* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Additional Slides Ch Biotech Dr Violet
Transcriptional regulation wikipedia , lookup
DNA barcoding wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Promoter (genetics) wikipedia , lookup
DNA sequencing wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Molecular evolution wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
DNA supercoil wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genomic library wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Molecular cloning wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Point mutation wikipedia , lookup
Restriction enzyme wikipedia , lookup
SNP genotyping wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Deoxyribozyme wikipedia , lookup
RESTRICTION ENDONUCLEASES • Restriction endonucleases (restriction enzymes): Bacterial enzymes that cleave double-stranded DNA into smaller, more manageable fragments • Each enzyme cleaves DNA at a specific palindromic nucleotide sequence (4-6bp), producing restriction fragments. • DNA sequence that is recognized by a restriction enzyme is called restriction site • These enzymes form either staggered cuts (sticky or cohesive ends) or blunt end cuts on the DNA • Bacterial DNA ligases can anneal two DNA fragments from different sources if they have been cut by the same restriction endonucleasethe hybrid combination of two fragments is called a recombinant DNA molecule 2 Genomic DNA libraries: 1. It is the collection of fragments of double-stranded DNA obtained by digestion of the total DNA of the organism with a restriction enzyme. 2. Ligation of the fragments to a vector. 3. The recombinant DNA molecules are replicated within host bacteria. 4. The amplified DNA fragments represented the entire genome of the organism and are called a genomic library. 3 DNA Sequencing Cloned fragment Primer Primer Binding sites Plasmid (or phage) with cloned DNA fragment 4 The ddATP Reaction Pol. 3’AATAGCATGGTACTGATCTTACGCTAT5’ Pol. Pol. Pol. 5’TTATCG 5’TTATCGTA 5’TTATCGTACCATGA 5’TTATCGTACCATGACTAGA 5’TTATCGTACCATGACTAGATGCGATA Let me Through! Oh come on! Not Again! Agggg…. 5’TTATCGTA 5’TTATCGTACCA 5’TTATCGTACCATGA 5’TTATCGTACCATGACTA 5’TTATCGTACCATGACTAGA 5’TTATCGTACCATGACTAGATGCGA 5’TTATCGTACCATGACTAGATGCGATA 5 DNA Sequencing ddCTP ddGTP ddTTP Read 5’ to 3’ from bottom to top • Products from 4 reactions each containing a small amount of a dideoxynucleotide are loaded onto a gel ddATP • Polyacrlyamide gels capable of separating fragments differing in size by only one base • High concentrations of urea are used to prevent formation of double stranded DNA or secondary structures • Because polymerization goes 5’ to 3’ shortest fragments are 5’ compared to longer fragments which are in the 3’ direction 6 Synthetic oligonucleotide probes • If the sequence of all or part of the target DNA is known, single stranded oligonucleotide probes of 20-30 nucleotides can be synthesized that are complementary to a small region of the gene of interest. • If the sequence of the gene is unknown, the amino acid sequence of the protein-that is the gene product-may be used to construct a probe. Short, single-stranded DNA sequences (15-30 nucleotides) are synthesized, using the genetic code as a guide. • Because of the degeneracy of the genetic code synthesize several oligonucleotides. 7 • Use of a pair of such ASOs (one specific for the normal allele and one specific for the mutant allele) allows one to distinguish the DNA from all three possible genotypeshomozygous normal, heterozygous, and homozygous mutant. 8 • Two DNA variations commonly resulting in RFLPs: 1. Single base changes in DNA: • About 90% of human genome variation comes in the form of single nucleotide polymorphisms, or SNPs (pronounced "snips"), that is, variations that involve just one base. • The alteration of one or more nucleotides at a restriction site can render the site unrecognizable by a particular restriction endonuclease. A new restriction site can also be created by the same mechanism. • In either case, cleavage with an endonuclease results in fragments of lengths differing from the normal, which can be detected by DNA hybridization 2. Tandem repeats: Polymorphism in chromosomal DNA can arise from the presence of a variable number of tandem repeats. These are short sequences of DNA at scattered locations in the genome, repeated in tandem (like freight cars of a train). • The number of these repeat units varies from person to person, but is unique for any given individual and, therefore, serves as a molecular fingerprint. • Cleavage by restriction enzymes yields fragments that vary in length depending on how many repeated segments are contained in the fragment. • Variations in the number of tandem repeats can lead to polymorphism. Prenatal diagnosis Families with a history of severe genetic disease, may wish to determine the presence of the disorder in a developing fetus by prenatal diagnosis. Many methods are available but molecular analysis of fetal DNA promises to provide the most detailed genetic picture. Direct diagnosis of sickle cell disease is preformed using RFLPs The Sickle Cell Anemia Mutation Normal b-globin DNA C Mutant b-globin DNA T T C G A A G U A mRNA mRNA Normal b-globin Mutant b-globin Glu H2 N C C A T Val O OH H CH2 H2C C OH O Acid H2 N C C O OH H CH CH3 H3C Neutral Non-polar Direct diagnosis of sickle cell disease using RFLPs: • The genetic disorders of hemoglobin are the most common genetic diseases in humans. • In the case of sickle cell disease, the mutation that gives rise to the disease is actually one and the same as the mutation that gives rise to the polymorphism. Direct detection by RFLPs of diseases that result from point mutations is at present limited to only a few genetic diseases. • Sickle cell anemia is caused by a point mutation. The sequence altered by the mutation abolishes the recognition site of the restriction endonuclease MstII that recognizes the nucleotide sequence CCTNAGG (where N is any nucleotide). • Thus, the A to T mutation within a codon of the bs-globin gene eliminates a cleavage site for the enzyme. RFLP analysis • Sickle cell anemia is caused by a point mutation (A to T mutation (base substitution) within a codon of the bsglobin gene). The sequence altered by the mutation abolishes the recognition site CCTNAGG (where N is any nucleotide). of the MstII restriction endonuclease • Normal DNA digested with MstII yields a 1.15 kb fragment, whereas a 1.35 kb fragment is generated from the ßs gene as a result of the loss of one MstII cleavage site. • Diagnostic techniques for analyzing fetal DNA provide safe, early detection of sickle cell anemia, as well as other genetic diseases. 14 PCR Temperature 100 Melting 94 oC Extension Annealing Primers 50 oC 50 0 94 oC 72 oC T i m e 3’ 3’ 5’ 5’ 3’ 3’ 5’ 5’ 5’ 3’ 5’ 5’ 5’ 3’ 5’ 5’ 5’ 3’ 5’ 5’ 5’ 30x Melting 5’ 3’ 15 3’ 5’ 3’ Temperature 100 Melting 94 oC PCR 50 0 T i m e 3’ 5’ 5’ 3’ 16 Temperature 100 50 0 3’ 5’ 5’ Melting 94 oC Extension Annealing 72 oC Primers 50 oC 30x T i m e 5’ 5’ 5’ Melting 94 oC PCR 5’ 3’ 5’ 5’ 5’ 5’ 5’ 5’ 17 Temperature 100 Melting 94 oC 50 0 3’ 5’ 5’ Melting 94 oC Extension Annealing 72 oC Primers 50 oC 30x T i m e 5’ 5’ 5’ PCR 5’ 3’ Fragments of defined length 5’ 5’ 5’ 5’ 5’ 5’ 18 DNA Between The Primers Doubles With Each Thermal Cycle Number 1 2 0 1 Cycles 4 8 16 32 64 2 3 4 5 6 19 Steps of a PCR • At the completion of one cycle of replication, the reaction mixture is heated again to denature the DNA strands (of which there are now four). and the cycle of chain extension is repeated. • Thus, each newly synthesized polynucleotide can act as a template for the successive cycles. This leads to an exponential increase in the amount of target DNA with each cycle, hence, the name "polymerase chain reaction” • By using a heat-stable DNA polymerase (for example, Taq polymerase) from a thermophilic bacterium, the polymerase is not denatureddoes not have to be added at each successive cycle. • Each extension product of the primer includes a sequence complementary to the primer at the 5' end of the target sequence. • Advantages o PCR: sensitivity (target DNA is less than 1 part in a 106 of the initial sample) and speed ( as compared to recombinant DNA cloning technology) 20 21