Eur. J. Cell Biol. 29:150–158.
5. Allen, R. D., and A. K. Fok. 1983. Phagosome fusion vesicles of Paramecium.
II. Freeze-fracture evidence for membrane replacement. Eur. J. Cell Biol.
29:159–165.
6. Altschul, S. F., T. L. Madden, A. A. Schaffer, J. Zhang, Z. Zhang, W. Miller,
and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation
of protein database search programs. Nucleic Acids Res. 25:3389–3402.
7. Antonin, W., D. Fasshauer, S. Becker, R. Jahn, and T. R. Schneider. 2002.
Crystal structure of the endosomal SNARE complex reveals common structural principles of all SNAREs. Nat. Struct. Biol. 9:107–111.
8. Aury, J. M., O. Jaillon, L. Duret, B. Noel, C. Jubin, B. M. Porcel, B.
Segurens, V. Daubin, V. Anthouard, N. Aiach, O. Arnaiz, A. Billaut, J.
Beisson, I. Blanc, K. Bouhouche, F. Camara, S. Duharcourt, R. Guigo, D.
Gogendeau, M. Katinka, A. M. Keller, R. Kissmehl, C. Klotz, F. Koll, A. Le
Mouel, G. Lepere, S. Malinsky, M. Nowacki, J. K. Nowak, H. Plattner, J.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
Poulain, F. Ruiz, V. Serrano, M. Zagulski, P. Dessen, M. Betermier, J.
Weissenbach, C. Scarpelli, V. Schachter, L. Sperling, E. Meyer, J. Cohen,
and P. Wincker. 2006. Global trends of whole-genome duplications revealed
by the ciliate Paramecium tetraurelia. Nature 444:171–178.
Bairoch, A., P. Bucher, and K. Hofmann. 1997. The PROSITE database, its
status in 1997. Nucleic Acids Res. 25:217–221.
Baldauf, S. L., A. J. Roger, I. Wenk-Siefert, and W. F. Doolittle. 2000. A
kingdom-level phylogeny of eukaryotes based on combined protein data.
Science 290:972–977.
Bark, I. C. 1993. Structure of the chicken gene for SNAP-25 reveals duplicated exon encoding distinct isoforms of the protein. J. Mol. Biol. 233:67–76.
Bateman, A., L. Coin, R. Durbin, R. D. Finn, V. Hollich, S. Griffiths-Jones,
A. Khanna, M. Marshall, S. Moxon, E. L. Sonnhammer, D. J. Studholme, C.
Yeats, and S. R. Eddy. 2004. The Pfam protein families database. Nucleic
Acids Res. 32:D138–D141.
Breidenbach, M. A., and A. T. Brunger. 2004. Substrate recognition strategy
for botulinum neurotoxin serotype A. Nature 432:925–929.
Brennwald, P., B. Kearns, K. Champion, S. Keranen, V. Bankaitis, and P.
Novick. 1994. Sec9 is a SNAP-25-like component of a yeast SNARE complex
that may be the effector of Sec4 function in exocytosis. Cell 79:245–258.
Chen, S., and J. T. Barbieri. 2007. Multiple pocket recognition of SNAP25
by botulinum neurotoxin serotype E. J. Biol. Chem. 282:25540–25547.
Couve, A., and J. E. Gerst. 1994. Yeast Snc proteins complex with Sec9.
Functional interactions between putative SNARE proteins. J. Biol. Chem.
269:23391–23394.
Dessen, P., M. Zagulski, R. Gromadka, H. Plattner, R. Kissmehl, E. Meyer,
M. Betermier, J. E. Schultz, J. U. Linder, R. E. Pearlman, C. Kung, J.
Forney, B. H. Satir, J. L. Van Houten, A. M. Keller, M. Froissard, L.
Sperling, and J. Cohen. 2001. Paramecium genome survey: a pilot project.
Trends Genet. 17:306–308.
Dillon, P. J., and C. A. Rosen. 1993. Use of polymerase chain reaction for the
rapid construction of synthetic genes. Methods Mol. Biol. 15:263–269.
Dryl, S. 1959. Effect of adaptation to the environment on chemotaxis of
Paramecium caudatum. Acta Biol. Exp. 19:83–93.
Eisen, J. A., R. S. Coyne, M. Wu, D. Wu, M. Thiagarajan, J. R. Wortman,
J. H. Badger, Q. Ren, P. Amedeo, K. M. Jones, L. J. Tallon, A. L. Delcher,
S. L. Salzberg, J. C. Silva, B. J. Haas, W. H. Majoros, M. Farzad, J. M.
Carlton, R. K. Smith, Jr., J. Garg, R. E. Pearlman, K. M. Karrer, L. Sun, G.
Manning, N. C. Elde, A. P. Turkewitz, D. J. Asai, D. E. Wilkes, Y. Wang, H.
Cai, K. Collins, B. A. Stewart, S. R. Lee, K. Wilamowska, Z. Weinberg, W. L.
Ruzzo, D. Wloga, J. Gaertig, J. Frankel, C. C. Tsao, M. A. Gorovsky, P. J.
Keeling, R. F. Waller, N. J. Patron, J. M. Cherry, N. A. Stover, C. J. Krieger,
C. del Toro, H. F. Ryder, S. C. Williamson, R. A. Barbeau, E. P. Hamilton,
and E. Orias. 2006. Macronuclear genome sequence of the ciliate Tetrahymena thermophila, a model eukaryote. PLoS Biol. 4:e286.
Fasshauer, D., R. B. Sutton, A. T. Brunger, and R. Jahn. 1998. Conserved
structural features of the synaptic fusion complex: SNARE proteins reclassified as Q.- and R-SNAREs. Proc. Natl. Acad. Sci. USA 95:15781–15786.
Froissard, M., R. Kissmehl, J. C. Dedieu, T. Gulik-Krzywicki, H. Plattner,
and J. Cohen. 2002. N-ethylmaleimide-sensitive factor is required to organize functional exocytotic microdomains in Paramecium. Genetics 161:643–
650.
Galvani, A., and L. 2002. Sperling. RNA interference by feeding in Paramecium. Trends Genet. 18:11–12.
Godiska, R., K. J. Aufderheide, D. Gilley, P. Hendrie, T. Fitzwater, L. B.
Preer, B. Polisky, and J. R. Preer, Jr. 1987. Transformation of Paramecium
by microinjection of a cloned serotype gene. Proc. Natl. Acad. Sci. USA
84:7590–7594.
Grote, E., C. M. Carr, and P. J. Novick. 2000. Ordering the final events in
yeast exocytosis. J. Cell Biol. 151:439–452.
Hackett, M., L. Guo, J. Shabanowitz, D. F. Hunt, and E. L. Hewlett. 1994.
Internal lysine palmitoylation in adenylate cyclase toxin from Bordetella
pertussis. Science 266:433–435.
Hauser, K., W. J. Haynes, C. Kung, H. Plattner, and R. Kissmehl. 2000.
Expression of the green fluorescent protein in Paramecium tetraurelia. Eur.
J. Cell Biol. 79:144–149.
Haynes, W. J., K. Y. Ling, Y. Saimi, and C. Kung. 1995. Induction of
antibiotic resistance in Paramecium tetraurelia by the bacterial gene APH3⬘-II. J. Eukaryot. Microbiol. 42:83–91.
Haynes, W. J., B. Vaillant, R. R. Preston, Y. Saimi, and C. Kung. 1998. The
cloning by complementation of the pawn-A gene in Paramecium. Genetics
149:947–957.
Heese, M., X. Gansel, L. Sticher, P. Wick, M. Grebe, F. Granier, and G.
Jurgens. 2001. Functional characterization of the KNOLLE-interacting tSNARE AtSNAP33 and its role in plant cytokinesis. J. Cell Biol. 155:239–
249.
Holt, M., F. Varoqueaux, K. Wiederhold, S. Takamori, H. Urlaub, D.
Fasshauer, and R. Jahn. 2006. Identification of SNAP-47, a novel QbcSNARE with ubiquitous expression. J. Biol. Chem. 281:17076–17083.
Jahn, R., and R. H. Scheller. 2006. SNAREs: engines for membrane fusion.
Nat. Rev. Mol. Cell Biol. 7:631–643.
Downloaded from ec.asm.org at 68523327 on January 15, 2009
food vacuoles. Another possibility is that the total capacity of
the digestive system is limited by the availability of acidosomes.
The slightly enhanced division rate of PtSNAP-silenced cells
could point to an increased energy supply from an increased
number of food vacuoles. The localization of PtSNAP observed at the cytostome could indicate a role there in food
uptake.
Attenuation of SNARE expression does not always have to
be deleterious, as shown by the improved salt tolerance of A.
thaliana plants depleted of AtVAMP714 (42). Also, a role for
so-called inhibitory SNAREs in fine-tuning membrane fusion
specificity by engagement in nonproductive SNARE complexes has been suggested (73). Thus, the lack of a deleterious
effect of PtSNAP silencing could be explained by a release of
an inhibition state, if PtSNAP would act as an inhibitory
SNARE. A closer investigation of the effects of PtSNAP gene
silencing on food vacuole processing will be needed to clarify
the exact role of PtSNAP in this process.
Conclusions. In summary, the present work is the first investigation of a SNAP-25 homologue in protists and opens the
exciting opportunity to study the role of such dual-SNAREmotif-containing proteins outside the animal kingdom. The
results from the glutamine-rich PtSNAP of Paramecium are
important because a similar asparagine-rich SNAP-25 homologue exists in the malaria parasite Plasmodium falciparum
(gi|23619154), an apicomplexan related to ciliates, both of
which are contained in the phylum Alveolata. Although it is
difficult to assign a precise role to PtSNAP in the phagocytic
cycle, it evidently plays a role in this complex process.
1401
1402
SCHILDE ET AL.
nucleotide introns are the standard length in Paramecium tetraurelia. Nucleic
Acids Res. 22:1221–1225.
58. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a
laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY.
59. Scales, S. J., B. Y. Yoo, and R. H. Scheller. 2001. The ionic layer is required
for efficient dissociation of the SNARE complex by alpha-SNAP and NSF.
Proc. Natl. Acad. Sci. USA 98:14262–14267.
60. Schägger, H. 2006. Tricine-SDS-PAGE. Nat. Protoc. 1:16–22.
61. Schilde, C., T. Wassmer, J. Mansfeld, H. Plattner, and R. Kissmehl. 2006. A
multigene family encoding R-SNAREs in the ciliate Paramecium tetraurelia.
Traffic 7:440–455.
62. Schoch, S., F. Deak, A. Konigstorfer, M. Mozhayeva, Y. Sara, T. C. Sudhof,
and E. T. Kavalali. 2001. SNARE function analyzed in synaptobrevin/VAMP
knockout mice. Science 294:1117–1122.
63. Søgaard, M., K. Tani, R. R. Ye, S. Geromanos, P. Tempst, T. Kirchhausen,
J. E. Rothman, and T. Söllner. 1994. A rab protein is required for the
assembly of SNARE complexes in the docking of transport vesicles. Cell
78:937–948.
64. Söllner, T., M. K. Bennett, S. W. Whiteheart, R. H. Scheller, and J. E.
Rothman. 1993. A protein assembly-disassembly pathway in vitro that may
correspond to sequential steps of synaptic vesicle docking, activation, and
fusion. Cell 75:409–418.
65. Sonneborn, T. M. 1974. Paramecium aurelia, p. 469–594. In R. C. Kung (ed.),
Handbook of genetics, vol. 2. Plenum Press, New York, NY.
66. Sperling, L., P. Dessen, M. Zagulski, R. E. Pearlman, A. Migdalski, R.
Gromadka, M. Froissard, A. M. Keller, and J. Cohen. 2002. Random sequencing of Paramecium somatic DNA. Eukaryot. Cell 1:341–352.
67. Steegmaier, M., B. Yang, J. S. Yoo, B. Huang, M. Shen, S. Yu, Y. Luo, and
R. H. Scheller. 1998. Three novel proteins of the syntaxin/SNAP-25 family.
J. Biol. Chem. 273:34171–34179.
68. Stevenson, F. T., S. L. Bursten, C. Fanton, R. M. Locksley, and D. H. Lovett.
1993. The 31-kDa precursor of interleukin 1 alpha is myristoylated on specific lysines within the 16-kDa N-terminal propiece. Proc. Natl. Acad. Sci.
USA 90:7245–7249.
69. Stevenson, F. T., S. L. Bursten, R. M. Locksley, and D. H. Lovett. 1992.
Myristyl acylation of the tumor necrosis factor alpha precursor on specific
lysine residues. J. Exp. Med. 176:1053–1062.
70. Sutton, R. B., D. Fasshauer, R. Jahn, and A. T. Brunger. 1998. Crystal
structure of a SNARE complex involved in synaptic exocytosis at 2.4 Å
resolution. Nature 395:347–353.
71. Timmons, L., D. L. Court, and A. Fire. 2001. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in
Caenorhabditis elegans. Gene 263:103–112.
72. Ungermann, C., and D. Langosch. 2005. Functions of SNAREs in intracellular membrane fusion and lipid bilayer mixing. J. Cell Sci. 118:3819–3828.
73. Varlamov, O., A. Volchuk, V. Rahimian, C. A. Doege, F. Paumet, W. S. Eng,
N. Arango, F. Parlati, M. Ravazzola, L. Orci, T. H. Sollner, and J. E.
Rothman. 2004. i-SNAREs: inhibitory SNAREs that fine-tune the specificity
of membrane fusion. J. Cell Biol. 164:79–88.
74. Vayssié, L., F. Skouri, L. Sperling, and J. Cohen. 2000. Molecular genetics of
regulated secretion in Paramecium. Biochimie 82:269–288.
75. Veit, M., T. H. Sollner, and J. E. Rothman. 1996. Multiple palmitoylation of
synaptotagmin and the t-SNARE SNAP-25. FEBS Lett. 385:119–123.
75a.Vetter, D. 1996. Functional analysis of trichocyst exocytosis in Paramecium
cells by clostridium toxins. Diploma thesis. University of Constance, Konstanz, Germany.
76. Washbourne, P., P. M. Thompson, M. Carta, E. T. Costa, J. R. Mathews, G.
Lopez-Bendito, Z. Molnar, M. W. Becher, C. F. Valenzuela, L. D. Partridge,
and M. C. Wilson. 2002. Genetic ablation of the t-SNARE SNAP-25 distinguishes mechanisms of neuroexocytosis. Nat. Neurosci. 5:19–26.
77. Wassmer, T., M. Froissard, H. Plattner, R. Kissmehl, and J. Cohen. 2005.
The vacuolar proton-ATPase plays a major role in several membranebounded organelles in Paramecium. J. Cell Sci. 118:2813–2825.
78. Wickner, W., and A. Haas. 2000. Yeast homotypic vacuole fusion: a window
on organelle trafficking mechanisms. Annu. Rev. Biochem. 69:247–275.
79. Wirsel, S. G. R., R. Vögele, R. Bänninger, and K. W. Mendgen. 2004. Cloning
of ␤-tubulin and succinate dehydrogenase genes from Uromyces fabae and
establishing selection conditions for their use in transformation. Eur. J. Plant
Pathol. 110:767–777.
80. Zagulski, M., J. K. Nowak, A. Le Mouel, M. Nowacki, A. Migdalski, R.
Gromadka, B. Noel, I. Blanc, P. Dessen, P. Wincker, A. M. Keller, J. Cohen,
E. Meyer, and L. Sperling. 2004. High coding density on the largest Paramecium tetraurelia somatic chromosome. Curr. Biol. 14:1397–1404.
Downloaded from ec.asm.org at 68523327 on January 15, 2009
33. Jones, D. T. 1998. Do transmembrane protein superfolds exist? FEBS Lett.
423:281–285.
34. Jones, D. T. 1999. Protein secondary structure prediction based on positionspecific scoring matrices. J. Mol. Biol. 292:195–202.
35. Jones, D. T., W. R. Taylor, and J. M. Thornton. 1994. A model recognition
approach to the prediction of all-helical membrane protein structure and
topology. Biochemistry 33:3038–3049.
36. Kissmehl, R., M. Froissard, H. Plattner, M. Momayezi, and J. Cohen. 2002.
NSF regulates membrane traffic along multiple pathways in Paramecium.
J. Cell Sci. 115:3935–3946.
37. Kissmehl, R., C. Schilde, T. Wassmer, C. Danzer, K. Nuehse, K. Lutter, and
H. Plattner. 2007. Molecular identification of 26 syntaxin genes and their
assignment to the different trafficking pathways in Paramecium. Traffic
8:523–542.
38. Kissmehl, R., I. M. Sehring, E. Wagner, and H. Plattner. 2004. Immunolocalization of actin in Paramecium cells. J. Histochem. Cytochem. 52:1543–
1559.
39. Kissmehl, R., T. Treptau, H. W. Hofer, and H. Plattner. 1996. Protein
phosphatase and kinase activities possibly involved in exocytosis regulation
in Paramecium tetraurelia. Biochem. J. 317:65–76.
40. Kloepper, T. H., C. N. Kienle, and D. Fasshauer. 2007. An elaborate classification of SNARE proteins sheds light on the conservation of the eukaryotic endomembrane system. Mol. Biol. Cell 18:3463–3471.
41. Lane, S. R., and Y. Liu. 1997. Characterization of the palmitoylation domain
of SNAP-25. J. Neurochem. 69:1864–1869.
42. Leshem, Y., N. Melamed-Book, O. Cagnac, G. Ronen, Y. Nishri, M.
Solomon, G. Cohen, and A. Levine. 2006. Suppression of Arabidopsis
vesicle-SNARE expression inhibited fusion of H2O2-containing vesicles
with tonoplast and increased salt tolerance. Proc. Natl. Acad. Sci. USA
103:18008–18013.
43. Lipka, V., C. Kwon, and R. Panstruga. 2007. SNARE-ware: the role of
SNARE-domain proteins in plant biology. Annu. Rev. Cell Dev. Biol. 23:
147–174.
44. Littleton, J. T., E. R. Chapman, R. Kreber, M. B. Garment, S. D. Carlson,
and B. Ganetzky. 1998. Temperature-sensitive paralytic mutations demonstrate that synaptic exocytosis requires SNARE complex assembly and disassembly. Neuron 21:401–413.
45. Marchler-Bauer, A., J. B. Anderson, P. F. Cherukuri, C. DeWeese-Scott,
L. Y. Geer, M. Gwadz, S. He, D. I. Hurwitz, J. D. Jackson, Z. Ke, C. J.
Lanczycki, C. A. Liebert, C. Liu, F. Lu, G. H. Marchler, M. Mullokandov,
B. A. Shoemaker, V. Simonyan, J. S. Song, P. A. Thiessen, R. A. Yamashita,
J. J. Yin, D. Zhang, and S. H. Bryant. 2005. CDD: a conserved domain
database for protein classification. Nucleic Acids Res. 33:D192–D196.
46. Marvaud, J. C., S. Raffestin, and M. R. Popoff. 2002. Botulism: the agent,
mode of action of the botulinum neurotoxins, forms of acquisition, treatment
and prevention. C. R. Biol. 325:863–878. (In French.)
47. McGuffin, L. J., K. Bryson, and D. T. Jones. 2000. The PSIPRED protein
structure prediction server. Bioinformatics 16:404–405.
48. Morrison, D. F., P. J. O’Brien, and D. R. Pepperberg. 1991. Depalmitylation
with hydroxylamine alters the functional properties of rhodopsin. J. Biol.
Chem. 266:20118–20123.
49. Okayama, M., T. Arakawa, I. Mizoguchi, Y. Tajima, and T. Takuma. 2007.
SNAP-23 is not essential for constitutive exocytosis in HeLa cells. FEBS
Lett. 581:4583–4588.
50. Pape, R., and H. Plattner. 1990. Secretory organelle docking at the cell
membrane of Paramecium cells: dedocking and synchronized redocking of
trichocysts. Exp. Cell Res. 191:263–272.
51. Pepperberg, D. R., D. F. Morrison, and P. J. O’Brien. 1995. Depalmitoylation of rhodopsin with hydroxylamine. Methods Enzymol. 250:348–361.
52. Plattner, H., and R. Kissmehl. 2003. Dense-core secretory vesicle docking
and exocytotic membrane fusion in Paramecium cells. Biochim. Biophys.
Acta 1641:183–193.
53. Plattner, H., and R. Kissmehl. 2003. Molecular aspects of membrane trafficking in Paramecium. Int. Rev. Cytol. 232:185–216.
54. Plattner, H., H. Matt, H. Kersken, B. Haacke, and R. Stürzl. 1984. Synchronous exocytosis in Paramecium cells. I. A novel approach. Exp. Cell Res.
151:6–13.
55. Plonne, D., I. Cartwright, W. Linss, R. Dargel, J. M. Graham, and J. A.
Higgins. 1999. Separation of the intracellular secretory compartment of rat
liver and isolated rat hepatocytes in a single step using self-generating gradients of iodixanol. Anal. Biochem. 276:88–96.
56. Pollack, S. 1974. Mutations affecting the trichocysts in Paramecium aurelia.
I. Morphology and description of the mutants. J. Protozool. 21:352–362.
57. Russell, C. B., D. Fraga, and R. D. Hinrichsen. 1994. Extremely short 20–33
EUKARYOT. CELL