Download PDF - FEMS Microbiology Letters

First genetic characterization of a bacterial b-phenylethylamine
biosynthetic enzyme in Enterococcus faecium RM58
Angela Marcobal, Blanca de las Rivas & Rosario Muñoz
Departamento de Microbiologı́a, Instituto de Fermentaciones Industriales, CSIC, Madrid, Spain
Correspondence: Rosario Muñoz,
Departamento de Microbiologı́a, Instituto de
Fermentaciones Industriales, CSIC, C/ Juan de
la Cierva, 3. 28006, Madrid, Spain. Tel.: 1 34
91 562 2900; fax: 1 34 91 564 4853; e-mail:
[email protected]
Received 17 January 2006; revised 21 February
2006; accepted 22 February 2006.
First published online 21 March 2006.
doi:10.1111/j.1574-6968.2006.00206.x
Abstract
Enterococcus faecium RM58 produces b-phenylethylamine and tyramine. A gene
from Ent. faecium RM58 coding for a 625 amino-acid residues protein that shows
85% identity to Enterococcus faecalis tyrosine decarboxylase has been expressed in
Escherichia coli, resulting in L-phenylalanine and L-tyrosine decarboxylase activities. Both activities were lost when a truncated protein lacking 84 amino acids at
its C-terminus was expressed in E. coli. This study constitutes the first genetic
characterization of a bacterial protein having L-phenylalanine decarboxylase
activity and solves a long-standing question regarding the specificity of tyrosine
decarboxylases in enterococci.
Editor: Andre Klier
Keywords
phenylethylamine; tyramine; decarboxylase;
lactic acid bacteria; biogenic amines.
Introduction
The physiological role of trace amines in the brain has still
not been resolved. Evidence that b-phenylethylamine (PEA)
is a physiological constituent in the mammalian brain acting
as mood elevator in the central nervous system goes back to
the early 1970s. b-Phenylethylamine may function primarily
as an ‘endogenous amphetamine’, being an enhancer substance that facilitates the release of the neurotransmitters
catecholamine and serotonin, which has been linked to the
regulation of mood, physical energy and attention (Shimazu
& Miklya, 2004). Arguably, one of the foods with the greatest
impact on mood is chocolate (Benton & Donohoe, 1999),
and it is thought that the reason why chocolate is said to be
an aphrodisiac is due to b-phenylethylamine (Godfrey et al.,
1995). b-Phenylethylamine also seems to be linked to the
therapeutic effects of physical exercise on depression, playing a role in the commonly reported ‘runners high’ (Szabo
et al., 2001). However, in individuals with reduced monoamino oxidase detoxifying activity, b-phenylethylamine ingestion has sometimes been associated with symptoms such
as headache, dizziness and discomfort (Lüthy & Schlatter,
1983; Premont et al., 2001; Millichap & Yee, 2003).
The origin of b-phenylethylamine in the human diet is
diverse, and the contribution of b-phenylethylamine of
microbial origin is unknown. In foods, b-phenylethylamine
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
levels of 100 mg/kg in chocolate and cheese have been
reported (Halász et al., 1994). b-Phenylethylamine production has been described during food fermentations (Santos
et al., 2003) and it was suggested to be formed as a result of
the activity of tyrosine decarboxylating bacteria towards this
structurally related amino acid (Millichap & Yee, 2003). To
date, there have been just a small number of food fermenting
bacteria for which the presence of a tyrosine decarboxylase
gene has been described: Enterococcus faecalis (formerly
Streptococcus faecalis) (Connil et al., 2002), Lactobacillus
brevis (Lucas et al., 2003), Enterococcus faecium (formerly
Streptococcus faecium), Carnobacterium divergens (Coton
et al., 2004), and recently Lactococcus lactis (Fernández
et al., 2004). Of these bacteria, L-phenylalanine decarboxylation has been verified only for Lact. brevis, Ent. faecalis and
Ent. faecium (Bover-Cid et al., 2001; Gardini et al., 2001;
Moreno-Arribas & Lonvaud-Funel, 2001; Beutling & Walter,
2002). Purified tyrosine decarboxylase from Lact. brevis does
not demonstrate the ability to decarboxylate L-phenylalanine; instead it is L-tyrosine specific (Moreno-Arribas &
Lonvaud-Funel, 2001). However, controversial results are
found in Ent. faecalis. As early as 1940, Gale tested washed
suspensions of Ent. faecalis for the decarboxylation of 16
amino acids, including L-phenylalanine, and, as none of the
amino acids were decarboxylated, he concluded that the
enzyme is strictly specific for the L-tyrosine molecule (Gale,
FEMS Microbiol Lett 258 (2006) 144–149
145
Phenylethylamine production by Enterococcus faecium
1940). In 1944, Epps found that in an acetone powder of
Ent. faecalis cell extract, L-tyrosine and 3,4-dihydroxyphenylalanine are decarboxylated to the corresponding amines;
and, in an attempt to discover whether both compounds act
as substrates for the same enzyme or whether a separate
enzyme is involved, he concluded that it seems highly
probable that only one enzyme is involved in both decarboxylations (Epps, 1944). Finally in 1948, McGilvery and
Cohen, in the course of studies on which they used an
acetone powder of Ent. faecalis, could not conclude whether
tyrosine decarboxylase also decarboxylates L-phenylalanine
or whether a second decarboxylase is present in the acetone
powder (McGilvery & Cohen, 1948). Presently, this is still an
unsolved question. Moreover, a well-known multinational
chemical company offers two different catalogue products
from Ent. faecalis, dried cells from which L-tyrosine decarboxylase activity can be extracted and an L-phenylalanine
decarboxylase.
Among enterococci, Ent. faecalis seems to carry several
potential virulence factors, whereas Ent. faecium plays an
important beneficial role in the production of various
traditional fermented products and may also be successfully
used as probiotics (Franz et al., 2003). Therefore, knowledge
of its b-phenylethylamine production in fermented foods
would be an advantage. In order to investigate the production of b-phenylethylamine by Ent. faecium and ascertain its
origin, we report here the characterization of an Ent. faecium
gene coding for a decarboxylase involved in b-phenylethylamine and tyramine biosynthesis. The protein implicated in
both reactions has been overproduced in Escherichia coli and
biochemically characterized.
Materials and methods
Bacterial strains, plasmids and growth
conditions
Enterococcus faecium RM85, previously named Ent. faecium
BIFI-85, was isolated from a Spanish grape must. Escherichia
coli strain DH5a (Sambrook et al. 1989) was used as host for
recombinant plasmids. Plasmid pIN-III(lppp-5)A3 (Inouye
& Inouye, 1985) was used for cloning PCR fragments.
Plasmid pIN-III(lppp-5)A3 is an expression vector that
allows the hyperexpression of the desired protein upon
induction with 0.5 mM isopropyl-b-D-thiogalactopyranoside (IPTG) in an E. coli strain (DH5aF 0 [F 0 /end A1 hsdR17
1
r
(r
KmK ) supE44 thi-1 recA1 gyrA (Nal ) relA1 D(lacIZYAargF)U169 deoR (F80dlacDZ)M15]). The construction of
the recombinant plasmids pAM1 and pAM3 is described in
the text.
Enterococcus faecium was routinely grown in MRS medium (purchased from Difco, Detroit, MI) at 30 1C without
shaking. Escherichia coli cells were incubated in Luria–BerFEMS Microbiol Lett 258 (2006) 144–149
tani (LB) medium (Sambrook et al., 1989) at 37 1C with
shaking. When required, ampicillin was added to the
medium at 100 mg mL1. Chromosomal DNA, plasmid
purification and transformation of E. coli were carried out
as described elsewhere (Arena et al., 2002).
DNA manipulations
Restriction endonucleases, T4 DNA ligase and the Klenow
fragment of DNA polymerase were obtained commercially
and used according to the recommendations of the suppliers. Gel electrophoresis of plasmids, restriction fragments
and PCR products were carried out in agarose gels as
described (Sambrook et al., 1989). PCR amplifications were
performed as previously described (Arena et al., 2002) using
Pfu DNA polymerase (Stratagene, La Jolla, CA). DNA
sequencing was carried out using an Abi Prism 377TM DNA
sequencer (Applied Biosystems Inc., Branchburg, NJ).
Heterologous expression of the Enterococcus
faecium decarboxylase gene in Escherichia coli
The decarboxylase gene was PCR amplified from Ent.
faecium RM58 using Pfu DNA polymerase and the synthetic
primers 57 (5 0 -GCTCTAGAGGGTATTAATAATGAGTGAA
TCATTGTCG), 58 (5 0 -GCGAATTCTTAGCTATTATTTTG
CTTCGCTTGCC) and primer 98 (5 0 - GCGGATCCTTAGCTATTATTTTGCTTCGCTTGCC) (the underlined sequences
indicate restriction sites for XbaI in primer 57, EcoRI in 58
and BamHI for primer 98, as these restriction sites were not
included in the published putative decarboxylase nucleotide
sequence). Primer 57 is based on the sequence of plasmid
pIN-III(lppp-5)A3 and contains the ribosome-binding site
domain, as well as the initial start codon and the sequence
encoding the first five amino-acid residues of the decarboxylase. Primers 58 and 98 are also based on the sequence of
pIN-III(lppp-5)A3 and contain the sequence encoding the
five last amino-acid residues of the protein and several stop
codons arranged in tandem. The purified PCR fragments
were digested with XbaI and EcoRI or XbaI and BamHI, and
cloned into pIN-III(lppp-5)A3 digested with the same
restriction enzymes. The ligation mixture was introduced
by transformation into the strain E. coli DH5aF 0.
Enzyme assays
Cell extracts for enzyme assays were obtained from induced
cultures. Briefly, DH5a cells harbouring either the original
vector or the recombinant plasmid were grown in LB broth
supplemented with ampicillin (100 mg mL1) at 37 1C and
200 r.p.m. to an optical density at 600 nm of 0.4, and expression of the corresponding gene was induced by adding
IPTG to 0.5 mM (final concentration). After 4 h of induction, samples of the cultures were harvested by centrifugation
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
146
(10 000 g, 5 min) and the pelleted bacteria were resuspended
in 50 mM phosphate buffer (pH 6.5) and disrupted by
sonication. The insoluble fractions were separated by centrifugation (15 000 g, 15 min), and the supernatants were
used to detect the presence of hyperproduced proteins.
Protein concentration was determined with the Coomassie
protein assay reagent (Pierce, Rockford, IL).
The standard assay to determine L-phenylalanine or Ltyrosine decarboxylation was performed as described previously for L-tyrosine decarboxylation (Borrensen et al.,
1989), which included two buffer systems, 200 mM sodium
acetate buffer (pH 5.0) and 50 mM phosphate buffer (pH
6.5), and adding L-phenylalanine or L-tyrosine at a final
concentration of 3.6 mM.
After the incubation time, the amines present in the
reactions were determined by a thin-layer chromatography
(TLC) method (Garcı́a-Moruno et al., 2005).
Results and discussion
Production of b-phenylethylamine and tyramine
by Entercoccus faecium strains
Tyramine-producing Enterococcus faecium strains were isolated in a wide screening of biogenic amine production by
lactic acid bacteria isolated from grape must and wine
(Marcobal et al., 2004). As Ent. faecium strains had also
been reported to produce b-phenylethylamine (Bover-Cid
et al., 2001; Beutling & Walter, 2002), we examined our
tyramine-producing Ent. faecium strains for b-phenylethylamine production. All of the three Ent. faecium strains
analysed produced both amines, tyramine and b-phenylethylamine (data not shown). We selected Ent. faecium
RM58 in order to gain deeper insight into b-phenylethylamine biosynthesis. Considering the previous (i) postulation
of possibly only one enzyme being involved in b-phenylethylamine and tyramine biosynthesis in Ent. faecalis
(McGilvery & Cohen, 1948), (ii) the identification of the
Ent. faecalis tyrosine decarboxylase operon involved in
tyramine production (Connil et al., 2002), and finally (iii)
the presence of a putative tyrosine decarboxylase gene in
Ent. faecium (Coton et al., 2004), our first hypothesis was
that this gene codes for a phenylalanine decarboxylase in
Ent. faecium.
Overexpression in Escherichia coli of the gene
coding for a putative decarboxylase in
Entercoccus faecium
Following searches in the uncompleted Ent. faecium genome
database (http://genome.jgi-psf.org/draft_microbes/entfa/
entfa.home.html) for a putative tyrosine decarboxylase, a
gene coding for a 625 amino-acid residues protein was
found. The protein encoded by this gene was firstly anno2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
A. Marcobal et al.
tated in the database as glutamate decarboxylase and related PLP-dependent proteins (ZP_00287527) and today as
pyridoxal-dependent decarboxylase (ZP_00602894), and
showed 85% identity to Ent. faecalis tyrosine decarboxylase.
The gene coding for this putative decarboxylase was expressed in Escherichia coli in order to assign an unequivocal
function. The gene was PCR amplified from Ent. faecium
RM58 using Pfu DNA polymerase and the two synthetic
primers 57 and 58, and cloned into pIN-III(lppp-5)A3. The
resulting plasmid pAM1, contained the putative decarboxylase gene under the control of the lppp-5 and lacpo
promoters, which can be induced at high levels by IPTG.
However, when the insertion site was verified by DNA
sequencing, we observed that the gene was cloned in an
EcoRI site located at nucleotide position 1621. This EcoRI
site was only present in the Ent. faecium RM58 decarboxylase gene sequence (accession AJ783966). This unwanted
cloning event produces a truncated protein of 541 aminoacid residues, lacking 84 amino-acid residues of the Cterminus. In order to solve this cloning problem, primer 98
was designed. Following the same strategy described above,
plasmid pAM3 was obtained by cloning the 1.9 kb DNA
fragment containing the complete gene sequence of the Ent.
faecium RM58 putative decarboxylase in pIN-III(lppp-5)A3.
The correct sequence and insertion of the 1.9 kb fragment
into recombinant plasmid pAM3 was verified by restriction
analysis and DNA sequencing.
The putative decarboxylase from Ent. faecium RM58 was
overproduced in E. coli following the strategy described in
‘Enzyme assays’. Control cells containing the pIN-III(lppp5)A3 expression plasmid alone did not show expression over
the 4 h time course analysed, whereas the expression of
additional 68 kDa protein was apparent with DH5aF 0 cells
harbouring pAM3 (Fig. 1). This molecular mass is in good
agreement with the Mr deduced from the nucleotide sequence of the corresponding gene.
Enzymatic activity of the putative
decarboxylase gene
As reported above, sequence similarities had suggested that
the gene might be an L-tyrosine, an L-phenylalanine, or an Ltyrosine/L-phenylalanine decarboxylase. As a preliminary
test, production of b-phenylethylamine or tyramine was
examined by growing DH5aF 0 cells harbouring pINIII(lppp-5)A3 or pAM3 in decarboxylase medium described
by Maijala (1993) supplemented with ampicillin, IPTG and
0.1% of the corresponding precursor amino acid, L-phenylalanine or L-tyrosine, respectively. This decarboxylase medium also contained purple bromocresol as a pH indicator,
and a positive result is indicated by a colour change to
purple in response to the pH shift by the indicator. The pH
shift is dependent on the production of more alkaline amine
FEMS Microbiol Lett 258 (2006) 144–149
147
Phenylethylamine production by Enterococcus faecium
kDa
1
Phe
2
1 2
97.4
3
Tyr
4
PEA
5
6
7
8
9 10
Tyramine
66
45
31
Fig. 1. Sodium dodecyl sulphate-polyacrylamide gel electrophoresis
(SDS-PAGE) analysis of soluble cell extracts of isopropyl-b-D-thiogalactopyranoside (IPTG)-induced cultures of Escherichia coli DH5aF 0 harbouring the recombinant plasmid pAM3 for decarboxylase production. Lane
1, E. coli DH5aF 0 [pIN-III(lppp-5)A3]; lane 2, E. coli DH5aF 0 (pAM3). The
arrow indicates the overproduced protein. The 10% polyacrylamide gel
was stained with Coomassie blue. The positions of molecular mass
markers (SDS-PAGE standards; Bio-Rad, Germany) are indicated on the
left.
from the amino acid initially included in the medium.
Positive results for b-phenylethylamine and tyramine production were found in DH5aF 0 cells harbouring pAM3 and
not in pIN-III(lppp-5)A3 cells (data not shown). These
results indicated that the Ent. faecium putative decarboxylase seems to decarboxylate L-phenylalanine as well as
L-tyrosine, resulting in b-phenylethylamine or tyramine
production.
In order to unequivocally identify the amines produced,
supernatants of sonicated cell lysates prepared from DH5aF 0
cells harbouring pAM3 or pIN-III(lppp-5)A3 as described in
‘Enzyme assays’ were assayed for L-phenylalanine and Ltyrosine decarboxylase activity by following modified protocols based on methods previously described. We tested
enzymatic activities in cell extracts of E. coli DH5aF 0 cells
harbouring pIN-III(lppp-5)A3 or pAM3. Cell extracts from
E. coli DH5aF 0 harbouring the recombinant plasmid pAM3
showed phenylalanine and tyrosine decarboxylase activities,
whereas extracts prepared from control cells containing the
expression plasmid alone did not (Fig. 2). As shown in Fig.
2, the enzyme seems to decarboxylate more efficiently in
phosphate than in sodium acetate buffer. These results are in
accordance with previous Ent. faecalis results, where phenyFEMS Microbiol Lett 258 (2006) 144–149
Fig. 2. Thin-layer chromatography detection of b-phenylethylamine
(PEA) and tyramine produced by soluble cell extracts of Escherichia coli
DH5aF 0 harbouring the recombinant plasmid pAM3. The reactions were
performed in 50 mM phosphate buffer (PB; pH 6.5) or 200 mM sodium
acetate buffer (AB; pH 5.0), and supplemented with 3.6 mM of Lphenylalanine (Phe) (lanes 1–4) or L-tyrosine (Tyr) (lanes 6–9) as substrate.
Lane 1, E. coli DH5aF 0 [pIN-III(lppp-5)A3] in PB; lane 2, E. coli DH5aF 0
(pAM3) in PB; lane 3, E. coli DH5aF 0 [pIN-III(lppp-5)A3] in AB; lane 4, E.
coli DH5aF 0 (pAM3) in AB; lane 6; E. coli DH5aF 0 [pIN-III(lppp-5)A3] in PB;
lane 7, E. coli DH5aF 0 (pAM3) in PB; lane 8, E. coli DH5aF 0 [pINIII(lppp-5)A3] in AB; lane 9, E. coli DH5aF 0 (pAM3) in AB. Lane 5, PEA
standard solution; lane 10, tyramine standard solution. The arrows
indicate the positions of PEA and tyramine.
lethylamine production significantly decreased with decreasing pH (Gardini et al., 2001). Thus, we could prove
experimentally that this gene in Ent. faecium encodes a
functional decarboxylase that is able to perform L-phenylalanine and L-tyrosine decarboxylation. Similarly, we had
proved that the tyrosine decarboxylase previously described
in Ent. faecalis also possesses this dual function (data not
shown).
In order to elucidate if the deletion of the 84 amino-acid
residues on the protein C-terminus affects decarboxylase
activity, the truncated protein was expressed following
the same strategy described for the complete protein. As
expected, the deletion of the protein C-terminus disrupts
decarboxylase activity (data not shown).
In contrast to these enterococcal decarboxylases, Lact.
brevis tyrosine decarboxylase, showing a 74% identity to
Ent. faecium decarboxylase, is not able to decarboxylate Lphenylalanine, being specific for L-tyrosine (Moreno-Arribas & Lonvaud-Funel, 2001). Similarly, the archaeal Ltyrosine decarboxylase from Metanocaldococcus jannaschii,
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
148
not specifically related to the bacterial L-tyrosine decarboxylases previously identified, is specific for L-tyrosine (Kezmarsky et al., 2005). In addition, a specific aromatic amino
acid decarboxylase in Sorangium cellulosum So ce90 converted only L-dihydroxyphenylalanine to dopamine (Müller
et al., 2000).
In summary, we have demonstrated that Ent. faecium
RM58 possesses a gene that encodes a functional decarboxylase capable of producing b-phenylethylamine and tyramine from the amino acids L-phenylalanine and L-tyrosine.
In this study, we reported the first heterologous expression
of a bacterial tyrosine decarboxylase gene. Moreover, it also
constitutes the first genetic characterization of a bacterial Lphenylalanine decarboxylating enzyme and solves a longstanding question regarding the specificity of tyrosine
decarboxylases in enterococci. Thus, enterococci should be
considered as potential b-phenylethylamine-producing organisms in fermented foods, and therefore this characteristic
should be taken into account during strain selection in the
health and food industry, mainly for its use as a probiotic
because of its reported beneficial effect on moods and in the
alleviation of depression.
Acknowledgements
This work was supported by Grant 07G/0035/2003 from the
Comunidad de Madrid and RM03-002 from INIA. We
thank R. González for a critical reading of the manuscript.
We also thank Dr Michelle Sheehan for correcting the
English version of the manuscript. The technical assistance
of M.V. Santamarı́a and A. Gómez is greatly appreciated. A.
Marcobal was a recipient of a predoctoral fellowship and B.
de las Rivas of a postdoctoral fellowship both from the
Comunidad de Madrid.
References
Arena ME, Manca de Nadra MC & Muñoz R (2002) The arginine
deiminase pathway in the wine lactic acid bacterium
Lactobacillus hilgardii X1B: structural and functional study of
the arcABC genes. Gene 301: 61–66.
Benton D & Donohoe RT (1999) The effects of nutrients on
mood. Public Health Nutr 2: 403–409.
Beutling DM & Walter D (2002) 2-Phenylethylamine formation
by enterococci in vitro. Eur Food Res Technol 215: 240–242.
Borrensen T, Klausen NK, Larsen LM & Sorensen H (1989)
Purification and characterization of tyrosine decarboxylase
and aromatic-L-amino-acid decarboxylase. Biochem Biophys
Acta 993: 108–115.
Bover-Cid S, Hugas M, Izquierdo-Pulido M. & Vidal-Carou MC
(2001) Amino acid-decarboxylase activity of bacteria isolated
from fermented pork sausages. Int J Food Microbiol 66:
185–189.
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
A. Marcobal et al.
Connil N, Le Breton Y, Dousset X, Auffray Y, Rince A & Prevost H
(2002) Identification of the Enterococcus faecalis tyrosine
decarboxylase operon involved in tyramine production. Appl
Environ Microbiol 68: 3537–3544.
Coton M, Coton E, Lucas P & Lonvaud A (2004) Identification of
the gene encoding a putative tyrosine decarboxylase of
Carnobacterium divergens 508. Development of molecular
tools for the detection of tyramine-producing bacteria. Food
Microbiol 21: 125–130.
Epps HMR (1944) Studies on bacterial amino-acid
decarboxylases. 2. L ( )-tyrosine decarboxylase from
Streptococcus faecalis. Biochem J 38: 242–249.
Fernández M, Linares DM & Alvarez MA (2004) Sequencing of
the tyrosine decarboxylase cluster of Lactococcus lactis IPLA
655 and the development of a PCR method for detecting
tyrosine decarboxylating lactic acid bacteria. J Food Prot 67:
2521–2529.
Franz CMAP, Stiles ME, Schleifer KH & Holzapfel WH (2003)
Enterococci in foods – a conundrum for food safety. Int J Food
Microbiol 88: 105–122.
Gale EF (1940) The production of amines by bacteria. 2. The
production of tyramine by Streptococcus faecalis. Biochem J 34:
846–852.
Garcı́a-Moruno E, Carrascosa AV & Muñoz R (2005) A rapid and
inexpensive method for the determination of biogenic amines
from bacterial cultures by thin-layer chromatography. J Food
Prot 68: 625–629.
Gardini F, Martuscelli M, Carusso MC, Galgano F, Crudele MA,
Favati F, Guerzoni ME & Suzzi G (2001) Effects of pH,
temperature and NaCl concentration on the growth kinetics,
proteolytic activity and biogenic amine production of
Enterococcus faecalis. Int J Food Microbiol 64: 105–117.
Godfrey PD, Hatherley LD & Brown RD (1995) The shapes of
neurotransmitters by millimetre-wave spectroscopy: 2phenylethylamine. J Am Chem Soc 117: 8204–8210.
Halász A, Baráth A, Simon-Sakardi L & Holzapfel W (1994)
Biogenic amines and their production by microorganisms in
food. Trends Food Sci Technol 5: 42–49.
Inouye S & Inouye M (1985) Up-promoter mutations in the lpp
gene of Escherichia coli. Nucl Acids Res 13: 3101–3110.
Kezmarsky ND, Xu H, Graham DE & White RH (2005)
Identification and characterization of a L-tyrosine
decarboxylase in Methanocaldococcus jannaschii. Biochim
Biophys Acta 1722: 175–182.
Lucas P, Landete J, Coton M, Coton E & Lonvaud-Funel A (2003)
The tyrosine decarboxylase operon of Lactobacillus brevis
IOEB 9809: characterization and conservation in tyramineproducing bacteria. FEMS Microbiol Lett 229: 65–71.
Lüthy J & Schlatter C (1983) Biogene amine in lebensmitteln: Zur
wirkung von histamin, tyramin und phenylethylamin auf den
Menschen. Z Lebensm-Unters-Forsch 177: 439–443.
Maijala RL (1993) Formation of histamine and tyramine by some
lactic acid bacteria in MRS-broth and modified
decarboxylation agar. Lett Appl Microbiol 17: 40–43.
FEMS Microbiol Lett 258 (2006) 144–149
149
Phenylethylamine production by Enterococcus faecium
Marcobal A, de las Rivas B, Garcı́a-Moruno E & Muñoz R (2004)
The tyrosine decarboxylation test does not differentiate
Enterococcus faecalis from Enterococcus faecium. Syst Appl
Microbiol 27: 423–426.
McGilvery RW & Cohen PP (1948) The decarboxylation of Lphenylalanine by Streptococcus faecalis R. J Biol Chem 174:
813–816.
Millichap JG & Yee MM (2003) The diet factor in pediatric and
adolescent migraine. Pediatr Neurol 28: 9–15.
Moreno-Arribas V & Lonvaud-Funel A (2001) Purification and
characterization of tyrosine decarboxylase of Lactobacillus
brevis IOEB 9809 isolated from wine. FEMS Microbiol Lett 195:
103–107.
Müller R, Gerth K, Brandt P, Blöcker H & Beyer S (2000)
Identification of an L-dopa decarboxylase gene from
Sorangium cellulosum So ce90. Arch Microbiol 173: 303–306.
FEMS Microbiol Lett 258 (2006) 144–149
Premont RT, Gainetdinov RR & Caron MG (2001) Following the
trace of elusive amines. Proc Natl Acad Sci USA 98: 9474–9475.
Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A
Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY.
Santos WC, Souza MR, Cerqueira MMOP & Glória MBA (2003)
Bioactive amines formation in milk by Lactococcus in the
presence or not of rennet and NaCl at 20 and 32 1C. Food Chem
81: 595–606.
Shimazu S & Miklya I (2004) Pharmacological studies with
endogenous enhancer substances: beta-phenylethylamine,
tryptamine, and their synthetic derivatives. Progr
Neuropsychopharmacol Biol Psychiatry 28: 421–427.
Szabo A, Billett E & Turner J (2001) Phenylethylamine, a possible
link to the antidepressant effects of exercise. Br J Sports Med 35:
342–343.
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c