Download A two-component system is required for colonization

Microbiology (2009), 155, 2288–2295
DOI 10.1099/mic.0.027755-0
A two-component system is required for
colonization of host cells by meningococcus
Anne Jamet,1,2 Clotilde Rousseau,1,2 Jean-BenoÎt Monfort,1,2 Eric Frapy,1,2
Xavier Nassif1,2,3 and Patricia Martin1,2
Correspondence
1
Patricia Martin
2
[email protected]
Institut National de la Santé et de la Recherche Médicale, Unité 570, F-75015 Paris, France
Université Paris Descartes, Faculté de Médecine René Descartes, F-75006 Paris, France
3
Assistance Publique–Hôpitaux de Paris, Hôpital Necker–Enfants Malades, F-75015 Paris, France
Received 22 January 2009
Revised 10 March 2009
Accepted 31 March 2009
In order to adapt to changing environments, bacteria have evolved two-component systems
(TCSs) that are able to sense and respond to environmental stimuli. The signal perception relies
on a sensor protein whose activation allows rapid adaptation through transcriptional regulation
achieved by the regulatory protein. The ability to adhere to and grow on the surface of human host
cells is an absolute requirement for many pathogens, including Neisseria meningitidis, in order to
colonize new hosts and to disseminate inside their host. Among the four TCSs encoded in the
meningococcus genome, only the PhoQ (MisS)/PhoP (MisR) system has been shown to
constitute a functional signal transduction circuit. To investigate the involvement of this TCS in the
adaptation process requisite for host cell colonization, we have tested the ability to grow on host
cells of a mutant inactivated for the sensor of the TCS. Our results demonstrate the involvement of
the TCS in the adaptation of the meningococcus to growth on host cells. We show that the
expression of the PhoQ (MisS)/PhoP (MisR) TCS is cell-contact controlled. Furthermore, this
TCS controls the regulation of a group of genes, the REP2 regulon, previously shown to be cellcontact regulated and to encode functions crucial for the adaptation of the bacterium to host cell
colonization. Thus, we provide evidence that one of the four TCSs existing in N. meningitidis
contributes to the adaptation of the pathogen to growth on host cells.
INTRODUCTION
Neisseria meningitidis is a worldwide cause of septicaemia
and meningitis. Paradoxically, the meningococcus asymptomatically colonizes the upper respiratory tract of about
8–25 % of the human population and disseminates from
person to person by direct contact (Stephens et al., 2007).
In a small percentage of colonized people, the bacterium is
able to invade the bloodstream and to cross the blood–
brain barrier. The ability of the bacterium to establish an
efficient interaction with host cells (epithelial and
endothelial cells) is crucial for its behaviour as a
commensal and a pathogen, by allowing colonization of
the nasopharynx and crossing of the blood–brain barrier.
This ability to grow on human cells implies that the
bacterium is able to rapidly adapt.
A regulon of 14 genes has been shown to be upregulated as
N. meningitidis initially interacts with host cells and
downregulated upon prolonged contact with host cells
(Morelle et al., 2003). The genes of this regulon encode
functions critical for the adaptation of the bacterium to
Abbreviations: EMSA, electrophoretic mobility shift assay; HUVEC,
human umbilical vein endothelial cell; TCS, two-component system.
2288
growth onto host cells, such as pilC1, which is required for
pilus-mediated adhesion (Taha et al., 1998), and the
exonuclease xseB gene, which controls an inducible repair
system (Morelle et al., 2005). These genes are characterized
by the presence of a REP2 repeat upstream of the open
reading frame. The mechanism controlling the expression
of this regulon is unknown.
Perception and response to environmental stimuli is
frequently mediated by two-component signal transduction systems (TCSs) (Beier & Gross, 2006; Garcı́a Véscovi
et al., 1996). Classical TCSs consist of a membrane-bound
sensor kinase and a cytoplasmic response regulator. The
histidine kinase is autophosphorylated in response to an
environmental signal. The phosphoryl group is then
transferred to the response regulator. This ultimately
results in modification of gene expression in response to
the environmental stimulus (Beier & Gross, 2006). In
contrast to Escherichia coli, which possesses 30 TCSs
(Blattner et al., 1997; Oshima et al., 2002), N. meningitidis
contains only four putative TCSs (Parkhill et al., 2000;
Tettelin et al., 2000). Experimental evidence demonstrating
a regulatory function is only available for one of these four
TCSs, i.e. the NMA0797 (PhoQ, MisS)/0798 (PhoP, MisR)
Downloaded from www.microbiologyresearch.org by
027755 G 2009 INSERM
IP: 88.99.165.207
On: Fri, 28 Apr 2017 17:54:00
Printed in Great Britain
Regulation of N. meningitidis–host cell interaction
system (Johnson et al., 2001; Newcombe et al., 2004, 2005;
Tzeng et al., 2004, 2006, 2008). A meningococcal knockout
mutant in the NMA0798 gene was reported to display an
attenuated virulence phenotype in a mouse model of
infection (Newcombe et al., 2004). This TCS was also
shown to be necessary for the bacterium to cross an
epithelial cell layer (Johnson et al., 2001), and was
demonstrated to constitute a functional signal transduction
system (Tzeng et al., 2006) that modulates the meningococcal virulence factor lipopolysaccharide (Tzeng et al.,
2004). In addition, transcriptomic analyses revealed that
inactivation of NMA0798 perturbed the expression of a
large number of genes (Newcombe et al., 2005), many of
which are involved in the synthesis of components of the
meningococcal cell surface (Tzeng et al., 2008).
Here, we investigated the role of the NMA0797 (PhoQ,
MisS)/0798 (PhoP, MisR) system in the adaptation of
meningococci to colonization of host cells. We show that
this system is required to optimize the growth of the
bacteria on the apical surface of human cells. In addition
we demonstrate that it controls the expression of the genes
of the REP2 regulon involved in the adaptation of the
bacterium to growth on host cells.
Total RNA isolation, real-time RT-PCR. Total RNA isolation and
real-time RT-PCR were performed as previously described (Morelle et
al., 2003; Yasukawa et al., 2006) from bacteria grown in infection
medium and harvested after 1 h and 4 h of adhesion to HUVECs.
Two reverse transcription reactions were performed for each RNA
sample isolated from three adhesion assays. Primers NMA0612prom-Up and NMA0612-prom-Down were designed to PCR amplify
the NMA0612 promoter region and were used to check the absence of
chromosomal contamination in RNA samples (Table 1). The aphA3
gene, which encodes kanamycin resistance, was used as an internal
reference. The aphA3 gene is located in the transposon in strain
8013NMA0797 and inserted in the intergenic region located between
divergently transcribed genes NMA2226 and NMA2227 in the wildtype 8013 strain. The ‘induction index’ was calculated for each gene
considered at every time point, using non-cell-associated bacteria
grown in an identical infection medium as calibrator. Statistical
significance was evaluated by using Student’s t-test, with P,0.01
considered significant.
Expression and purification of recombinant NMA0798 protein.
The open reading frame of NMA0798 devoid of the stop codon was
amplified by PCR using genomic DNA from N. meningitidis and
primers NMA0798-NcoI-59/NMA0798-XhoI-39 (Table 1), which
contain restriction sites for NcoI and XhoI. This PCR product was
digested with NcoI and XhoI, purified with the QIAEXII gel extraction
kit and subcloned into pET28a(+) (Novagen) which had been
previously digested with NcoI and XhoI. This introduced a six-
METHODS
Bacterial strains and growth conditions. The strain used in this
study is a derivative of the piliated, Opa2, Opc2, PilC1+ and PilC2+
serogroup C N. meningitidis 8013 strain (Nassif et al., 1993). N.
meningitidis strains were grown on GC agar (GCB; Difco),
supplemented with Kellogg’s defined supplement (Kellogg et al.,
1963) overnight at 37 uC in a moist atmosphere containing 5 % CO2.
For selection of transformants, the growth medium was supplemented with kanamycin (100 mg ml21). E. coli DH5a was grown in Luria–
Bertani (LB) broth or on plates at 37 uC and was used for the
propagation of plasmids (Sambrook et al., 1989). E. coli BL21(DE3)
was used for recombinant protein expression. When necessary, E. coli
was grown in the presence of kanamycin (30 mg ml21) or ampicillin
(50 mg ml21).
Construction of a mutant of the NMA0797 gene. A mutant
disrupted for the gene encoding the sensor of the NMA0797/0798
TCS, i.e. NMA0797, was present in the library of signature-tagged
mutants of N. meningitidis (Geoffroy et al., 2003) available in the
laboratory. This mutation was introduced by transformation into N.
meningitidis strain 8013. The transformants were selected in the
presence of kanamycin. We showed by RT-PCR that genes NMA0797
and NMA0796 were not co-transcribed. Therefore the insertion of the
transposon cannot result in any polar effect.
Adhesion assay. Human umbilical vein endothelial cells (HUVECs)
(promoCell) were seeded at 46104 cells cm22 in a six-well culture
plate and grown overnight at 37 uC in a humidified incubator with
5 % CO2 as previously described (Morelle et al., 2003). Briefly, cell
monolayers were infected with bacteria in the exponential growth
phase (m.o.i.5400). Bacteria were left in contact with the cells for
30 min, the supernatant was then removed, and the wells were gently
washed with infection medium (t50 h). Monolayers were then
washed every hour and fresh infection medium was added. The
adherent bacteria were harvested after 1 h (early stage) and 4 h (late
stage) of infection.
http://mic.sgmjournals.org
Table 1. Oligonucleotides used in the study
Primer
NMA0612-prom-Up
NMA0612-prom-Down
RT-aphA3-3
RT-aphA3-5
RT-pilC1-Up
RT-pilC1-Down
RT-xseB-Up
RT-xseB-Down
RT-parC-Up
RT-parC-Down
RT-NMA0797-Up
RT-NMA0797-Down
RT-NMA0798-Up
RT-NMA0798-Down
NMA0798-NcoI-59
NMA0798-XhoI-39
EMSA_NMA0798-F
EMSA_NMA0798-R
EMSA_REP2-pilC1-F
EMSA_REP2-pilC1-R
EMSA_REP2-xseB-F
EMSA_REP2-xseB-R
EMSA_REP2-parC-F
EMSA_REP2-parC-R
EMSA_parE-F
EMSA_parE-R
Footprint_REP2-xseB-F
Footprint_REP2-xseB-R
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 28 Apr 2017 17:54:00
Sequence (5§ to 3§)
ggtaccttgatttcgggcggtttgcc
gagctctacgctctctcaaacggtacg
gacctttggaacaggcagctt
gccggtataaagggaccacc
ggtggaggttctgtctttttcg
gtaggtggctgtgcctttttc
gcgaaatgcccttggaaga
acttgcgccagcttggttt
ggaaggcaatgtgtccatgaa
ccagccattcctgcaaaatc
catccttgccaacgaaagctac
cgatgttgatcaggatggtgc
ccgcaagctggcaaaattc
aagccgcgtacggtttgaa
catgccatggcatgcatgagccgcgtattactcgtag
ccgctcgagcgggtttttgacaaacaggtagcc
ctcaaagactgcaaagcc
ggctcatggtgtttcctt
cctgcccgacggtatcccgcgaagcaagat
ctgcctttttaaagttttattcatcgt
taccggaacatccgaaact
tcatcgtgtttccttttcgg
ccgcatacacaatgtttca
gcggttgcatatttatcgt
gctgctgaccctgttctacc
gttgacatctacgcggaaca
tcgggtttcagacggcatccg
attcaaggttcaactcctt
2289
A. Jamet and others
(a)
ln (8013NMA0797 c.f.u./8013 c.f.u.)
histidine tag at the C-terminus of the recombinant protein. The
protein was expressed in E. coli BL21(DE3) and purified using NiNTA agarose (Qiagen).
Electrophoretic mobility shift assay (EMSA). The experiment was
performed as described by Tzeng et al. (2006), using as probes PCR
products generated using genomic DNA from N. meningitidis as a
template and primers indicated in Table 1.
DNase I protection. The experiment was performed as described by
Tzeng et al. (2006), using primers Footprint_REP2-xseB-F and
Footprint_REP2-xseB-R (Table 1), corresponding to the coding or
the non-coding strand.
We investigated the role of the NMA0797/0798 TCS in
meningococcal colonization of host cells. A mutant of the
sensor was engineered, thus abolishing the perception of an
environmental signal by the bacterium. The ability of this
mutant to grow onto the apical surface of host cells was
evaluated by determining a competitive index with the
parental wild-type (WT) strain 8013. HUVEC monolayers
were infected with a mix of WT strain (kanamycin
sensitive), and mutant 8013NMA0797 strain (kanamycin
resistant). The number of bacteria adhering at t50 h
(30 min after the infection), t51 h (early adhesion step)
and t54 h (late adhesion step) was determined. The ratio
of WT and mutant strains interacting with the monolayer
was determined. At t50 h, the initial change in the natural
logarithm of the ratio quantified the difference in
adhesiveness. Subsequent changes in the logarithm of the
ratio, measured at t51 h and t54 h, quantified the
difference in fitness, i.e. the ability of the bacteria to grow
onto the monolayer. This revealed that the mutant
disrupted for the sensor kinase displayed an altered
phenotype (Fig. 1). The 8013NMA0797 strain did not
display any adhesiveness defect (t50 h). However, at
t54 h, the number of mutant bacteria interacting with
the cells was drastically reduced (P,0.01, Fig. 1a). Mutant
8013NMA0797 also displayed a growth defect in broth
compared to that of the WT strain (doubling time of
60 min vs 40 min for the WT; Fig. 1b), when both strains
were cultured together. However, although a maximal 1 : 9
ratio was measured after 5 h of culture in broth, a 1 : 15
ratio was calculated after 4 h of adhesion to host cells.
Therefore, the defect of fitness displayed by strain
8013NMA0797 was significantly more pronounced on cells
than in broth (Fig. 1). These data demonstrated that an
efficient meningococcus–host cells interaction was dependent on the fully functional NMA0797/0798 TCS. Thus,
efficient colonization of N. meningitidis relies on the ability
of the sensor to perceive an environmental signal during
the early step of adhesion.
2290
0
_1
_2
*
_3
_4
IM
0h
1h
4h
109
No. of c.f.u.
The NMA0797 (PhoQ, MisS)/0798 (PhoP, MisR)
system is required to optimize the growth of N.
meningitidis onto host cells
1
1010
(b)
RESULTS
2
108
107
106
105
0
1
3
2
Time (h)
4
5
Fig. 1. Growth kinetics of N. meningitidis strains 8013 and
8013NMA0797 grown in co-culture. (a) Changes in the natural
logarithm of the ratio of N. meningitidis strain 8013NMA0797 c.f.u.
to strain 8013 c.f.u., as observed in a colonization competition
model. The experiment assessed the ability of strain
8013NMA0797 to compete against the wild-type ancestor 8013
strain. Adherent bacteria were harvested 30 min after infection
(t50 h) and after 1 h and 4 h of adhesion, and plated for
quantification. The graph represents differences in ratios at 0 h,
1 h and 4 h of adhesion to HUVECs after inoculation (IM). Solid
lines indicate group means; changes in the ratio of c.f.u. are marked
when statistically significant (*P,0.01). (b) Growth curves of wildtype (X) and mutant (&) populations grown in infection medium.
Each point represents the mean±SEM of two experiments.
The expression of the NMA0797/0798 TCS is cellcontact regulated
We investigated whether the expression of the TCS was
regulated upon contact with host cells. The level of
transcription of genes NMA0797 and NMA0798 was
measured by quantitative RT-PCR in WT strain 8013
grown in infection medium and from adherent bacteria
harvested after 1 h and 4 h of adhesion to HUVECs (Fig.
2). A modest but significant 1.5–1.8-fold increase (P,0.01)
of expression of the NMA0797 and NMA0798 genes was
measured after 1 h of adhesion to host cells, whereas after
4 h of adhesion the level of transcription of both genes
returned to the non-induced state (Fig. 2). These data
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 28 Apr 2017 17:54:00
Microbiology 155
Relative gene expression
Regulation of N. meningitidis–host cell interaction
4
3
2
1
IM 1 h 4 h
NMA0797
IM 1 h 4 h
NMA0798
Fig. 2. Cell-contact regulation of the transcription of the
NMA0797/0798 TCS in N. meningitidis. The transcriptional level
of each gene during early (1 h) and late (4 h) adhesion was
measured by real-time quantitative RT-PCR analysis from strain
8013. A chromosomal kanamycin resistance aphA3 cassette was
used as reference. For each gene, the induction ratio compares the
transcription of the gene in cell-associated bacteria with that of
bacteria grown in the absence of human cells (IM, infection
medium alone). Data represent means±SEM, resulting from at least
six independent measurements carried out on three different
batches of RNA.
indicate that the NMA0797/0798 system is transiently
expressed upon initial contact with host cells.
The NMA0797/798 TCS is involved in the
regulation of the expression of the host cellcontact regulated REP2 regulon
Since the expression of the TCS is slightly upregulated
upon initial contact with host cells, we investigated
whether this TCS could be involved in the regulation of
the REP2 regulon, whose expression is also induced upon
(a)
initial contact with host cells (Morelle et al., 2003, 2005).
The level of transcription of a subset of REP2 genes, i.e.
pilC1, xseB and parC, was measured (Fig. 3). In WT strain,
a 3.2-, 2.4- and 4.6-fold increased level of transcription was
respectively measured for the pilC1, xseB and parC genes
(P,0.01; Fig. 3a) after 1 h of adhesion to host cells,
whereas the expression of the three genes was non-induced
after 4 h of adhesion. This transient induction was
consistent with data from a previous report (Morelle et
al., 2003). In contrast, strain 8013NMA0797 did not show
any transient induction of the expression of the three genes
investigated (Fig. 3b). This suggests that the NMA0797/
0798 TCS may be involved in the control of the expression
of the cell-contact-regulated REP2 regulon upon early
contact with host cells.
The regulator of the NMA0797/0798 TCS interacts
with the REP2 sequence
The above data suggest that the expression of the genes of
the REP2 regulon is controlled directly or indirectly by the
NMA0797/0798 TCS. Considering that the REP2 repeats
have been shown to be the location of the promoter region
of the genes of this regulon (Morelle et al., 2003, 2005), we
investigated the putative interaction of the regulatory
NMA0798 protein with the REP2 sequence. The neisserial
NMA0798 protein was overexpressed in E. coli, purified
and used in EMSAs (Fig. 4).
The promoter of the NMA0797/0798 TCS has previously
been reported to bind the NMA0798 protein (Tzeng et al.,
2006). As expected, following incubation of the NMA0798
protein with the NMA0798 promoter probe, we detected a
shift in the DNA probe, in a dose-dependent manner
(Fig. 4a). We then tested whether NMA0798 protein bound
to the REP2 sequence. Since the REP2 sequence was
(b)
6
Relative gene expression
Relative gene expression
6
5
4
3
2
1
IM
1h 4h
pilC1
IM
1h 4h
xseB
IM
1h 4h
parC
5
4
3
2
1
IM
1h 4h
pilC1
IM
1h 4h
xseB
IM
1h 4h
parC
Fig. 3. Cell-contact regulation of the transcription of three REP2-associated genes in N. meningitidis. The transcriptional level
of each gene during early (1 h) and late (4 h) adhesion was measured by real-time quantitative RT-PCR analysis from strains
8013 (a) and 8013NMA0797 (b). A chromosomal kanamycin resistance aphA3 cassette was used as reference. For each
gene, the induction ratio compares the transcription of the gene in cell-associated bacteria with that of bacteria grown in the
absence of human cells (IM, infection medium alone). Data represent means±SEM, resulting from at least six independent
measurements carried out on three different batches of RNA.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 28 Apr 2017 17:54:00
2291
A. Jamet and others
(a) NMA0798 promoter
(b) REP2-pilC1
(c) REP2-xseB
(d) REP2-parC
NMA0798
100 200 400 800
0
parE ORF
(e)
0
100
200 400 800
0
100 200 400 800
0
100 200 400 800
REP2-xseB
NMA0798
0
800 1000
0
800
1000
previously shown to display sequence polymorphism
(Morelle et al., 2003), three REP2 sequences were included
in the assay. EMSAs showed that migration of the three
probes was retarded when incubated with the NMA0798
protein (Fig. 4b–d). No retardation was observed when the
NMA0798 protein was incubated with an internal fragment
of the coding region of the parE gene used as a negative
control (Fig. 4e). These findings provided evidence that the
NMA0798 regulatory protein binds to both its own
promoter, as usually described for classical TCSs, and the
REP2 sequences.
To identify the precise location of NMA0798 binding sites
in the REP2 sequence, DNase I protection assays were
performed (Fig. 5). Two areas of protection were observed
on addition of increasing concentrations of the NMA0798
protein (Fig. 5a, b), one region on the coding strand (Fig.
5a) and one region on the non-coding strand (Fig. 5b). In
conclusion, two distinct NMA0798 binding sites were
identified in the REP2 sequence, located on both sides of
the transcription start site of the xseB gene (Fig. 5c).
DISCUSSION
In this work we explored the molecular mechanism the
meningococcus has evolved to adapt to growth on host
cells, through the investigation of the only meningococcal
TCS previously described as a functional system. Adhesion
assays revealed that the sensor kinase of the NMA0797/
0798 TCS is involved in the adaptation to growth on host
cells. A mutation in the gene encoding the sensor results in
2292
Fig. 4. EMSA. DNA fragments containing the NMA0798 promoter
(a), the REP2 sequences (b–d) and an internal region of the parE
gene (e) were PCR amplified, 32P-labelled by T4 polynucleotide
kinase, mixed with the NMA0798 protein and subjected to gel
electrophoresis. The amount of added protein is indicated in ng
below the figures.
a defect in the perception of an external signal occurring
during the colonization process, and in the prevention of
the TCS activation. Thus, the sensor is involved in the
perception of environmental variations that take place
during host cell colonization.
The TCS participates in a regulation pathway resulting in
the transcriptional control of a group of genes that are coordinately and transiently upregulated upon contact with
host cells. Since the expression of these genes, i.e. the REP2
regulon, is induced when the bacteria interact with host
cells, the encoded functions are likely to be important for
the adaptation process. We hypothesize that during the
early adhesion step a signal is sensed by the NMA0797/
0798 TCS, which results in the activation of the TCS, in its
auto-induction, and in the induction of the NMA0797/
0798 regulon, which includes the REP2 genes.
The NMA0797/0798 TCS shares homology with several
TCSs present in E. coli and Salmonella enterica: OmpR/
EnvZ, PhoP/PhoQ and CpxR/CpxA. Newcombe et al.
(2005) renamed the NMA0797/0798 TCS PhoP/PhoQ
based on similar phenotypes of the two TCSs in response
to Mg2+. However, the transcriptomic analysis that the
authors performed did not identify any gene involved in
the transport of Mg2+ as being transcriptionally altered in
a NMA0798 background. In contrast, in the same study the
gene whose expression was the most strongly repressed was
homologous to cpxP (20 % identity at the amino acid
level), which is one of the most strongly induced members
of the CpxR/CpxA regulon (DiGiuseppe & Silhavy, 2003).
The cpxP gene was also reported to be regulated by
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 28 Apr 2017 17:54:00
Microbiology 155
Regulation of N. meningitidis–host cell interaction
Fig. 5. DNase I protection of the xseB-associated REP2 sequence by NMA0798. The coding (a) or non-coding (b) strand of
32
P-end-labelled REP2 sequence fragment between positions ”146 and +285 with respect to the xseB transcription start site
was incubated with increasing amounts of NMA0798 for 20 min at 30 6C and then subjected to DNase I digestion. The amount
of added protein was 0, 600 and 1200 ng. Dideoxy chain termination sequences are shown. Black bars indicate regions
protected. (c) Sequence of the xseB-associated REP2 sequence. The protected regions for NMA0798 are shaded. The
transcription start site is labelled +1. The translation start codon of the xseB gene is indicated in bold. The core consensus
sequence for the NMA0798 binding site previously reported (Tzeng et al., 2008) is underlined.
NMA0798 in the transcriptomic analysis carried out by
Tzeng et al. (2008). Together with the fact that the CpxR/
CpxA pathway plays a key role in the regulation of
adhesion-induced gene expression (Otto & Silhavy, 2002),
these data suggest that the NMA0797/0798 TCS could
combine the function of the different TCSs that it shares
homologies with.
(Shin et al., 2006). This highlights how crucial the
perception of the environmental signal is and hence the
key role of the sensors that allow the auto-induction of the
system. It must be underlined that although many bacteria
contain dozens of these signalling pathways, cross-talk
between different TCSs at the level of phosphorylation is
extremely rare (Laub & Goulian, 2007).
In this work we assume that the altered adhesion process
and transcriptional patterns of the REP2 genes observed in
mutant 8013NMA0797 resulted from the absence of
activation of the regulatory NMA0798 protein. In
Salmonella Typhimurium, deletion of the phoP gene or
constitutive expression of the PhoP regulatory protein both
lead to attenuated virulence in mice (Miller & Mekalanos,
1990; Shin et al., 2006). These findings demonstrate that
the surge conferred by PhoP’s positive feedback loop,
which is dependent on the activation of the sensor PhoQ, is
necessary to trigger salmonella’s virulence programme
Two independent transcriptomic analyses reported lists of
genes whose expression was altered in meningococcal
strains inactivated for the NMA0798 gene (Newcombe et
al., 2005; Tzeng et al., 2008). Only 29 genes were identified
in both studies and among them none of the REP2 genes.
The RNAs used in these two studies were isolated from
bacteria grown on agar plates and in broth, respectively.
We hypothesize that in the absence of host cells, i.e. in the
absence of stimulating signal, the expression of the
NMA0798 subregulon that comprises genes specifically
induced upon contact with host cells remains unchanged.
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 28 Apr 2017 17:54:00
2293
A. Jamet and others
We showed that the NMA0798 regulatory protein directly
interacts with the REP2 sequence and that the NMA0798
protein exhibits a higher affinity for the NMA0798
promoter region compared to the REP2 sequences. The
very high concentration of protein used for EMSA studies
could be suggestive of concern about the physiological
relevance of the binding. Alternatively, differential binding
affinity for different operators that correlate with differential gene regulation is a well-known feature of global
regulators (Sebastian et al., 2002; Wosten et al., 2006).
Besides, a discrepancy was previously reported between the
binding affinities of PhoP determined in vivo and in vitro
(Miyashiro & Goulian, 2007). The order of promoter
activation in vivo was indeed qualitatively different from
the order expected from in vitro measurements. This
suggests that the observed differences between the in vitro
and in vivo data are due to additional factors that affect
PhoP binding affinity and are only present in vivo
(Miyashiro & Goulian, 2007).
A previous study demonstrated that PhoP overexpression
can substitute for PhoQ- and phosphorylation-dependent
activation. Either a high concentration of PhoP or
activation via phosphorylation stimulates PhoP selfassociation (Lejona et al., 2004). In addition, high-level
expression of PhoP in vivo in the absence of phosphorylation shows the same ordering of promoter activation
(Miyashiro & Goulian, 2007). Besides, the auto-phosphorylation of the NMA0797 protein and the subsequent
transfer of the phosphoryl group to the NMA0798
regulatory protein has been previously demonstrated
(Tzeng et al., 2006). This led us not to investigate the role
of phosphorylation in the binding affinity of the regulatory
protein NMA0798 for its binding sites.
Tzeng et al. (2008) proposed a consensus sequence for the
NMA0798 DNA binding site, i.e. (A/T)(A/T)TGTAA(A/G/
C)G. In our study, DNase I footprinting mapping of the
NMA0798 binding sites in the REP2 sequence identified
sequences similar to the core consensus sequence for the
NMA0798 binding site previously reported (Tzeng et al.,
2008). The differences in affinity between the NMA0798
promoter and the REP2 sequences for the NMA0798
protein evidenced in EMSAs could be related to differences
in sequence from the consensus proposed by Tzeng et al.
(2008). Moreover, the two binding sites are located
upstream and downstream of the transcription start site
in the REP2 sequence. A binding site located downstream
of the transcription start site for a transcriptional activator
has previously been reported for the regulatory proteins
Rns from E. coli (Munson & Scott, 2000), and SlyA from S.
enterica (Shi et al., 2004).
The contribution of TCSs to bacterial virulence is poorly
known for many pathogens. This is particularly true
regarding the nature of the environmental signals sensed
by the TCSs, which have been verified experimentally in
very few cases (Beier & Gross, 2006). A few studies have
involved contact with host cells as a stimulus sensed by
2294
TCSs., i.e. in biofilm formation by Pseudomonas aeruginosa
(Goodman et al., 2004; Kulasekara et al., 2005) or in
staphylococcal adhesion (Liang et al., 2006). Although the
stimulus sensed by the NMA0797/0798 TCS still needs to
be identified to explain the human host specificity that is a
feature of N. meningitidis, this study represents a significant
advance in our understanding of how the ability of the
meningococcus to colonize human cells is regulated.
ACKNOWLEDGEMENTS
The authors would like to thank Dr G. Duménil and Dr J. C. Hoe for
reviewing the manuscript. This work was supported by grants from
Université Paris 5 – René Descartes, INSERM, Région Ile De France
and Fondation pour la Recherche Médicale.
REFERENCES
Beier, D. & Gross, R. (2006). Regulation of bacterial virulence by two-
component systems. Curr Opin Microbiol 9, 143–152.
Blattner, F. R., Plunkett, G., III, Bloch, C. A., Perna, N. T., Burland, V.,
Riley, M., Collado-Vides, J., Glasner, J. D., Rode, C. K. & other
authors (1997). The complete genome sequence of Escherichia coli K-
12. Science 277, 1453–1474.
DiGiuseppe, P. A. & Silhavy, T. J. (2003). Signal detection and target
gene induction by the CpxRA two-component system. J Bacteriol 185,
2432–2440.
Garcı́a Véscovi, E., Soncini, F. C. & Groisman, E. A. (1996). Mg2+ as
an extracellular signal: environmental regulation of Salmonella
virulence. Cell 84, 165–174.
Geoffroy, M. C., Floquet, S., Metais, A., Nassif, X. & Pelicic, V. (2003).
Large-scale analysis of the meningococcus genome by gene disruption: resistance to complement-mediated lysis. Genome Res 13, 391–
398.
Goodman, A. L., Kulasekara, B., Rietsch, A., Boyd, D., Smith, R. S. &
Lory, S. (2004). A signaling network reciprocally regulates genes
associated with acute infection and chronic persistence in
Pseudomonas aeruginosa. Dev Cell 7, 745–754.
Johnson, C. R., Newcombe, J., Thorne, S., Borde, H. A., EalesReynolds, L. J., Gorringe, A. R., Funnell, S. G. & McFadden,
J. J. (2001). Generation and characterization of a PhoP
homologue mutant of Neisseria meningitidis. Mol Microbiol 39,
1345–1355.
Kellogg, D. S., Peacock, W. L., Deacon, W. E., Brown, L. & Pirkle, C. I.
(1963). Neisseria gonorrhoeae. I. Virulence genetically linked to clonal
variation. J Bacteriol 85, 1274–1279.
Kulasekara, H. D., Ventre, I., Kulasekara, B. R., Lazdunski, A.,
Filloux, A. & Lory, S. (2005). A novel two-component system controls
the expression of Pseudomonas aeruginosa fimbrial cup genes. Mol
Microbiol 55, 368–380.
Laub, M. T. & Goulian, M. (2007). Specificity in two-component signal
transduction pathways. Annu Rev Genet 41, 121–145.
Lejona, S., Castelli, M. E., Cabeza, M. L., Kenney, L. J., Garcı́a
Véscovi, E. & Soncini, F. C. (2004). PhoP can activate its target genes
in a PhoQ-independent manner. J Bacteriol 186, 2476–2480.
Liang, X., Yu, C., Sun, J., Liu, H., Landwehr, C., Holmes, D. & Ji, Y.
(2006). Inactivation of a two-component signal transduction system,
SaeRS, eliminates adherence and attenuates virulence of Staphylococcus aureus. Infect Immun 74, 4655–4665.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 28 Apr 2017 17:54:00
Microbiology 155
Regulation of N. meningitidis–host cell interaction
Miller, S. I. & Mekalanos, J. J. (1990). Constitutive expression of the
Sebastian, S., Agarwal, S., Murphy, J. R. & Genco, C. A. (2002). The
phoP regulon attenuates Salmonella virulence and survival within
macrophages. J Bacteriol 172, 2485–2490.
gonococcal fur regulon: identification of additional genes involved in
major catabolic, recombination, and secretory pathways. J Bacteriol
184, 3965–3974.
Miyashiro, T. & Goulian, M. (2007). Stimulus-dependent differential
regulation in the Escherichia coli PhoQ PhoP system. Proc Natl Acad
Sci U S A 104, 16305–16310.
Morelle, S., Carbonnelle, E. & Nassif, X. (2003). The REP2 repeats of
the genome of Neisseria meningitidis are associated with genes
coordinately regulated during bacterial cell interaction. J Bacteriol
185, 2618–2627.
Morelle, S., Carbonnelle, E., Matic, I. & Nassif, X. (2005). Contact
with host cells induces a DNA repair system in pathogenic neisseriae.
Mol Microbiol 55, 853–861.
Munson, G. P. & Scott, J. R. (2000). Rns, a virulence regulator within
the AraC family, requires binding sites upstream and downstream of
its own promoter to function as an activator. Mol Microbiol 36, 1391–
1402.
Nassif, X., Lowy, J., Stenberg, P., O’Gaora, P., Ganji, A. & So, M.
(1993). Antigenic variation of pilin regulates adhesion of Neisseria
meningitidis to human epithelial cells. Mol Microbiol 8, 719–725.
Newcombe, J., Eales-Reynolds, L., Wootton, L., Gorringe, A. R.,
Funnell, S. G., Taylor, S. C. & McFadden, J. J. (2004). Infection with
an avirulent phoP mutant of Neisseria meningitidis confers broad
cross-reactive immunity. Infect Immun 72, 338–344.
Newcombe, J., Jeynes, J. C., Mendoza, E., Hinds, J., Marsden, G. L.,
Stabler, R. A., Marti, M. & McFadden, J. J. (2005). Phenotypic and
Shi, Y., Latifi, T., Cromie, M. J. & Groisman, E. A. (2004).
Transcriptional control of the antimicrobial peptide resistance ugtL
gene by the Salmonella PhoP and SlyA regulatory proteins. J Biol
Chem 279, 38618–38625.
Shin, D., Lee, E. J., Huang, H. & Groisman, E. A. (2006). A positive
feedback loop promotes transcription surge that jump-starts
Salmonella virulence circuit. Science 314, 1607–1609.
Stephens, D. S., Greenwood, B. & Brandtzaeg, P. (2007). Epidemic
meningitis, meningococcaemia, and Neisseria meningitidis. Lancet
369, 2196–2210.
Taha, M. K., Morand, P., Pereira, Y., Eugene, E., Giorgini, D.,
Larribe, M. & Nassif, X. (1998). Pilus-mediated adhesion of Neisseria
meningitidis: the essential role of cell contact-dependent transcriptional upregulation of the PilC1 protein. Mol Microbiol 28, 1153–
1163.
Tettelin, H., Saunders, N. J., Heidelberg, J., Jeffries, A. C., Nelson,
K. E., Eisen, J. A., Ketchum, K. A., Hood, D. W., Peden, J. F. & other
authors (2000). Complete genome sequence of Neisseria meningitidis
serogroup B strain MC58. Science 287, 1809–1815.
Tzeng, Y. L., Datta, A., Ambrose, K., Lo, M., Davies, J. K., Carlson,
R. W., Stephens, D. S. & Kahler, C. M. (2004). The MisR/MisS two-
component regulatory system influences inner core structure and
immunotype of lipooligosaccharide in Neisseria meningitidis. J Biol
Chem 279, 35053–35062.
transcriptional characterization of the meningococcal PhoPQ system,
a magnesium-sensing two-component regulatory system that controls
genes involved in remodeling the meningococcal cell surface.
J Bacteriol 187, 4967–4975.
Tzeng, Y. L., Zhou, X., Bao, S., Zhao, S., Noble, C. & Stephens, D. S.
(2006). Autoregulation of the MisR/MisS two-component signal
Oshima, T., Aiba, H., Masuda, Y., Kanaya, S., Sugiura, M., Wanner,
B. L., Mori, H. & Mizuno, T. (2002). Transcriptome analysis of all two-
transduction system in Neisseria meningitidis. J Bacteriol 188, 5055–
5065.
component regulatory system mutants of Escherichia coli K-12. Mol
Microbiol 46, 281–291.
Tzeng, Y. L., Khaler, C., Zhang, X. & Stephens, D. S. (2008). The
Otto, K. & Silhavy, T. J. (2002). Surface sensing and adhesion of
MisR/MisS two-component regulon in Neisseria meningitidis. Infect
Immun 76, 704–716.
Escherichia coli controlled by the Cpx-signaling pathway. Proc Natl
Acad Sci U S A 99, 2287–2292.
Wosten, M. M., Parker, C. T., van Mourik, A., Guilhabert, M. R., van
Dijk, L. & van Putten, J. P. (2006). The Campylobacter jejuni PhosS/
Parkhill, J., Achtman, M., James, K. D., Bentley, S. D., Churcher, C.,
Klee, S. R., Morelli, G., Basham, D., Brown, D. & other authors
(2000). Complete DNA sequence of a serogroup A strain of Neisseria
PhosR operon represents a non-classical phosphate-sensitive twocomponent system. Mol Microbiol 62, 278–291.
meningitidis Z2491. Nature 404, 502–506.
Yasukawa, K., Martin, P., Tinsley, C. R. & Nassif, X. (2006). Pilus-
Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989). Molecular Cloning:
mediated adhesion of Neisseria meningitidis is negatively controlled by
the pilus-retraction machinery. Mol Microbiol 59, 579–589.
a Laboratory Manual, 2nd edn. Cold Spring Harbor, NY: Cold Spring
Harbor Laboratory.
Edited by: P. van der Ley
http://mic.sgmjournals.org
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Fri, 28 Apr 2017 17:54:00
2295