Download Lgi1 null mutant mice exhibit myoclonic seizures

Human Molecular Genetics, 2010, Vol. 19, No. 9
doi:10.1093/hmg/ddq047
Advance Access published on February 3, 2010
1702–1711
Lgi1 null mutant mice exhibit myoclonic seizures
and CA1 neuronal hyperexcitability
Y. Eugene Yu3,∗ , {, Lei Wen2,{, Jeane Silva1, Zhongyou Li3, Karen Head3, Khalid Sossey-Alaoui3,{,
Annie Pao3, Lin Mei2 and John K. Cowell1,∗
1
MCG Cancer Center, School of Medicine and 2Institute of Molecular Medicine and Genetics, and Department of
Neurology, Medical College of Georgia, Augusta, GA 30912, USA and 3Department of Cancer Genetics, Roswell Park
Cancer Institute, Buffalo, NY 14263, USA
Received October 29, 2009; Revised and Accepted February 1, 2010
LGI1 in humans is responsible for a predisposition to autosomal dominant partial epilepsy with auditory
features (ADPEAF). However, mechanisms of how LGI1 mutations cause epilepsy remain unclear. We have
used a mouse chromosome engineering strategy to create a null mutation for the gene ortholog encoding
LGI1. The Lgi1 null mutant mice show no gross overall developmental abnormalities from routine histopathological analysis. After 12 – 18 days of age, the homozygous mutant mice all exhibit myoclonic seizures
accompanied by rapid jumping and running and die shortly thereafter. The heterozygous mutant mice do
not develop seizures. Electrophysiological analysis demonstrates an enhanced excitatory synaptic transmission by increasing the release of the excitatory neurotransmitter glutamate, suggesting a basis for the seizure phenotype. This mouse model, therefore, provides novel insights into the mechanism behind ADPEAF
and offers a new opportunity to study the mechanism behind the role of LGI1 in susceptibility to myoclonic
seizures.
INTRODUCTION
Autosomal dominant partial epilepsy with auditory features
(ADPEAF) is a hereditary form of epilepsy (1). This disorder
is also referred to (2,3) as autosomal dominant lateral temporal
lobe epilepsy (ADLTE). Seizures in patients with this disorder
are characterized by auditory auras followed by complex
partial seizures and subsequent generalized seizures in many
cases. The age of onset of seizures ranges widely between 8
and 50 years of age. Linkage analysis in ADPEAF families identified a locus in 10q24 (1) and subsequently a candidate gene
approach identified mutations in the leucine-rich, glioma
inactivated-1 (LGI1) gene in affected individuals (4–7). We
had originally identified LGI1 from studies of chromosome
translocation breakpoints in 10q24 in glioma cell lines (8),
which was shown to be inactivated in high-grade brain tumors.
The presence of a signal peptide at the N-terminal end indicated
it was a secreted protein (9–11). A leucine-rich repeat (LRR)
motif was also located in the N-terminal end flanked by cysteine
clusters. The C-terminal part of the protein carries a repeat
domain that is predicted to form a b-propeller structure indicative of protein–protein binding (12).
The majority of hereditary epilepsy genes encode structural
components of ion channels (13 – 15). LGI1, however, was the
first epilepsy predisposition gene which did not possess this
function directly. Early studies in glioma cells demonstrated
that re-expression of LGI1 suppressed cellular invasion (16),
which was later associated with a downregulation of matrix
metalloproteinase genes through suppression of signaling
through the MEK/ERK pathway (17). In neuroblastoma
cells, forced expression of LGI1 resulted in apoptosis (18).
We have shown recently that re-expression of LGI1 in
glioma cells results in the disregulation of the canonical
axon guidance pathway (19). A function in neuronal cells
was only recently suggested. Using a heterologous system in
Xenopus oocytes, LGI1 was suggested to interact with the
∗
To whom correspondence should be addressed at: MCG Cancer Center, CN 4112, Medical College of Georgia, 1120 Fifteen Street, Augusta, GA 30912,
USA. Tel: +1 7067214381; Fax: +1 7067211670; Email: [email protected](J.K.C.); Tel: +1 7168451099; Fax: +1 7168451698; Email: yuejin.yu@
roswellpark.org (Y.E.Y.)
†
The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors.
‡
Present address: Department of Molecular Cardiology, Cleveland Clinic Foundation, Cleveland, OH 44195, USA.
# The Author 2010. Published by Oxford University Press. All rights reserved.
For Permissions, please email: [email protected]
Human Molecular Genetics, 2010, Vol. 19, No. 9
1703
Figure 1. Generation of the Lgi1 mutation. (A) Strategy to generate the deletion at the Lgi1 locus based on Cre/loxP-mediated recombination. H, HpaI; N, NdeI;
S, SmaI; 3′ 3′ -HPRT; 5′ , 5′ -HPRT; Ag, K14-Aguoti gene; Ty, tyrosinase minigene; P, puromycin-resistance gene; N, neomycin-resistance gene; arrowhead, loxP
site. Integration sites for MICER clones are shown adjacent to intron 2 and downstream of exon 8. Following Cre-loxP recombination, the HPRT gene is reconstituted from the two fragments located in the vector arms and the two coat color markers are inserted. (B and C) Southern blot analysis of samples from ES cell
DNA that were digested with NdeI. DNA isolated from the parental AB2.2 ES cells and an ES cell clone targeted with MHPN-127h1 (B, lanes 1 and 2) was
hybridized with Probe A. Cellular DNA isolated from an ES cell clone targeted with MHPN-127h1 (C, lane 1) and two ES cell clones carrying the Lgi1 deletion
(C, lanes 2 and 3) hybridized with Probe B.
Kv1.1 channel (20) which is present on the presynaptic membrane. In other studies (21), LGI1 was shown to
co-immunoprecipitate with the ADAM22 receptor protein normally found on the postsynaptic membrane. We have recently
confirmed the interaction between LGI1 and ADAM23 (22)
and studies by Sagane et al. (23) extended interactions
within this family to ADAM11. These observations generally
support the role of LGI1 in the seizure phenotype and possibly
suggest a role in synapse plasticity/function.
To investigate the mechanism of action of LGI1 further, we
have now created mice with a null mutant genotype using a
chromosome engineering strategy. These mice develop seizures between 12 and 20 days and die shortly thereafter. Heterozygous mice are seizure-free. Electrophysiological analysis
demonstrates an enhanced excitatory synaptic transmission by
increasing the release of the excitatory neurotransmitter glutamate, suggesting a basis for the seizure phenotype.
RESULTS
Generation of Lgi1-targeted embryonic stem cells
The structural gene of the mouse ortholog of human LGI1 contains eight exons, which spans 44.16 kb (Fig. 1). To reduce the
probability of generating a truncated mutant Lgi1 protein after
gene targeting, we decided to delete the genomic region
extending from exon 3 to exon 8 using Cre/loxP-mediated
chromosome engineering (24). The loxP sites were inserted
into the desired endpoints using MICER-based targeting
vectors (25), available through the Wellcome Trust Sanger
Institute (Cambridge, UK). These vectors carry loxP sites
and either the 3′ - or the 5′ -HPRT gene fragments as well as
agouti and tyrosinase coat color markers, respectively
(Fig. 1). The specific MICER clones selected, MHPP-6m1
and MHPN-127h1, carried genomic inserts which mapped
between exon 1 and 2 and exon 8 downstream of the noncoding region of Lgi1, respectively (Fig. 1). To generate the
deletion at the Lgi1 locus by cis recombination, AB2.2
embryonic stem (ES) cells were first targeted with
MHPN-127h1 (Fig. 1). An ES cell clone with successful targeting of the loxP site using MHPN-127h1 was identified
through neomycin selection. This clone was then electroporated with MHPP-6m1, a 3′ HPRT targeting vector (Fig. 1),
and the ES cells were then selected in puromycin. After 9
days of selection, the cells from the puromycin-resistant
clones were pooled and electroporated with pOG231, which
carries the Cre recombinase. ES cell clones which had undergone loxP recombination reconstitute the HPRT gene and
these cells were then selected using hypoxanthine, aminopterin and thymidine (HAT) medium. Sib-selection of the
HAT-resistant clones was performed with G418 and puromycin, where 55% were G418- and puromycin-sensitive,
suggesting that they carried the desired deletion. Southern
blot analysis of DNA derived from these clones identified
1704
Human Molecular Genetics, 2010, Vol. 19, No. 9
Figure 2. FISH analysis of ES cells carrying the heterozygous deletion of the Lgi1 gene. An ES cell metaphase is shown (left). The two copies of chromosome 19
are identified in the box. Individual copies of chromosome 19 (right) were identified by BAC clone RP23-359A49 located close to the centromeric region (red).
When co-hybridized with DNA probes from within the deleted region (see text), only one of these chromosomes (arrow) shows the presence of the Lgi1 locus
(green).
the specific restriction enzyme fragment that was predicted to
be generated as a result of the deletion of the Lgi1 gene
(Fig. 1).
Fluorescence in situ hybridization analysis of ES clones
with Lgi1 deletion
ES cell clones which were shown by Southern blot analysis to
carry hemizygous deletions were further analyzed using fluorescence in situ hybridization (FISH). The deleted region spans
a ,50 Kb genomic interval, which precluded using BACs in
the FISH analysis of the deleted region. Instead, individual
genomic DNA probes based on the plasmid clones that
mapped within the deleted region were obtained from the
Mouse 10 Kb plasmid library prepared by Dr R.B. Weiss at
the University of Utah. Plasmid DNA from four individual
clones was pooled and used to generate the biotinylated
probe. This probe was then applied to metaphase chromosome
spreads derived from six independently derived ES cell clones.
The mouse Lgi1 gene is located on the distal part of chromosome 19. To unequivocally identify chromosome 19 in the
metaphase spread, we used BAC RP23-359N19, which is
located on the proximal part of chromosome 19. As shown
in Figure 2, the control BAC identifies both copies of chromosome 19 within the metaphase spread, but the Lgi1 locus was
only present on one of these chromosomes, demonstrating the
successful deletion of the homologous region in all of these
cell clones.
Generation of the heterozygous null mice
The mutant ES cell clones were used to generate chimeras
using standard procedures. Male mice with high chimerism
as judged by coat color were then crossed onto albino
C57BL/6J mice to generated mice with the constitutional heterozygous deletion. Germline transmission of the Lgi1
mutation was confirmed using a PCR strategy which first
demonstrated the constitutional presence of the reconstituted
HPRT gene that resulted from the Cre-mediated deletion
event (Fig. 3). These heterozygous null mice were then bred
to generate homozygous mutant mice, which initially could
be identified using the PCR strategy described in Figure 3.
In this approach, eight PCR reactions identified the genomic
loci, of which two loci lay outside the predicted deletion on
either side and four loci were located within the targeted deletion. Analysis of DNA derived from tail snips of 10-day-old
mice demonstrated that, as expected, 25% of littermates
carried the homozygous deletion. From an analysis of .200
mice, there was no apparent sex ratio distortion and the frequency of the Lgi1-targeted alleles showed normal Mendelian
inheritance.
RT – PCR analysis of RNA derived from the hippocampus
and cortex of null mutant mice, as expected, showed the
absence of Lgi1 gene expression compared with wild-type
and heterozygous littermates (Fig. 3). To examine temporal
expression of Lgi1, we performed RT – PCR analysis on hippocampal mRNA from wild-type and heterozygous mutant littermates. Lgi1 expression was identified in all animals from
4 days old (P4) through 23 days old (P23) (Fig. 3). In this
semi-quantitative analysis, there was evidence for a lower
expression level in the heterozygotes as might be expected,
although it is still clear that LGI1 expression is present at all
time points during the first month of life in these animals.
Cosegregation of coat color markers at the genotypic and
phenotypic levels in mutant mice
The MICER clones used to generate the targeted knockout
carry either the agouti or tyrosinase coat color markers,
which can potentially correlate with specific genotypes
within littermates (Fig. 1A). We crossed the original heterozygous targeted mice onto an albino C57BL/6J background
where the influence of these genes is often more readily
observed in terms of eye and coat color in particular. After
six backcrosses, the Lgi1 wild-type mice showed pink eyes
and a white coat color, the heterozygous mutants had dark ruby
eyes with white coats and the homozygous null mice showed
dark ruby eyes with cream-colored coats (Supplementary
Human Molecular Genetics, 2010, Vol. 19, No. 9
1705
Figure 3. PCR strategy for identification of the homozygous deletion of the Lgi1 gene. (A) Six pups were analyzed, of which four (2, 3, 5 and 6) were positive for
the HPRT gene, indicating the presence of the Cre/loxP-mediated recombination product, although this PCR analysis could not distinguish between heterozygous
and homozygous deletions. (B) All four of these pups were positive for proximal genomic region 2 (P2) and distal genomic regions 7 and 8 (P7 and P8) which lie
outside the deletion (see text). When analyzed for genomic regions within the deletion, pups 3 and 6 were negative, demonstrating that they carry the homozygous deletion and the other two (2 and 5) carry a hemizygous deletion. RT–PCR analysis of wild-type (lanes 1, 4, 5 and 8) and mutant null (lanes 2, 3, 6 and 7)
mice demonstrates the absence of PCR products from the hippocampus of the null mice (C). RT– PCR analysis of RNA from hippocampus of the wild-type mice
(D) at postnatal days 2– 26 demonstrate expression of Lgi1 during early weeks of postnatal life. When wild-type and heterozygous littermates were analyzed
using semi-quantitative RT–PCR, evidence for reduced LGI1 expression was seen in the hippocampus, although expression is clearly present at all time
points in the heterozygotes (E).
Material, Fig. S1). These coat-color phenotypes are caused by
the presence of one and two copies of the tyrosinase coat
color marker in the heterozygous and homozygous mutant
mice (Fig. 1A). These phenotypic markers negated the need
to genotype mice in this colony in subsequent analyses.
Lgi1 null mice show early-onset seizures
Since LGI1 mutations cause predisposition to ADPEAF in
humans, we monitored the mice for seizure activity from
birth. Homozygous mutant null mice were viable and developed apparently normally with only a slight reduction in
overall body size in some cases. After 12– 20 days,
however, these mice demonstrated generalized myoclonic
seizure phenotypes, which involved uncontrolled jumping
and running accompanied by erratic movements which were
preceded and followed by periods of relative inactivity involving preening or slow walking. The series of intermittent
seizure events were noted to last for 20 min (Supplementary
Material, videos M1 and M2). Preceding the onset of seizures,
these mice were noted to exhibit ‘flagpole’ tail dorsiflexion.
During the later stages of the seizures, mice would fall on
their sides and exhibit running/galloping motions with the
fore and hind limbs. Mice that were followed further would
die shortly after an isolated seizure event. These seizure phenotypes were highly consistent between individual mice. Heterozygous null mice have never been observed to exhibit this
phenotype and, over a 12 –18 month observation period, have
not been noted to suffer the premature death experienced by
the homozygous null mice.
Hyperexcitability in CA1 hippocampal neurons in Lgi1
null mice
To investigate whether the loss of Lgi1 resulted in altered synaptic function, we investigated extracellular field responses in the
CA1 region of the hippocampi from Lgi1-mutant and wild-type
mice. When perfused in the modified artificial cerebrospinal fluid
(ACSF) (0-Mg2+, low-Ca2+ and high-K+-ACSF), wild-type
slices generated characteristic spontaneous epileptiform
discharges with burst charges 11.7 + 1.3 per min (mean +
S.E.M., n ¼ 7). In contrast, the spontaneous burst discharge frequency was significantly increased in the Lgi1-mutant mice (n ¼
7, P , 0.01; Fig. 4A and B). These results indicate that CA1
neurons in Lgi-mutant mice exhibit higher spontaneous
epileptiform-discharge activity in comparison with those in
control littermates. To investigate possible mechanisms of the
increased discharge activity in mutant mice, we analyzed the
intrinsic properties of CA1 pyramidal neurons in current clamp
mode. Neurons fired in response to the depolarizing current
(+200 pA), but become hyperpolarized when clamped at
2200 pA (Fig. 5A). The firing frequency and spikes showed
no difference between mutant and wild-type mice (n ¼ 9, P .
0.05; Fig. 5A and B). Moreover, there was no difference in the
resting membrane potential (n ¼ 9, P . 0.05; Fig. 5C) and
input resistance between the two mice (n ¼ 9, P . 0.05;
1706
Human Molecular Genetics, 2010, Vol. 19, No. 9
Figure 4. Spontaneous epileptiform-discharge activity in the CA1 regions of
hippocampal slices from wild-type (+/ + ) and Lgi1 null (2/ 2 ) mice.
Field responses were recorded extracellularly in a modified ACSF (0 mM
MgSO4, 5 mM KCl, 1.6 mM CaCl2). (A) Representative traces of the spontaneous epileptiform burst discharges from mutant and wild-type mice were
shown. Quantitative analysis of the burst discharge incidence (B) showed
increased frequency in the mutant compared with the wild-type mice (both
n ¼ 7, ∗∗ P , 0.01).
Fig. 5D). These results indicate that Lgi1 mutation did not change
the intrinsic properties of pyramidal neurons in the hippocampal
CA1 region. This finding also suggests that the cellular architecture of pyramidal neurons was not altered in the mutant mice,
consistent with the gross morphological characterization
described below.
Because there is no difference in the intrinsic properties of
pyramidal neurons, we next investigated whether inputs onto
pyramidal neurons were altered. First, we recorded miniature
excitatory postsynaptic synaptic currents (mEPSCs), a
response generated by spontaneous glutamate release. The
amplitudes of mEPSCs were similar between mutant and wildtype mice, suggesting the LGI1 mutation did not alter the
density and response of postsynaptic receptors (n ¼ 12, P .
0.05; Fig. 6A and C). Remarkably, however, the frequency
of mEPSCs was dramatically increased in the mutant mice
(n ¼ 12, P , 0.01; Fig. 6A and B), indicating increased
release of glutamate. Consistently, AMPA receptor-mediated
EPSCs (P , 0.01) and NMDA receptor-mediated EPSCs
(P , 0.05) were larger in mutant CA1 pyramidal cells than
wild-type controls (n ¼ 7 for wild-type mice and n ¼ 8 for
Lgi1-mutant mice, respectively; Fig. 6G and H). We have
also investigated the effect of LGI1 mutation on GABAergic
transmission by measuring miniature and evoked inhibitory
postsynaptic currents (mIPSCs and eIPSCs, respectively).
The mIPSC frequency (n ¼ 8, P . 0.05; Fig. 6D and E) and
amplitude (P . 0.05; Fig. 6D and F) and the eIPSCs amplitude (n ¼ 7, P . 0.05; Fig. 6I and J) showed no difference
between mutant and wild-type mice. These results suggest
that Lgi1 mutation had no effect on inhibitory synaptic transmission. Instead, it enhances excitatory synaptic transmission
by increasing the release of the excitatory neurotransmitter
glutamate. These results provide a potential mechanism of epileptiform activity in mutant mice.
Gross anatomical analysis of the null mutant mice
To determine whether the Lgi1 null mice showed any gross
developmental abnormalities that might explain the seizures,
six individual mice from each of the three genotypes underwent extensive routine histopathological and gross anatomy
analysis (conducted by the Molecular and Comparative
Figure 5. The intrinsic properties of CA1 pyramidal neurons. (A) Representative response of a CA1 pyramidal neuron to 200 ms depolarizing and hyperpolarizing somatic current pulses. Quantitative analysis showed that the
evoked spike frequencies of CA1 pyramidal neurons produced by a 200 pA
suprathreshold somatic current injection (B) were similar in wild-type and
Lgi1-mutant neurons. The resting membrane potential (RMP) (C) and input
resistance (D) of CA1 pyramidal neurons did not vary significantly between
wild-type and Lgi1-mutant mice (both n ¼ 9, P . 0.05).
Pathobiology Service at Johns Hopkins University). Overall,
no specific abnormalities were observed in the null mutant
mice at this level of resolution, with specific attention paid
to the hippocampus and cortex as well as other organs demonstrated to express Lgi1 in our previous studies (11).
DISCUSSION
The demonstration here that the null mutant mice for Lgi1
develop myoclonic seizures makes them a representative
model for the study of the role of the gene in ADPEAF/
ADLTE, with the caveat that human epilepsy patients are
only heterozygous for the mutant gene. Loss of function of
LGI1 results in early-onset seizures consistent with the phenotype in humans. The seizure phenotype in the null mouse,
however, is clearly more severe than that seen in ADPEAF
patients, due possibly to the loss of LGI1 function compared
with the predicted haplo-insufficiency in humans. The
effects of the LGI1 mutations on the function of the protein,
however, are still not altogether clear, making it difficult to
define the consequences of haploinsufficiency. In a recent
review by Nobile et al. (7), 25 mutations were described, of
which 30% were predicted to create nonsense mutations
and 70% were missense mutations, presumed to affect
protein function. When tested, these missense mutations abrogated or greatly reduced the secretion of the protein. The
alleles carrying these particular mutations would be predicted
to be non-functional if LGI1 acts on the outer cell membrane
as suggested by Fukata et al. (21). If, as suggested by Schulte
et al. (20), LGI1 binds to proteins on the inner cell membrane,
then it is possible that these missense, or even the truncating,
mutations may act in a dominant-negative manner by competing for binding partners in protein complexes, although there
is, as yet, no evidence that LGI1 oligomerizes. In our
Human Molecular Genetics, 2010, Vol. 19, No. 9
1707
Figure 6. Analysis of miniature and evoked EPSCs and IPSCs in hippocampal CA1 pyramidal neurons from wild-type (+/ + ) and Lgi1 null (2/ 2 ) mice. (A)
Representative traces of the mEPSCs are shown. Quantitative analysis of mEPSC frequency (B) showed significantly higher frequencies in the mutant compared
with the wild-type mouse (both n ¼ 12, ∗∗ P , 0.01), and cumulative distribution of mEPSC amplitudes (C) showed no significant difference between mutant and
wild-type control mice. (D) Representative traces of the mIPSC in CA1 neurons for mutant and wild-type mice are shown. Quantitative analysis of the mIPSC
frequency (E) and cumulative distribution of mIPSC amplitudes (F) showed no significant difference between Lgi1-mutant mice and wild-type controls (both
n ¼ 8). (G) Representative traces showed that the evoked AMPA (lower) and NMDA (upper) receptor-mediated EPSCs were increased in Lgi1-mutant CA1
pyramidal neurons. (H) The quantification of eEPSC amplitude is shown (n ¼ 7 for wild-type mice and n ¼ 8 for Lgi1-mutant mice, respectively;
∗∗
P , 0.01, ∗ P , 0.05, compared with wild-type controls). Representative traces (I) and quantification (J) showed that the eIPSC amplitudes were similar in
CA1 pyramidal neurons from the wild-type and Lgi1-mutant mice (both n ¼ 7, P . 0.05). The amplitudes for AMPA-eEPSCs, NMDA-eEPSCs and eIPSCs
in wild-type mice were 270.6+15.3 pA, 278.0+18.7 pA and 712.9+44.6 pA, respectively.
studies there was no evidence that the hemizygous null mice
experienced seizures, although we cannot rule out the possibility that they suffer a very mild seizure like activity that
cannot be readily detected. There is also no evidence from
ADPEAF patients that the nonsense mutations lead to the production of a truncated protein. It might be expected, for
example, that mRNA molecules carrying premature chain terminating codons would activate the nonsense mediated decay
pathway and, unless they were located in the last exon,
degrade the abnormal message (26). In the experiments
described by Zhou et al. (27), using knock-in of a nonsense
mutation in exon 6 in a transgenic BAC system, a truncated
protein was detected supporting the possibility of a dominantnegative effect. A naturally occurring truncated message has
also been reported (10) which apparently remains intracellular,
which may also affect the function of the full length protein.
Thus, although the idea that ADPEAF results from haploinsufficiency due to inactivation of one allele is compelling at this
point, until the molecular mechanism of LGI1 function is more
clearly understood, it is difficult to interpret the consequences
of particular mutations in the gene in the context of the homozygous null mutation.
The identification of proteins that interact with LGI1 has
suggested that it is involved in synapse transmission. Thus,
Schulte et al. (20) identified an interaction between LGI1
and Kv1.1 (KCNA1) in a heterologous Xeonopus oocyte
system, and Fukata et al. (21) identified LGI1 within the
PSD95 protein complex which contains ADAM22. Immunoprecipitation (IP) using ADAM22 antibodies demonstrated
the presence of LGI1 in this complex. In IP experiments
using LGI1 as the bait, we have recently shown that LGI1
interacts with the closely related ADAM23 protein (22). Our
mass spectroscopy analysis also identifed syntaxin 1A
(SYT1A) and syntaxin binding protein (STXBP1) as interacting protein partners for LGI1 (22). SYT1A also binds to
KCNA1 (28). STXBP1 is essential for synaptic vesicle
release, and mutations in this gene predispose to infantile epileptic encephalopathy (29). Null mutant mice for KCNA1
(30), ADAM23 (31) and ADAM 22 (32) have been shown
to experience seizure/tremor activity, which appears almost
identical to that seen in the Lgi1 null mutant mice. The
Kv1.2 (KCNA2) protein is commonly found in the same tetramer as KCNA1 and the KCNA2 null mice also develop a phrenetic jumping and running phenotype, with the flagpole tail
phenotype preceding the onset of the seizures (33). As in the
Lgi1 null mutant mice, these animals die shortly after the seizures begin (32). The emerging evidence, therefore, suggests
that the LGI1 protein complex is important for specific neurological function and that loss of any member of this complex
results in seizures.
1708
Human Molecular Genetics, 2010, Vol. 19, No. 9
During the preparation of this manuscript, another model
for LGI1-related disruption of neuronal function was
described by Zhou et al. (27). In this model, transgenic mice
were created carrying BACs that resulted in the overexpression of either the wild-type Lgi1 gene or an Lgi1 gene with
a truncating mutation in exon 6. In mice overexpressing the
exogenous mutant Lgi1 allele, the processes of presynaptic
and postsynaptic maturation were arrested. This phenotype
was associated with inhibition of dendritic pruning and
increased spine density which markedly increased excitatory
synaptic transmission. These mice, however, did not demonstrate spontaneous seizures as seen in either human
ADPEAF patients or the Lgi1 null mice described here.
When mice overexpressing the mutant LGI1 protein were
challenged with seizure-inducing pharmacological agents,
however, epileptiform discharges were noted and, at high concentrations, mice apparently experienced seizures. Since the
human and mouse seizures result from reduced or loss of function, it is not clear at this time to what extent the phenotypes
seen in the BAC transgenic model are due to the overexpression of the exogenous genes. It is interesting to note, however,
that even though there are differences between the overexpression and null models, both showed increased excitatory synaptic transmission.
In a study by Fukata et al. (21), the frequency of mEPSCs
was increased by the presence of LGI1, whereas in this
study it was increased by the absence of LGI1. This group
(21), however, studied the effect of exogeneous, potentially
super physiological concentrations of recombinant LGI1 on
neurotransmission in hippocampal slices of P24-29 rats.
Because LGI1 had no effect on paired-pulse facilitation, it
was concluded that the increase in mEPSC frequency was
due to enhanced mEPSC amplitudes. In the present study,
neurotransmission was characterized in hippocampal slices
of Lgi1 null mutant mice. Owing to neonatal lethality, it was
necessary to perform these experiments prior to the age of
P14 –18. We showed that the mutation had no effect on miniature EPSC (mEPSC) amplitude, but increased its frequency.
These results indicate a critical role of LGI1 in the development of synapses, in particular, presynaptic differentiation
and/or function. This notion is in general agreement with
observations that presynaptic and postsynaptic maturation
were arrested in mice overexpressing a mutant Lgi1 allele
(27). It would be interesting to investigate the effect of
exogenous LGI1 on hippocampal neurotransmission of Lgi1mutant mice in the future.
From an RT – PCR analysis of mRNA derived essentially
from whole brain, previous studies (34) suggested that
appreciable levels of LGI1 were only seen after P14, and
rising to P28. These observations provided a potential explanation for the age of onset of seizures in the Lgi1 null mice,
where the phenotypic effect becomes obvious when the
demand for LGI1 function in the CNS becomes highest. A
similar observation was reported by Zhou et al. (27) using
western blotting with the Santa Cruz antibody SC9583,
which we have previously shown to cross-react with other
members of the LGI1 family (11). Surprisingly, however,
our RT – PCR analysis of the isolated hippocampus from wildtype and heterozygous Lgi1-mutant mice demonstrated an
equal expression level from P2 to P28, specifically arguing
against a differential temporal expression pattern. Using the
BAC transgenic reporter mice for Lgi1 (11), we have also
shown that Lgi1 is expressed in the developing hippocampus
and cortex between embryonic days E9.5 and 18.5 (manuscript
under submission), further supporting a sustained expression
in critical cell types during development and into early postnatal life.
The demonstration here that the constitutional inactivation
of the Lgi1 gene in mice results in myoclonic seizures supports
this as a model for ADPEAF/ADTLE which is due, at least in
part, to neuronal hyperexcitability that was specific for excitatory transmission. The availability of the mouse model will
facilitate a more detailed understanding of this gene in neuronal dysfunction related to epilepsy, as well as potentially
its function in other cell types showing high levels of
expression. We have recently shown, for example, that Lgi1,
which is also expressed in normal prostate epithelium (11),
is inactivated during early-stage hyperplasia of the prostate
in a mouse model of prostate cancer, potentially facilitating
cellular invasion (35).
MATERIALS AND METHODS
The targeting vectors for generating the targeted Lgi1
mutation
The MICER clone-based targeting vectors were obtained from
the Wellcome Trust Sanger Institute (25). The end sequences
of the genomic insert of MHPN-127h1 were verified by
sequencing using primers TTGGCCGATTCATTAATGCAG
and TGAAGAAAGTTGAGGAGAGTTTC, whereas the
end sequences of the genomic insert of the MICER clone
MHPP-6m1 were verified by sequencing using the primers
CGTCCCATTCGCCATTCAGGC
and AGACAATAGCAGGCATGCTG.
Gene targeting in ES cells
Culture of the AB2.2 line of ES cell line and the method for
gene targeting have been described previously (36,37). For
generating the deletion at the Lgi1 locus, MHPN-127h1 and
MHPP-6m1 were linearized by digestion with HpaI and
SmaI, respectively, prior to transfection. The linearized targeting vectors were transfected into ES cells by electroporation,
which were selected in G418 or puromycin. Positive clones
were identified by Southern blot analysis with one of the following probes: a PCR product external to the genomic insert
of MHPN-127h1 and a 2.3 kb PvuII fragment from the BlueScript plasmid vector backbone.
Generation of the targeted Lgi1 mutation in ES cells
and mice
The pOG231 cre-expression vector (38) was electroporated
into double-targeted clones. ES cell clones with recombined
products were then selected in the HAT medium as described
previously (24,38). Clones of ES cells that carried the desired
deletion at the Lgi1 locus generated by cis recombination were
identified by hybridizing Southern blots of NdeI-digested
genomic DNA from HAT-resistant ES cell clones that
Human Molecular Genetics, 2010, Vol. 19, No. 9
carried the desired deletion between exon 2 and 3′ non-coding
region of Lgi1 to the radiolabeled probe B, a 2.3 kb PvuII fragment that was isolated from the BlueScript plasmid vector
backbone (Fig. 1). Germline-transmitting chimeras were generated from ES cell lines carrying the targeted Lgi1 allele by
microinjection of blastocysts isolated from albino C57B6/
J-Tyr c-Brd females as described previously (39).
Electrophysiological recordings in slices
Brain slices were prepared using standard procedures (40).
Briefly, transverse hippocampal slices (0.40 mm) were prepared
from P14– P18 Lgi1-mutant mice and wild-type littermates
using a Vibroslice (Leica VT 1000S, Leica Instruments, Nussloch, Germany) in an ice-cold solution containing (in mM):
64 NaCl, 2.5 KCl, 1.25 NaH2PO4, 10 MgSO4, 0.5 CaCl2, 26
NaHCO3, 10 glucose and 120 sucrose. Slices were allowed to
recover for at least 2 h (1 h at 348C followed by 1 h at 228C)
in ACSF containing (in mM): 126 NaCl, 2.5 KCl, 1.25
NaH2PO4, 2 MgSO4, 2 CaCl2, 26 NaHCO3 and 10 glucose.
Slices were transferred to the recording chamber and superfused
with ACSF (2 ml/min) at 348C that was saturated with 95%O2/
5%CO2. CA1 pyramidal neurons were visualized using an
infrared-differential interference contrast microscope with a
×40 water-immersion lens (Axioskop2 Fsplus, Carl Zeiss,
Germany) and an infrared-sensitive CCD camera. Whole-cell
patch-clamp recordings were performed using an Axon Multiclamp 700B amplifier (Molecular Devices, Sunnyvale, CA,
USA) and digitized by the pClamp 9.2 software (Molecular
Devices). Both mEPSCs and mIPSCs were recorded at a
holding potential of 265 mV. For mEPSCs recording, glass
pipettes were filled with the solution containing (mM): 120 Kgluconate, 20 KCl, 10 HEPES, 0.1 EGTA, 2 MgCl2, 10
sodium phosphocreatine, 0.2 leupeptin, 4 Mg-ATP and 0.3
Na-GTP (pH 7.3, 280 mOsm with sucrose). K-gluconate in
the pipette solution was substituted with 140 mM KCl (final concentration) for mIPSC recording. For eEPSC and eIPSC recording, K-gluconate was substituted with 120 mM CsCH3SO3 and
5 mM lidocaine N-ethylchloride (QX-314) was added in the
pipette. The resistance of pipettes was 3 –5 MV. AMPA and
NMDA receptor-mediated EPSCs were recorded at a holding
potential of 265 and +40 mV, respectively; eIPSCs were
recorded at a holding potential of 265 mV. Tetrodotoxin
(1 mM) was included in the perfusion solution for mEPSC and
mIPSC recording and 20 mM bicuculline was used to block
GABAA receptor-mediated currents to record mEPSCs and
eEPSCs. For mIPSC and eIPSC recording, DL-2-amino5-phosphonovaleric acid (50 mM) and 6-cyano-7-nitroquinoxaline-2,3-dione (20 mM) were supplemented to block NMDA
and AMPA receptors, respectively. eEPSCs and eIPSCs were
generated with a two-concentric bipolar stimulating electrode
(25 mm pole separation) positioned 100 mM from the neuron
under recording. Single pulses of 0.2 ms were delivered at
0.1 Hz and synchronized using a Mater-8 stimulator
(A.M.P.I., Israel). Basic biophysical and firing properties were
recorded in current-clamp whole-cell configuration using the
K-gluconate-based pipette solution coupled with regular perfusion ACSF. De- and hyperpolarizing current steps (+200
and 2200 pA, respectively, 200 ms) were applied for characterization of intrinsic properties. Data were filtered at 2 kHz, and
1709
sampled at 10 kHz. Neurons with a resting potential of at least
– 60 mV and resistance that fluctuated within 15% of initial
values (,20 MV) were analyzed. Mini events were analyzed
with MiniAnalysis software (Synaptosoft). The amplitude histograms were binned at 1 pA. Differences between cumulative
amplitude histograms were evaluated using the Kolmogorov –
Smirnov test. Spontaneous epileptiform burst discharge was
recorded extracellularly in the stratum pyramidal of CA1 in a
modified ACSF (0 mM MgSO4, 5 mM KCl, 1.6 mM CaCl2) by
using pipettes (223 MV) filled with modified ACSF.
FISH analysis
FISH was carried out basically as described by Chernova and
Cowell (41). DNA probes were derived from BAC clone
RP23-359A49 as well as clones 2M0204H23, 1M0418N07,
1M0559N07 and 1M0343M12 where the plasmids were
isolated using standard alkaline lysis procedures and were
labeled with digoxigenin-11-dUTP using the DIG-Nick
Translation Mix (Roche) or with Biotin-16-dUTP using the
Biotin-Nick Translation Mix (Roche). The hybridization
mixture contained (in a final volume of 20 ml): 2 mg of the
labeled probe, a 4-fold excess of human cot-1 DNA
(Roche), a 17-fold excess of salmon sperm DNA (Invitrogen)
in 50% formamide, 2X SSC and 10% dextran sulfate. The
slide was denatured at 708C in 70% formamide/2X SSC for
1 min, 30 s followed by incubation in ice-cold 70, 80 and
100% ethanol for 2 min each prior to annealing with probe.
The probe mixture was denatured at 808C for 5 min, incubated
at 378C for 45 min, applied to the surface of the slide, overlaid
with a coverslip, sealed and then incubated for 20 h at 378C.
The slide was washed three times at 458C in 50% formamide/2X SSC, two times in 1X SSC and once in 4X SSC/
0.1% Tween. The probes hybridized to nuclei were detected
using anti-digoxigenin-fluorescein Fab fragments (Roche) or
Avidin-Rhodamine (Roche). Slide preparations were viewed
using a fluorescent microscope (Nikon) and the images were
captured and adjusted for signal intensity with Easyfish software (ASI).
PCR analysis
Total RNA was isolated from cortex and hippocampus of mice
from postnatal days 2 (P2), 6 (P6), 11 (P11), 14 (P14) and 26
(P26) using Trizol Reagent RNA isolation system (Invitrogen
Corporation, Carlsbad, CA, USA) following standard protocols. First-strand cDNA was carried out using 1 – 3 mg total
RNA and the standard protocol for the Invitrogen SuperScript
II Reverse Transcriptase Preamplification System (Invitrogen
Corporation). RT – PCR reactions were carried out using
specific primers, forward—GAT CCA TTC CAC GCA CCG
TTC CTC, reverse—TCT TCT CTA CGT GGT CCC ATT
CCA, spanning exons 1 – 7 to amplify unique fragments homologous to regions of mouse Lgi1 (NCBI: NM_020278) and
Gapdh (NCBI: 008084), forward—CAT GTT TGT GAT
GGG TGT GAA CCA CGA G, reverse—GAC AAC CTG
GTC CTC AGT GTA GCC CAA G. Reverse transcription
was performed using cDNA mixture supplemented with
0.3 ml of Taq DNA polymerase, 10 nM of each primer,
1710
Human Molecular Genetics, 2010, Vol. 19, No. 9
Table 1. LGI1 primers used for genotyping
Primers
Primers sequences
HPRT ctrl-F
HPRT ctrl-R
HPRT-F
HPRT-R
LGI1 deletion no. 2-F
LGI1 deletion no. 2-R
LGI1 deletion no. 3-F
LGI1 deletion no. 3-R
LGI1 deletion no. 4-F
LGI1 deletion no. 4-R
LGI1 deletion no. 5-F
LGI1 deletion no. 5-R
LGI1 deletion no. 7-F
LGI1 deletion no. 7-R
127H1 deletion no. 8-F
127H1 deletion no. 8-R
AGGCTTAGCTGAGGTCACACA
CCAGTTTCACTAATGACACA
AGGATGTGATACGTGGAAGA
CCAGTTTCACTAATGACACA
GGCCCGTAAGCATTTTGATA
GCAGCGATGGTGTGAATAAG
TGAGAAAAGCTGCCAAGGTT
CGTTCACCTAGCAAGCACAA
TTTGCAAAGTCCCAAGACCT
TACACCTGCATGCCAGAAGA
GCCTTGCAAATTGGAACACT
ACCGAAATGGCGTTGAGTAG
GCCAGTGCAGTCCACAATAA
ACTTTCCCAGCCTCACTCAA
GATCCCCCACCATGATACAC
TGCCCTAGCATTCCCAATAC
2.0 ml of 10X Taq Reaction Buffer, 1.25 mM MgCl2, 125 mM
of each DNTP, 100 ng/ml DNA template, 5% DMSO and
PCR water to bring the final volume to 20 ml. The reaction
mixtures were incubated using a PTC-100 SingleBlock
System temperature cycler. PCR reactions were programmed
to repeat the following cycles: one cycle with a 5 min denaturation at 958C, 30 cycles annealing of 30 s at 948C, 30 s at
618C and 30 s at 728C, followed by 5 min extension at
728C, then bring to and hold at 48C. The PCR products
were electrophoresed on 0.8% agarose DNA grade (Thermo
Fisher Scientific, Waltham, MA, USA) gels in 1X TAE.
Genotyping was carried out using primers that amplify
unique fragments within the mouse Lgi1 locus (Table 1).
PCR reactions were performed using genomic DNA mixture
supplemented with 0.3 ml of Taq DNA polymerase, 10 nM of
each primer, 2.0 ml of 10X Taq Reaction Buffer, 1.25 mM
MgCl2, 125 mM of each DNTP, 100 ng/ml genomic DNA
template and PCR water to bring the final volume to 20 ml.
The reaction mixtures were incubated using a PTC-100
SingleBlock System temperature cycler. PCR reactions were programmed to repeat the following cycles: one cycle with a 5 min
denaturation at 958C, 35 cycles annealing of 30 s at 948C, 30 s
at 558C and 30 s at 728C, followed by 5 min extension at 728C.
The PCR products were electrophoresed on 0.8% agarose DNA
grade (Thermo Fisher Scientific) gels in 1X TAE.
SUPPLEMENTARY MATERIAL
Supplementary Material is available at HMG online.
ACKNOWLEDGEMENTS
We would like to thank Mr Jeff LaDuca for preparing the
FISH images and to Cory Brayson (Molecular and Comparative Pathobiology Service at Johns Hopkins University) for
the histopathological analysis of the Lgi1-mutant and wildtype mice. Dr Cowell is a Georgia Cancer Coalition Distinguished Cancer Scholar.
Conflict of Interest statement. None declared.
FUNDING
This work was supported in part by grants from the National
Institutes of Health NS046706 (J.C.), MH083317 and
MH083563 (L.M.), HL091519 (Y.E.Y.).
REFERENCES
1. Ottman, R., Risch, N., Hauser, W.A., Pedley, T.A., Lee, J.H.,
Barker-Cummings, C., Lustenberger, A., Nagle, K.J., Lee, K.S., Scheuer,
M.L. et al. (1995) Localization of a gene for partial epilepsy to
chromosome 10q. Nat. Genet., 10, 56–60.
2. Michelucci, R., Poza, J.J., Sofia, V., de Feo, M.R., Binelli, S., Bisulli, F.,
Scudellaro, E., Simionati, B., Zimbello, R., D’Orsi, G. et al. (2003)
Autosomal dominant lateral temporal epilepsy: clinical spectrum, new
epitempin mutations, and genetic heterogeneity in seven European
families. Epilepsia, 44, 1289– 1297.
3. Poza, J.J., Sáenz, A., Martı́nez-Gil, A., Cheron, N., Cobo, A.M., Urtasun,
M., Martı́-Massó, J.F., Grid, D., Beckmann, J.S., Prud’homme, J.F. et al.
(1999) Autosomal dominant lateral temporal epilepsy: clinical and genetic
study of a large Basque pedigree linked to chromosome 10q. Ann. Neurol,
45, 182–188.
4. Kalachikov, S., Evgrafov, O., Ross, B., Winawer, M., Barker-Cummings,
C., Martinelli Boneschi, F., Choi, C., Morozov, P., Das, K., Teplitskaya,
E. et al. (2002) Mutations in LGI1 cause autosomal-dominant partial
epilepsy with auditory features. Nat. Genet, 30, 335– 341.
5. Morante-Redolate, J.M., Gorostidi-Pagola, A., Piquer-Sirerol, S., Saenz,
A., Poza, J.R., Galan, J., Gesk, S., Sarafidou, T., Mautner, V.F., Binelli, S.
et al. (2002) Mutations in the LGI1/Epitempin gene on 10q24 cause
autosomal dominant lateral temportal epilepsy. Hum. Mol. Genet, 11,
1119– 1128.
6. Ottman, R., Winawer, M.R., Kalachikov, S., Barker-Cummings, C.,
Gilliam, T.C., Pedley, T.A. and Hauser, W.A. (2004) LGI1 mutations in
autosomal dominant partial epilepsy with auditory features. Neurology,
62, 1120–1126.
7. Nobile, C., Michelucci, R., Andreazza, S., Pasini, E., Tosatto, S.C. and
Striano, P. (2009) LGI1 mutations in autosomal dominant and sporadic
lateral temporal epilepsy. Hum. Mutat., 30, 530 –536.
8. Chernova, O., Somerville, R.P.T. and Cowell, J.K. (1998) A novel gene,
LGI1, from region 10q24, is rearranged and downregulated in malignant
brain tumors. Oncogene, 17, 2873– 2881.
9. Senechal, K.R., Thaller, C. and Noebels, J.L. (2005) ADPEAF mutations
reduce levels of secreted LGI1, a putative tumor suppressor protein linked
to epilepsy. Hum. Mol. Genet., 14, 1613–1620.
10. Sirerol-Piquer, M.S., Ayerdi-Izquierdo, A., Morante-Redolat, J.M.,
Herranz-Pérez, V., Favell, K., Barker, P.A. and Pérez-Tur, J. (2006) The
epilepsy gene LGI1 encodes a secreted glycoprotein that binds to the cell
surface. Hum. Mol. Genet., 15, 3436–3445.
11. Head, K., Gong, S., Joseph, S., Wang, C., Burkardt, T., Rossi, M.R.,
LaDuca, J., Matsui, S-I., Vaughan, M., Hicks, D.G., Heinz, N. and
Cowell, J.K. (2007) The expression pattern of the LGI1 gene in tissues and
organs from BAC transgenic mice demonstrate a neuronal and glial
expression pattern as well as other distinct cell types in the adult animal.
Mamm. Genome, 18, 328–337.
12. Staub, E., Perez-Tur, J., Siebert, R., Nobile, C., Moschonas, N.K.,
Deloukas, P. and Hinzmann, B. (2002) The novel EPTP repeat defines a
superfamily of proteins with implications in epileptic disorders. Trends
Biochem. Sci., 27, 441–444.
13. Gutierrez-Delicado, E. and Serratosa, J.M. (2004) Genetics of the
epilepsies. Curr. Opin. Neurol., 17, 147– 153.
14. Lerche, H., Jurkat-Rott, K. and Lehmann-Horn, F. (2001) Ion channels
and epilepsy. Am. J. Med. Genet., 106, 146– 159.
15. Reid, C.A., Berkovic, S.F. and Petrou, S. (2009) Mechanisms of human
inherited epilepsies. Prog. Neurobiol., 87, 41– 57.
16. Kunapuli, P., Chitta, K. and Cowell, J.K. (2003) Suppression of the cell
proliferation and invasion phenotypes in glioma cells by the LGI1 gene.
Oncogene, 22, 3985–3991.
17. Kunapuli, P., Kasyapa, C., Hawthorn, L. and Cowell, J.K. (2004) LGI1, a
putative tumor metastasis suppressor gene, controls in vitro invasiveness
and expression of matrix metalloproteinases in glioma cells through the
Erk1/2 pathway. J. Biol. Chem., 279, 23151– 23157.
Human Molecular Genetics, 2010, Vol. 19, No. 9
18. Gabellini, N., Masola, V., Quartesan, S., Oselladore, B., Nobile, C.,
Michelucci, R., Curtarello, M., Parolin, C. and Palù, G. (2006) Increased
expression of LGI1 gene triggers growth inhibition and apoptosis of
neuroblastoma cells. J. Cell Physiol., 207, 711– 721.
19. Kunapuli, P., Lo, K., Hawthorn, L. and Cowell, J.K. (2010) Reexpression
of LGI1 in glioma cells results in dysregulation of genes implicated in the
canonical axon guidance pathway. Genomics, 95, 93– 100.
20. Schulte, U., Thumfart, J.O., Klöcker, N., Sailer, C.A., Bildl, W.,
Biniossek, B., Dehn, D., Deller, D., Eble, S., Abbass, K. et al. (2006) The
epilepsy-linked Lgi1 protein assembles into presynaptic Kv1 channels and
inhibits inactivation by Kvbeta1. Neuron, 49, 697– 706.
21. Fukata, Y., Adesnik, H., Iwanaga, T., Bredt, D.S., Nicoll, R.A. and
Fukata, M. (2006) Epilepsy-related ligand/receptor complex LGI1 and
ADAM22 regulate synaptic transmission. Science, 313, 1792–1795.
22. Kunapuli, P., Jang, G., Kazim, L. and Cowell, J.K. (2009) Mass
spectrometry identifies LGI1-interacting proteins that are involved in
synaptic vesicle function in the human brain. J. Mol. Neurosci., 39,
805–816.
23. Sagane, K., Ishihama, Y. and Sugimoto, H. (2008) LGI1 and LGI4 bind to
ADAM22, ADAM23 and ADAM11. Int. J. Biol. Sci., 4, 387 –396.
24. Ramirez-Solis, R., Liu, P. and Bradley, A. (1995) Chromosome
engineering in mice. Nature, 378, 720–724.
25. Adams, D.J., Biggs, P.J., Box, T., Davies, R., van der Weyden, L.,
Jonkers, J., Smith, J., Plumb, B., Taylor, R., Nishijima, I. et al. (2004)
MICER—mutagenic insertion and chromosome engineering resource.
Nat. Genet., 36, 867–871.
26. Neu-Yilik, G. and Kulozik, A.E. (2008) NMD: multitasking between
mRNA surveillance and modulation of gene expression. Adv. Genet., 62,
185–243.
27. Zhou, Y.D., Lee, S., Jin, Z., Wright, M., Smith, S.E. and Anderson, M.P.
(2009) Arrested maturation of excitatory synapses in autosomal dominant
lateral temporal lobe epilepsy. Nat. Med., 15, 1208–1214.
28. Fili, O., Michaelevski, I., Bledi, Y., Chikvashvili, D., Singer-Lahat, D.,
Boshwitz, H., Linial, M. and Lotan, I. (2001) Direct interaction of a brain
voltage-gated K+ channel with syntaxin 1A: functional impact on
channel gating. J. Neurosci., 21, 1964–1974.
29. Saitsu, H., Kato, M., Mizuguchi, T., Hamada, K., Osaka, H., Tohyama, J.,
Uruno, K., Kumada, S., Nishiyama, K., Nishimura, A. et al. (2008) De
novo mutations in the gene encoding STXBP1 (MUNC18-1) cause early
infantile epileptic encephalopathy. Nat. Genet., 40, 782– 788.
30. Smart, S.L., Lopantsev, V., Zhang, C.L., Robbins, C.A., Wang, H., Chiu,
S.Y., Schwartzkroin, P.A., Messing, A. and Tempel, B.L. (1998) Deletion
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
1711
of the K(V)1.1 potassium channel causes epilepsy in mice. Neuron, 20,
809– 819.
Mitchell, K.J., Pinsonm, K.I., Kelly, O.G., Brennan, J., Zupicich, J.,
Scherz, P., Leighton, P.A., Goodrich, L.V., Lu, X., Avery, B.J. et al.
(2001) Functional analysis of secreted and transmembrane proteins
critical to mouse development. Nat. Genet., 28, 241– 249.
Sagane, K., Hayakawa, K., Kai, J., Hirohashi, T., Takahashi, E.,
Miyamoto, N., Ino, M., Oki, T., Yamazaki, K. and Nagasu, T. (2005)
Ataxia and peripheral nerve hypomyelination in ADAM22-deficient mice.
BMC Neurosci., 6, 33.
Brew, H.M., Gittelman, J.X., Silverstein, R.S., Hanks, T.D., Demas, V.P.,
Robinson, L.C., Robbins, C.A., McKee-Johnson, J., Chiu, S.Y., Messing,
A. and Tempel, B.L. (2007) Seizures and reduced life span in mice
lacking the potassium channel subunit Kv1.2, but hypoexcitability and
enlarged Kv1 currents in auditory neurons. J. Neurophysiol., 98, 1501–
1525.
Ribeiro, P.A., Sbragia, L., Gilioli, R., Langone, F., Conte, F.F. and
Lopes-Cendes, I. (2008) Expression profile of Lgi1 gene in mouse brain
during development. J. Mol. Neurosci., 35, 323– 329.
Cowell, J.K., Head, K., Kunapuli, P., Vaughan, M., Karasik, E. and
Foster, B. (2009) Inactivation of LGI1 expression accompanies early stage
hyperplasia of prostate epithelium in the TRAMP murine model of
prostate cancer. Exp. Mol. Pathol., 88, 77–81.
Bradley, A. (1987) Production and analysis of chimaeric mice. In
Robertson, E. (ed.), Teratocarcinomas and Embryonic Stem Cells—a
Practical Approach. IRL Press, pp. 113– 151.
Ramirez-Solis, R., Davis, A.C. and Bradley, A. (1993) Gene targeting in
embryonic stem cells. Methods Enzymol., 225, 855–878.
O’Gorman, S., Dagenais, N.A., Qian, M. and Marchuk, Y. (1997)
Protamine-Cre recombinase transgenes efficiently recombine target
sequences in the male germ line of mice, but not in embryonic stem cells.
Proc. Natl Acad. Sci., 94, 14602–14607.
Liu, P., Zhang, H., McLellan, A., Vogel, H. and Bradley, A. (1998)
Embryonic lethality and tumorigenesis caused by segmental aneuploidy
on mouse chromosome 11. Genetics, 150, 1155–1168.
Woo, R.S., Li, X.M., Tao, Y., Carpenter-Hyland, E., Huang, Y.Z., Weber,
J., Neiswender, H., Dong, X.P., Wu, J., Gassmann, M. et al. (2007)
Neuregulin-1 enhances depolarization-induced GABA release. Neuron,
54, 599– 610.
Chernova, O. and Cowell, J.K. (1998) Molecular definition of
chromosome translocations involving 10q24 and 19q13 in human
malignant glioma cells. Cancer Genet. Cytogenet., 105, 60– 68.