Download Personalized Medicine Class of 2016

Personalized Medicine
Dr. M. Jawad Hassan
Personalized Medicine
•
•
•
•
•
•
Human Genome and SNPs
What is personalized medicine?
Pharmacogenetics
Case study – warfarin etc
Public policy
Pros-cons
Genotypes and Human Disease
• Do all humans have the same DNA?
• What are single nucleotide polymorphisms or
SNPs?
• Can we associate SNPs with medical histories of
individuals and achieve statistically significant
correlations?
“personal genetics”?
Because learning about our own
DNA is rapidly becoming
inexpensive and accessible
• Genetic testing available directly to consumers (DTC)
• Reading our genome sequence will soon cost under $1,000
(a routine medical test in the future?)
• Insights about our health, behavior and other traits
• Highly personal information with social, legal and
familial impact
Human Genome Project outcomes:
A. Determined where genes are located
on our chromosomes.
B. Assessed # of genes humans have –
between 20,000 – 25,000 (27000 now)
C. The creation of a “map” or
“reference sequence” to which other
genomes (or parts of genomes) can be
compared
Oct-11
Why personal genome analysis?
• Ideas for more medical tests and interventions if I learn I’m at risk
• To find the right drugs, in the right doses, for my conditions
• Motivation to my change habits
• Planning for my long term medical and financial needs
• To inform my reproductive decisions
International consortium that aims
in genotyping the genome of 270
individuals from four different
populations.
HUJI 2006
- Launched in 2002.
- First phase (2005):
~1 million SNPs for 270 individuals from four populations
- Second phase (2007):
~3.1 million SNPs for 270 individuals from four
populations
- Third phase (ongoing):
> 1 million SNPs for 1115 individuals across 11
populations
HUJI 2006
Where should we look?
SNP = Single Nucleotide Polymorphism
Cases:
AGAGCAGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCGGTAGAGCCGTGAGATCGACATGATAGCC
AGAGCCGTCGACATGTATAGTCTACATGAGATCGACATGAGATCGGTAGAGCAGTGAGATCGACATGATAGTC
AGAGCAGTCGACAGGTATAGTCTACATGAGATCGACATGAGATCGGTAGAGCCGTGAGATCGACATGATAGCC
AGAGCAGTCGACAGGTATAGCCTACATGAGATCAACATGAGATCGGTAGAGCAGTGAGATCGACATGATAGCC
AGAGCCGTCGACATGTATAGCCTACATGAGATCGACATGAGATCGGTAGAGCCGTGAGATCAACATGATAGCC
AGAGCCGTCGACATGTATAGCCTACATGAGATCGACATGAGATCGGTAGAGCAGTGAGATCAACATGATAGCC
AGAGCCGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCGGTAGAGCAGTGAGATCAACATGATAGTC
AGAGCAGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCGACATGATAGCC
Controls:
Associated SNP
AGAGCAGTCGACATGTATAGTCTACATGAGATCGACATGAGATCGGTAGAGCAGTGAGATCAACATGATAGCC
AGAGCAGTCGACATGTATAGTCTACATGAGATCAACATGAGATCTGTAGAGCCGTGAGATCGACATGATAGCC
AGAGCAGTCGACATGTATAGCCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCAACATGATAGCC
AGAGCCGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCGACATGATAGTC
AGAGCCGTCGACAGGTATAGTCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCAACATGATAGCC
AGAGCAGTCGACAGGTATAGTCTACATGAGATCGACATGAGATCTGTAGAGCAGTGAGATCGACATGATAGCC
AGAGCCGTCGACAGGTATAGCCTACATGAGATCGACATGAGATCTGTAGAGCCGTGAGATCGACATGATAGCC
AGAGCCGTCGACAGGTATAGTCTACATGAGATCAACATGAGATCTGTAGAGCAGTGAGATCGACATGATAGTC
Published Genome-Wide Associations through 6/2009, 439
published GWA at p < 5 x 10-8
Other Data Sources
• Human Genome Diversity Project
– 50 populations, 1000 individuals, 650k SNPs
• POPRES
– 6000 individuals (controls)
• Encode Project
– Resequencing, discovery of new SNPs
• 1000 Genomes project
• dbGAP
Haplotypes
• Can 1,000,000 SNPs tell us everything?
• No, but they can still tell us a lot about the
rest of the genome.
– SNPs in physical proximity are correlated.
– A sequence of alleles along a chromosome are
called haplotypes.
A Definition of Personalized Medicine
• Personalized medicine is the use of information from
a patient's genotype to:
• initiate a preventative measure against the
development of a disease or condition, or
• select the most appropriate therapy, for an existing
disease or condition, that is particularly suited to
that patient.
The Leading Edge:
Pharmacogenomics (PGx)
• Using an individual’s genetic profile to predict response to
certain drugs
• Clinical goal is to enable better drug treatment decisions and
safer medical care
• Pharmaceutical industry goal is to develop more predictable and
more effective drugs
• Genetic tests already in use to predict patient response to
therapy in the fields of cancer and infectious disease
The Vision of Personalized Medicine
Genetic and epigenetic variants +
measurable environmental/behavioral factors would
be used for a personalized treatment and diagnosis
Examples of SNPs
Linked to Drug Response
Case Study: Warfarin
• Most widely prescribed oral anticoagulant for preventing
thrombolytic events, despite its narrow therapeutic range
• Problematic dosing due to patient’s diet, age, and other medications
• Second most common drug implicated in adverse drug reaction-linked
emergency room visits
Personalized Warfarin Dosing
• One-third of thrombosis patients metabolize their warfarin
dose differently than expected due in large part to
variations of 2 genes,VKORC1 and CYP2C9
• VKORC1 SNPs, such as the 1639G>A allele, indicate that a
patient will respond well to a lower dose of warfarin
• CYP2C9*2 and CYP2C9*3 alleles encode SNP variants of
CYP2C9 with reduced efficiency in degrading warfarin
• Warfarin labeling suggesting genetic testing of VKORC1 and
CYP2C9 is the first indication of personalized dosing being
approved by the FDA
Example 1: Pharmacogenetics Claim
•
obtaining a nucleic acid sample from said human
subject;
•
•
subjecting the sample to PCR and identifying i and/or ii:
i) in the subject’s VKORC1 gene, the nucleotide base
at position X of SEQ ID NO:1 in the sample from the
subject and/or
ii) in the subject’s CYP2C9 gene, the nucleotide base
at position Y of SEQ ID NO:2 in the sample from the
subject; and
•
•
Treating the human subject with a dosage of warfarin
indicated by their genotype as identified in b.
Example 2: SNP Claim
An isolated nucleic acid sequence comprising SEQ ID NO:1.
The specification teaches that SEQ ID NO:1 is a variant of
the ERBB2 gene having an A (adenine) to C (cytosine)
mutation at position 101 (A101>C).
This mutation (A101>C) is typically found in breast cancer
patients.
•
this mutation (A101>C) correlates with a significantly
better response to “breast cancer drug X” versus placebo.
•
without mutation (A101>C), “breast cancer drug X” is
an ineffective treatment.
The Debate on Direct-to-Consumer Tests
• Pros
• Early warning about predisposition could promote
healthier lifestyles
• Cons
• Is the data more harmful than helpful without
context? (patient confidentiality)
• Is it beneficial to be informed that you are at high risk
to develop a disease for which there is no cure?
Personal genomes: what are the challenges?
1. How far ahead is the technology of its clinical usefulness?
2. How much information would you want to know?
3. Will fair weight be given to environmental & social factors?
4. How will your genetic information affect your family?
5. How much should we be concerned about discrimination at work and by insurance
companies?
6. How can we ensure access for all?
For more information, please visit www.pged.org