Download Cloning and characterization of the

4604–4610 Nucleic Acids Research, 2000, Vol. 28, No. 23
© 2000 Oxford University Press
Cloning and characterization of the Schizosaccharomyces
pombe tRNA:pseudouridine synthase Pus1p
Klaus Hellmuth, Henri Grosjean1, Yuri Motorin1, Karina Deinert, Ed Hurt and George Simos*
BZH, Biochemie-Zentrum Heidelberg, Im Neuenheimer Feld 328, D-69120 Heidelberg, Germany and 1CNRS,
Laboratoire d’Enzymologie et de Biochimie Structurales, 1 Avenue de la Terrasse, F-91198 Gif-sur-Yvette, France
Received September 8, 2000; Revised and Accepted October 4, 2000
ABSTRACT
Saccharomyces cerevisiae cells that carry deletions
in both the LOS1 (a tRNA export receptor) and the
PUS1 (a tRNA:pseudouridine synthase) genes
exhibit a thermosensitive growth defect. A
Schizosaccharomyces pombe gene, named spPUS1,
was cloned from a cDNA library by complementation of
this conditional lethal phenotype. The corresponding
protein, spPus1p, shows sequence similarity to
S.cerevisiae and murine Pus1p as well as other
known members of the pseudouridine synthase family.
Accordingly, recombinant spPus1p can catalyze in vitro
the formation of pseudouridines at positions 27, 28, 34,
35 and 36 of yeast tRNA transcripts. The sequence and
functional conservation of the Pus1p proteins in fungi
and mammalian species and their notable absence from
prokaryotes suggest that this family of pseudouridine
synthases is required for a eukaryote-specific step of
tRNA biogenesis, such as nuclear export.
INTRODUCTION
The modified nucleoside pseudouridine (Ψ) is present in
rRNAs and tRNAs in both prokaryotes and eukaryotes. In the
yeast Saccharomyces cerevisiae it is found in at least 15
different locations of tRNA. Uridines at positions 13, 27, 28,
31, 32, 38, 39 and 55 are almost always or frequently modified
to pseudouridines, while other positions, including 1, 26, 34,
35, 36, 65 and 67, are rarely modified (1). A family of
enzymes, the tRNA:pseudouridine synthases, catalyzes the
conversion of uridine into pseudouridine residues in tRNA
molecules. In S.cerevisiae Ψ13, Ψ32 and Ψ55 are formed by
three distinct activities (2), whereas a single enzyme (Pus1p) is
responsible for Ψ formation at positions 27, 28, 34 and 36,
both in vitro and in vivo (3,4). In addition, Pus1p is implicated
in the formation of Ψ at positions 26, 65 and 67 in vivo and at
position 35 in vitro (3,4). Saccharomyces cerevisiae (sc)
Pus1p, together with scPus2p and mouse (m)Pus1p (5), form a
subfamily of pseudouridine synthases that is related in
sequence to scPus3p/Deg1p, the enzyme responsible for the
DDBJ/EMBL/GenBank accession no. AJ251329
formation of Ψ38 and Ψ39 and the true homolog of Escherichia
coli synthase TruA (6). scPus1p and mPus1p have similar
substrate specificities while the target RNAs of scPus2p have
not yet been determined. Surprisingly, scPus1p also converts
uridines at position 44 in U2 small nuclear (sn)RNA and is therefore the first yeast pseudouridine synthase characterized so far
which exhibits a dual substrate specificity, acting both on
tRNA and snRNA (7). Furthermore, it has been shown that
scPus1p contains a zinc atom that is essential for tRNA
binding, the structural requirements of which have also been
investigated (8,9). The other Ψ synthases that have been
characterized so far in S.cerevisiae include Pus4p, a member of
the TruB family that catalyzes the formation of Ψ55 in both
cytoplasmic and mitochondrial tRNAs (10), Pus5p, a member
of the RluA family that modifies yeast mitochondrial 21S
rRNA (11), and Cbf5p, a component of snoRNPs involved in
the formation of the Ψ residues in 18S and 25S rRNAs (12–14).
Despite the abundance of Ψ residues in yeast tRNAs, the
function of these modifications remains unclear and none of
the four known yeast tRNA Ψ synthases (Pus1p–Pus4p) is
essential for viability, at least under normal growth conditions.
However, genetic experiments have implicated scPus1p in the
nuclear export of tRNA. PUS1 was originally identified by its
ability to complement a mutation that was synthetically lethal
to a thermosensitive allele of the essential nucleoporin Nsp1p
(4). The synthetic lethality of the mutant strain had actually
been due to a combination of mutations in three genes: NSP1,
LOS1 und PUS1. Los1p, as well as its human homolog Xpo-t,
associates with the nuclear pores and acts as an exportin for
tRNA, i.e. it can mediate the nuclear export of tRNA (4,15–21). A
deletion of either LOS1 or PUS1 does not result in a growth
defect for yeast cells, whereas combined disruption of both
genes causes slow cell growth at 30°C as well as a thermosensitive phenotype, i.e. lack of viability at 37°C (4). This
genetic interaction suggests that pseudouridinylation of tRNA
residues by Pus1p could be a prerequisite for efficient nuclear
export of tRNA molecules.
Pus1p has so far been characterized in only two species,
S.cerevisiae and mouse, and this makes sequence as well as
phylogenetic analysis of this enzyme difficult. In order to
identify a functional homolog in an additional organism we
took advantage of the thermosensitive phenotype of the los1∆
*To whom correspondence should be addressed. Tel: +49 6221 546757; Fax: +49 6221 544369; Email: [email protected]
Present addresses:
Klaus Hellmuth, Arimedes Biotechnology GmbH, Robert-Rössle-Straße 10, D-13125 Berlin, Germany
Yuri Motorin, Maturation des ARN et Enzymologie Moléculaire, UMR 7567 CNRS-UHP, Faculté des Sciences, BP 239, 54506 Vandoeuvre-les-Nancy Cédex, France
Nucleic Acids Research, 2000, Vol. 28, No. 23 4605
pus1∆ double mutant and searched for Schizosaccharomyces
pombe genes that could act as high copy suppressors of this
phenotype. With this approach we expected to identify S.pombe
orthologs of either scPus1p or scLos1p. Indeed, we were able to
clone the cDNA of a protein that represents, as shown by sequence
homology and functional analysis, the S.pombe (sp)Pus1p.
MATERIALS AND METHODS
Yeast strains, media and plasmids
The following yeast strains were used in this work: Y572
(MATa ade2 his3 leu2 trp1 ura3 pus1::HIS3); Y680 (MATa
ade2 his3 leu2 trp1 ura3 los1::HIS3 pus1::HIS3) (4). Cells
were grown in YPD rich medium or synthetic SDC medium
containing the necessary amino acids and nutrients. For counter
selection of cells containing URA3 plasmids 5-fluoroorotic acid
(FOA) (Toronto Research Chemicals) was used at 1 µg/ml.
The following plasmids were used: pFL61 (2µ, URA3) contains a
cDNA insert of S.pombe under control of the S.cerevisiae PGK1
promoter and terminator (22); pRS315 (CEN/ARS, LEU2);
pRS426 (2µ, URA3) (23). Vectors containing the precursor of
yeast tRNAIle (anticodon UAU), yeast tRNATrp (anticodon
CCA) and yeast tRNATyr (anticodon GUA), as used in the
present work, were described previously (3,24).
Cloning of the S.pombe cDNA encoding spPus1p
An aliquot of 100 OD600 units of an overnight culture of the
thermosensitive yeast strain Y680 (los1∆ pus1∆) in YPD
liquid medium was transformed with 10 µg S.pombe cDNA
library inserted into pFL61, according to the lithium acetate
method (25). Transformed cells were streaked on 20 SDC-ura
plates and incubated for 5 h at room temperature and for 6 days
at 37°C. Growing colonies were re-streaked on SDC-ura plates
and incubated for 3 days at 37°C. After two rounds of selection,
the remaining clones were made ura– by growth on 5-FOAcontaining plates and tested for reappearance of the thermosensitive phenotype. The plasmid DNA of all the positive
clones was isolated and the cDNA insert size was determined
by restriction analysis with NotI. The screening strain was
transformed with the recovered plasmids in order to confirm
complementation of the thermosensitive phenotype. Three
complementing plasmids (SP79, SP88 and SP130) with NotI
cDNA inserts of identical length (1.9 kb) and identical restriction
patterns were further analyzed. The cDNA insert was
subcloned into vector pRS315 and sequenced by the dideoxy
method. The obtained sequence was compared to the S.pombe
nucleotide sequence available from the Sanger Centre (http://
www.sanger.ac.uk/Projects/S_pombe/) and found to be part of
cosmid c126 on chromosome III (accession no. AL034490).
Introns in the genomic sequence were reported by Genefinder
(http://sciclio.cshl.org/genefinder/Pombe/pombe.htm). Proteins
with sequence similarities were identified by FASTA and
aligned using the ClustalW and Boxshade programs.
Preparation of recombinant His-tagged S.pombe and
S.cerevisiae Pus1p
The spPUS1 open reading frame (ORF) was amplified by PCR
from vector pRS315-spPUS1 using two primers that created a
XhoI restriction site at the ATG start codon and a MluI restriction
site in the 3′-untranslated region of the gene (sense, TTTT-
TCTCGAGCGGACGTGGTGGTAAACGC; antisense, TTTrestriction
TTACGCGTGTATATTGCACCATACGGTC;
sites underlined). This manipulation allowed cloning of the
ORF into a modified pET (pET-HIS6/pET8c) (26) vector cut
with XhoI–MluI and created an in-frame fusion protein of six
histidine residues joined by a Ser-Ser spacer dipeptide to the
amino acid immediately after the start methionine. The vector
containing the fusion gene was transformed into E.coli BL21
cells. A 1 l culture was grown in minimal medium at 37°C to
OD 0.7 and induced by addition of 1 mM IPTG. The bacterial
cell pellet was lysed by sonication in 10 ml of lysis buffer (LB)
[50 mM Tris–HCl pH 8.0, 150 mM NaCl, 0.1% Triton X-100,
1 mM DTT, containing a cocktail of protease inhibitors (Complete, EDTA-free; Boehringer Mannheim)]. The lysate was
cleared by centrifugation and applied to a Ni–NTA resin column
(Qiagen, Hilden, Germany) which was then washed with lysis
buffer lacking Triton X-100 but containing 20 mM imidazole.
spPus1p was purified to near homogeneity by elution with 250
mM imidazole in lysis buffer lacking Triton X-100. To ensure further removal of contaminants the Ni–NTA eluate was dialysed
against Mono Q buffer (20 mM Tris–HCl, 1 mM MgCl2, 1 mM
DTT, 10% glycerol, pH 8.0) and applied to a Mono Q HR 5/5 column (Pharmacia) equilibrated in the same buffer. spPus1p was
eluted with ∼250 mM NaCl, peak fractions were concentrated
to 1 mg/ml, glycerol was added to 50% and aliquots were
frozen and kept at –80°C. In all purification steps the identity
of the purified protein band was verified by western blotting
using monoclonal antibodies (BAbCO, CA) against the His6
tag. The enzyme was used for 3 months without apparent loss
of activity. Recombinant His-tagged scPus1p was prepared as
described earlier (3,8).
Pseudouridine formation assay in vitro
Pseudouridine synthase activity of purified recombinant
spPus1p was tested at 30°C and compared under identical
experimental conditions to that of recombinant scPus1p. The
incubation mixture (50 µl) contained 100 mM Tris–HCl,
pH 8.0, 100 mM ammonium acetate, 5 mM MgCl2, 2 mM
DTT, 0.1 mM EDTA, 2–5 fmol appropriate 32P-radiolabeled
T7 run-off transcripts as substrate and purified enzyme as
indicated in the legends to the figures. Prior to the enzymatic
assay the purified enzymes were diluted at appropriate concentrations in 50 mM Tris–HCl buffer, pH 7.5, containing 1 mM
MgCl2, 2 mM DTT, 1 mg/ml bovine serum albumin and 10%
glycerol. After incubation the pseudouridine content in the
radiolabeled transcripts was analyzed as described previously
(3). In brief, the RNA was extracted with phenol/chloroform,
precipitated with ethanol and then completely hydrolyzed to
3′-nucleotide monophosphates by RNase T2 (‘nearest
neighbor’ analysis). Each hydrolyzate was chromatographed
on 2-dimensional thin layer chromatography (TLC) plates and
radioactivity in the spots was evaluated after exposure to a
PhosphorImager screen.
Tagging of spPus1p with green fluorescent protein (GFP)
and localization in yeast cells
To tag spPus1p with GFP at the N-terminus, the spPUS1 ORF
was amplified by PCR from vector pRS315-spPUS1 using two
primers that created an in-frame PstI restriction site after the
ATG start codon and a HindIII restriction site in the 3′-untranslated
region of the gene (sense, TTTTTCTGCAGGGACGTGGT-
4606 Nucleic Acids Research, 2000, Vol. 28, No. 23
GGTAAACGC; antisense, TTTTTAAGCTTGTATATTGCACCATACGGTC; restriction sites underlined). The PCR
product, after digestion with PstI–HindIII, was ligated to the
vector pRS315-PNOP1-GFP-scPUS1 (15) previously cut with
the same enzymes to remove the scPUS1 ORF. This resulted in
the plasmid pRS315-PNOP1-GFP-spPUS1, which expressed
GFP-tagged spPus1p under control of the constitutive NOP1
promoter. This plasmid was then transformed in yeast cells and
expression of the full-length GFP–spPus1p fusion protein was
confirmed by western blotting of whole cell extracts using
polyclonal antibodies (Clontech) against the GFP moiety. The
localization of the GFP-tagged protein in living yeast cells was
examined in the fluorescein channel of a Zeiss Axioskop
fluorescence microscope. Pictures were obtained with a Xillix
Microimager CCD camera and processed with Improvison
Openlab 1.7 software
RESULTS
Cloning of S.pombe PUS1 by complementation of the
S.cerevisiae los1∆ pus1∆ double disrupted strain
The fact that disruption of both LOS1 and PUS1 in the yeast
S.cerevisiae causes a synergistic growth arrest at 37°C (4)
makes possible the cloning of putative homologs of Los1p or
Pus1p from other organisms by functional complementation.
Therefore, the thermosensitive los1∆ pus1∆ strain was
transformed with a S.pombe-derived cDNA library and
thermoresistant clones were isolated and analyzed by plasmid
recovery. After passing all false positive tests (see Materials
and Methods), three complementing plasmids with S.pombe
cDNA inserts were obtained that were capable of restoring the
viability of the los1∆ pus1∆ strain at 37°C (Fig. 1A). Restriction analysis of these three clones (SP79, SP88 and SP130)
showed that they contained identical cDNA inserts of ∼1.9 kb.
The nucleotide sequence of the SP79 insert was determined by
dideoxy sequencing and primer walking. The 1902 bp long
cDNA insert could be completely aligned with a part of cosmid
c126 derived from chromosome III of S.pombe. Two predicted
introns for the uncharacterized genomic sequence could be
confirmed, the first 65 bp and the second 39 bp long, at
positions 1116 and 1472 of the cDNA, respectively. Both introns
have the typical 5′- and 3′-splice consensus elements
(GTAAGTA and TAG) and are absent in the cDNA fragment
we cloned. Starting at position 40, the cDNA contains a complete
1605 bp long ORF that codes for a 534 amino acid long polypeptide (EMBL ID/accession no. SPO251329/AJ251329). This
protein was named spPus1p (for S.pombe pseudouridine
synthase 1), because of its sequence homology to two previously characterized eukaryotic tRNA modification enzymes,
S.cerevisiae pseudouridine synthase 1 (scPus1p) (4) and mouse
pseudouridine synthase 1 (mPus1p) (5). An alignment of these
three proteins is shown in Figure 1B. This sequence comparison
shows that there are two blocks of high sequence identity. The
first one, containing 124 amino acids (42–165 in spPus1), defines
an N-terminal domain which is positively charged in all three
proteins, with a pI between 9.2 and 10. The second one,
containing 160 amino acids (314–473 in spPus1), comprises a Cterminal domain and is also very basic, at least in the case of the
two yeast proteins (pI 10.1–10.3). The two highly conserved Nand C-termimal domains are separated by a non-conserved linker
sequence of variable length which is short in the mammalian
protein (11 amino acids) but long and acidic (pI 4.6) in the cases
of scPus1p and spPus1p (90 and 148 amino acids, respectively). SpPus1 also shares significant homology with other
uncharacterized ORFs in S.pombe and other species (see
below).
Recombinant spPus1p exhibits tRNA:pseudouridine
synthase activity
The fact that spPus1p can complement the thermosensitive
phenotype of the S.cerevisiae los1∆ pus1∆ strain as well its
sequence homology to scPus1p indicate that spPus1p may have
pseudouridine synthase activity. To show this experimentally, we
tested whether recombinant spPus1p exhibits a similar enzymatic
activity to recombinant scPus1p. The spPUS1 ORF was tagged
at its N-terminal end with six histidines and expressed in
E.coli. A single protein with the expected molecular weight of
His6–spPusp1 could be purified from E.coli whole cell lysates
by two chromatographic steps (Fig. 2A). The activity of this
recombinant spPus1p, as well as recombinant scPus1p, was
tested in parallel using various transcripts of S.cerevisiae
tRNA as substrates. From earlier experiments with recombinant scPus1p we knew that the precursor of yeast tRNAIle
(which contains a 60 nt long intron) allowed intron-dependent
formation of Ψ34 and Ψ36 as well as intron-independent formation
of Ψ27 (3,4). Taking advantage of the fact that both uridines U34
and U36 are followed by A, while Ψ at position 27 is followed
by C in the sequence of pre-tRNAIle, the formation of pseudouridines at position 27 and positions 34 and 36 can be monitored independently by using appropriate [32P]AMP- or
[32P]CMP-radiolabeled transcripts and T2 digestion prior to TLC
(see Material and Methods). To monitor the formation of Ψ28 we
used [32P]CMP-radiolabeled yeast tRNATrp and to monitor the
formation of intron-dependent Ψ35 we used [32P]AMP-radiolabeled yeast tRNATyr bearing a 14 nt long intron (for the structures of the tRNA substrates see 3).
The formation of Ψ28, Ψ34 and Ψ36 by recombinant spPus1p
is shown in Figure 2B, while Figure 2C shows the quantitation
of all the results as the molar amount of pseudouridine formed
per mole of tRNA, in the presence of increasing amounts of
recombinant scPus1p or spPus1p and using as substrates the
tRNAs mentioned above. Control experiments with yeast
tRNAAsp or yeast tRNAPhe, which normally contain Ψ residues
at positions 13, 32 and 55 or 39 and 55, respectively, but are
not modified by recombinant scPus1 (3), gave no trace of
pseudouridine formation even at the highest concentration of
recombinant spPus1p tested (data not shown). These results
demonstrate that spPus1p is capable of forming Ψ at positions
27, 28, 34, 35 and 36, the efficiency of the modification being
dependent on the position of the uridine in the tRNA molecules.
While formation of Ψ27 in yeast tRNAIle is catalyzed very
efficiently by both spPus1p and scPus1p even at low enzyme
concentrations (Fig. 2C, panel a), the formation of Ψ28, Ψ34+36
and Ψ35 in yeast tRNATrp, yeast tRNAIle and yeast tRNATyr,
respectively, is catalyzed less efficiently by spPus1p than by
scPus1p (Fig. 2C, panels b–d, respectively). This difference in
efficiency most likely reflects the fact that the S.pombe enzyme
is acting on S.cerevisiae tRNAs, which may therefore be
recognized and bound less strongly. The ability of spPus1p to
form Ψ at position 27 was also confirmed by testing cell
extracts of the S.cerevisiae pus1∆ strain transformed with a
Nucleic Acids Research, 2000, Vol. 28, No. 23 4607
Figure 1. (A) The S.pombe cDNA that encodes spPus1p can complement the thermosensitive los1∆ pus1∆ double disrupted S.cerevisiae strain. This strain was
transformed with the indicated plasmids (pFL61-spPUS1, clones SP79, SP88 and SP130) and incubated on YPD plates at the indicated temperatures. Untransformed cells
and cells transformed with an empty plasmid served as negative controls. (B) Sequence alignment between S.cerevisiae (sc), S.pombe (sp) and mouse (m) homologs
of Pus1p. Invariant amino acids are indicated as white letters in dark gray boxes, partially conserved amino acids are in light gray boxes.
plasmid expressing spPus1p (data not shown). In summary,
our results demonstrate that spPus1p, as predicted from its
sequence, has tRNA:pseudouridine synthase activity and
exhibits a substrate specificity which is identical in vitro to the
substrate specificity of scPus1p. Therefore, spPus1p can be
considered as the true ortholog of scPus1p.
4608 Nucleic Acids Research, 2000, Vol. 28, No. 23
Figure 3. Subcellular localization of GFP-tagged spPus1p expressed in
S.cerevisiae cells lacking endogenous Pus1p. (Left) Fluorescence image of
living cells; (middle) corresponding phase contrast image; (right) a merge of the
fluorescence and phase contrast images.
when expressed in S.cerevisiae cells. In order to show that, we
localized spPus1p in budding yeast cells that lacked endogenous scPus1p. To facilitate the localization, spPus1p was
tagged at the N-terminus with GFP. This fusion protein could
be expressed stably in S.cerevisiae, as shown by western blot
analysis of total cell extracts using antibodies against the GFP
moiety, and was functional because it could complement
thermosensitive growth of the los1∆ pus1∆ budding yeast
strain (data not shown). As shown in Figure 3, when GFP–spPus1p
was expressed in pus1∆ budding yeast cells the fluorescence signal
was restricted to an area that corresponded to the nucleus, while the
cytoplasm and the vacuole, which were clearly discernable by phase
contrast, were devoid of signal. Similar nuclear localization
was also observed when GFP–spPus1p was expressed in wildtype S.cerevisiae cells (data not shown). Therefore, it can be
concluded that the Pus1p nuclear localization signal and
import pathway are conserved between budding and fission
yeast cells and that nuclear residence is an integral property of
a functional Pus1p enzyme.
Figure 2. Recombinant His6–spPus1p has tRNA:pseudouridine synthase
activity. (A) Purification of His6–spPus1p from E.coli. Aliquots of soluble cell
extract (lane 2), Ni–NTA column flow-through (lane 3), Ni–NTA column
eluate with 250 mM imidazole (lane 4) and eluate of the Mono Q column (lane 5)
were analyzed by SDS–PAGE followed by Coomassie Blue staining. Lane 1,
10 kDa ladder molecular weight markers, the arrowhead indicates the position
of the 50 kDa band. The position of the His6–spPus1p band is indicated by an
arrow. (B) Autoradiograms of cellulose TLC plates obtained after chromatography of RNase T2 hydrolyzates of in vitro radiolabeled [32P]CMP-labeled
tRNATrp and [32P]AMP-labeled tRNAIle transcripts incubated for 1 h at 30°C
with 100 ng recombinant His6–spPus1p, demonstrating the formation of Ψ27
and Ψ34/Ψ36, respectively. (C) Enzymatic formation of pseudouridine in different
yeast tRNA transcripts incubated for 1 h at 30°C in the presence of increasing
amounts of recombinant S.pombe Pus1p (open squares) or recombinant
S.cerevisiae Pus1p (filled circles). (a) [32P]CMP-labeled tRNAIle lacking the
60 nt intron was used as substrate, allowing monitoring of the selective formation
of Ψ27. (b) [32P]CMP-labeled tRNATrp (lacking its natural intron) was used to
monitor the formation of Ψ28. (c) Formation of Ψ34 and Ψ36 was monitored
using intron-containing tRNAIle labeled with [32P]AMP. (d) Formation of Ψ35
was monitored using intron-containing tRNATyr labeled with [32P]AMP. After
incubation, 32P-radiolabeled tRNA was extracted with phenol/chloroform,
ethanol precipitated and subjected to complete digestion with RNase T2. Each
hydrolyzate was subjected to 2-dimensional TLC and the amount of
[32P]ΨMP relative to radiolabeled AMP, CMP, GMP and UMP was evaluated
as indicated in Materials and Methods.
spPus1p is imported efficiently into the nucleus of S.cerevisiae
The finding that scPus1p, which is an exclusively intranuclear
protein (4,15), could be functionally replaced by the S.pombe
enzyme indicated that spPus1p could also enter the nucleus
DISCUSSION
In this report we have identified the S.pombe Pus1p, which is
now the third tRNA:pseudouridine synthase 1 to be characterized
experimentally after the S.cerevisiae (3,4) and mouse (5)
enzymes. The cDNA coding for spPus1p was found in a screen
for fission yeast proteins that can rescue the thermosensitive
los1∆ pus1∆ budding yeast strain. Enzymatic assays in vitro
confirmed the ability of spPus1p to function as a
tRNA:pseudouridine synthase and demonstrated that its
substrate specificity for S.cerevisiae tRNAs matches those of
the other two previously identified homologs from S.cerevisiae
and mouse. All enzymes display multisite specificity and are
capable of modifying residues in at least two different regions
of the tRNA molecule and in an intron-dependent (positions 34
and 36) or intron-independent (positions 27 and/or 28) mode.
Finally, the two yeast homologs localize exclusively inside the
nucleus.
Comparison of the sequences of the three Pus1p orthologs
allows certain conclusions to be drawn concerning their
structural organization and their relationship to the other
pseudouridine synthases. Pus1p was originally grouped in the
TruA family because of its sequence similarity to the founding
member of this family, E.coli pseudouridine synthase I or
TruA (4). However, TruA modifies positions 38, 39 and/or 40
in tRNA and its true eukaryotic ortholog is apparently yeast
Pus3/Deg1p, which has a similar substrate specificity (6). It
Nucleic Acids Research, 2000, Vol. 28, No. 23 4609
Figure 4. Sequence alignment of the conserved blocks (A) and bootstrapped phylogenetic tree (B) of eukaryotic proteins related to spPus1p. The following
abbreviations of organism names are used: sc, S.cerevisiae; sp, S.pombe; ce, C.elegans; at, A.thaliana; dm, D.melanogaster; m, mouse; h, human. In the case of
uncharacterized ORFs, the organism name is followed by the accession number in the GenBank or SwissProt database. (A) The horizontal line separates potential
members of the Pus1 family (top) from potential members of the Pus3/TruA family (bottom). The conserved sequence RTDKGV, which is found in both families
and contains the aspartate residue essential for catalysis (28), as well as the sequence HNFHNFT, which is characteristic for the members of the Pus1 family, are
indicated by brackets. The alanine residue conserved in all Pus1-like proteins is also indicated by an asterisk. The numbers at the top correspond to the amino acid
positions in scPus1 (first line). Identical or conserved residues are shaded by dark or light gray, respectively. (B) The bootstrapped phylogenetic tree was constructed
using ClustalW software and the alignment of the proteins excludes positions with gaps. Numbers show the percent occurrence of nodes in 1000 bootstrap replications.
can therefore be suggested that spPus1p, scPus1p and mPus1p
constitute what can be now called the Pus1 family, which is
related to but distinct from TruA. The members of the Pus1
family differ from the TruA-like proteins not only in their
substrate specificity but also in the fact that they are only
encountered in one kingdom, i.e. eukaryotes. Indeed, databank
sequence searches and comparisons revealed a number of other
eukaryotic Pus1p-like proteins that can be distinguished from
the TruA-like enzymes on the basis of sequence similarity. An
alignment of the most conserved areas as well as a phylogenetic tree of eukaryotic Pus1-like and TruA (Pus3)-like
proteins is shown in Figure 4. In addition to spPus1p (this
work), scPus1p (3,4) and mPus1p (5), potential members of the
Pus1 family include human Pus1p (5), S.cerevisiae Pus2p (4),
4610 Nucleic Acids Research, 2000, Vol. 28, No. 23
two additional S.pombe ORFs (T40736 and CAA20745) and
one ORF each in Arabidopsis thaliana (AAF17648),
Caenorhabditis elegans (T26253) and Drosophila melanogaster (AAF55785). Unique sequence elements of the Pus1-like
family that can be easily identified include the invariable
alanine residue before the conserved RTD motif and the
characteristic sequence HNFHNFT that is found with small
variations in all Pus1 sequences, as well as Pus2, which can
therefore be considered a member of this family (Fig. 4A).
Other, more distantly related polypeptides appear to be eukaryotic
members of the TruA (Pus3) family, such as scPus3p itself (6)
and ORFs in S.pombe (CAB61771), A.thaliana (AAF26999
and possibly O22928) and C.elegans (Q09524). Of course, the
sequence analysis shown in Figure 4 has only predictive value but,
nevertheless, it may act as a guide for the experimentation required
for the definite classification of a protein in one or the other family,
according to catalytic activity and substrate specificity.
As shown in Figures 1B and 4, Pus1-like enzymes contain
two highly conserved, positively charged domains which may
represent the catalytic core and the basic recognition
machinery for the common structure of the tRNA substrates.
This two-domain organization is reminiscent of the E.coli
enzyme TruA, which is the only pseudouridine synthase with a
known 3-dimensional structure (27). The TruA monomer
consists of two distinct domains with similar folding topology,
the union of which generates a RNA-binding cleft. Therefore,
Pus1-like proteins may be structured in an analogous way to
TruA. However, in the Pus1-like proteins the two conserved
domains are connected via a species-specific linker sequence
of variable length. A possible function of this idiosyncratic
sequence may be involvement in recognition of the tRNA
intron, which, although required for modification at positions
34 and 36 in the anticodon of tRNAIle(UAU), varies in length
between different species. For example, while the intron of
S.cerevisiae pre-tRNAIle(UAU) is 60 nt long, analysis of the
S.pombe and human genomic sequences indicates the presence
of tRNAIle(UAU) genes containing a shorter intron, of 25 and
20 nt, respectively. The differences in the substrate pre-tRNA
structure may also explain the fact that spPus1p modifies positions 34 and 36 in budding yeast tRNAIle(UAU) less efficiently
than the homologous scPus1p. In addition to its capability of
modifying tRNAs, S.cerevisiae Pus1p was shown previously
to catalyze U→Ψ conversion at position 44 in U2 snRNA (7).
However, the analysis of RNA extracted from a S.cerevisiae
pus1∆ strain complemented by spPus1p showed that U2
snRNA does not contain Ψ at position 44 (I.Ansmant and
Y.Motorin, unpublished observations). These results suggest
an additional difference in RNA recognition between S.cerevisiae
and S.pombe Pus1p.
The modifications catalyzed by the Pus1 enzymes are a
unique feature of eukaryotic tRNAs and they may therefore be
required for a process that occurs only in eukaryotes, such as
nuclear export of tRNA. Indeed, scPus1p becomes essential for
optimal cell growth in the absence of the tRNA nuclear export
factor Los1p (4). The fact that spPus1p can replace scPus1p
effectively suggests that this genetic interaction may be
conserved between species. We have recently reported that two
distinct but redundant nuclear export pathways for tRNA exist
in budding yeast: one depends on Los1p while the second one
is Los1p-independent but requires tRNA aminoacylation and
function of the essential translation elongation factor eEF-1A
(21). Therefore, it is likely that Pus1p-mediated modifications can
facilitate interaction of the tRNAs with the aminoacyl-tRNA
synthetases, EF-1A or other factors of the same pathway. In the
absence of Pus1p this interaction may be weakened, causing a
reduction in the rate of nuclear tRNA export, which, however,
can be compensated for by the Los1p-dependent export
mechanism. However, when both Pus1p and Los1p are
missing the rate of nuclear tRNA export may become limiting
for cell growth. We hope that the identification of Pus1p in
fission yeast will help to address these issues further.
ACKNOWLEDGEMENTS
We would like to thank M. Wigler (Cold Spring Harbor
Laboratory) for providing the S.pombe cDNA library,
C. Simon for technical assistance and H. Grosshans for useful
comments on the manuscript. This work was supported by a
grant from the DFG to G.S. and E.H. (SFB352-B11).
REFERENCES
1. Sprinzl,M., Horn,C., Brown,M., Ioudovitch,A. and Steinberg,S. (1998)
Nucleic Acids Res., 26, 148–153.
2. Samuelsson,T. and Olsson,M. (1990) J. Biol. Chem., 265, 8782–8787.
3. Motorin,Y., Keith,G., Simon,C., Foiret,D., Simos,G., Hurt,E. and
Grosjean,H. (1998) RNA, 4, 856–869.
4. Simos,G., Tekotte,H., Grosjean,H., Segref,A., Sharma,K., Tollervey,D.
and Hurt,E.C. (1996) EMBO J., 15, 2270–2284.
5. Chen,J. and Patton,J.R. (1999) RNA, 5, 409–419.
6. Lecointe,F., Simos,G., Sauer,A., Hurt,E.C., Motorin,Y. and Grosjean,H.
(1998) J. Biol. Chem., 273, 1316–1323.
7. Massenet,S., Motorin,Y., Lafontaine,D.L., Hurt,E.C., Grosjean,H. and
Branlant,C. (1999) Mol. Cell. Biol., 19, 2142–2154.
8. Arluison,V., Hountondji,C., Robert,B. and Grosjean,H. (1998)
Biochemistry, 37, 7268–7276.
9. Arluison,V., Buckle,M. and Grosjean,H. (1999) J. Mol. Biol., 289, 491–502.
10. Becker,H.F., Motorin,Y., Planta,R.J. and Grosjean,H. (1997)
Nucleic Acids Res., 25, 4493–4499.
11. Ansmant,I., Massenet,S., Grosjean,H., Motorin,Y. and Branlant,C. (2000)
Nucleic Acids Res., 28, 1941–1946.
12. Watkins,N.J., Gottschalk,A., Neubauer,G., Kastner,B., Fabrizio,P.,
Mann,M. and Luhrmann,R. (1998) RNA, 4, 1549–1568.
13. Lafontaine,D.L.J., Bousquet-Antonelli,C., Henry,Y., Caizergues-Ferrer,M.
and Tollervey,D. (1998) Genes Dev., 12, 527–537.
14. Zebarjadian,Y., King,T., Fournier,M.J., Clarke,L. and Carbon,J. (1999)
Mol. Cell. Biol., 19, 7461–7472.
15. Hellmuth,K., Lau,D.M., Bischoff,F.R., Künzler,M., Hurt,E.C. and
Simos,G. (1998) Mol. Cell. Biol., 18, 6374–6386.
16. Arts,G.J., Fornerod,M. and Mattaj,I.W. (1998) Curr. Biol., 8, 305–314.
17. Arts,G.J., Kuersten,S., Romby,P., Ehresmann,B. and Mattaj,I.W. (1998)
EMBO J., 17, 7430–7441.
18. Kutay,U., Lipowsky,G., Izaurralde,E., Bischoff,F.R., Schwarzmaier,P.,
Hartmann,E. and Görlich,D. (1998) Mol. Cell, 1, 359–369.
19. Lipowsky,G., Bischoff,F.R., Izaurralde,E., Kutay,U., Schäfer,S.,
Gross,H.J., Beier,H. and Görlich,D. (1999) RNA, 5, 539–549.
20. Sarkar,S. and Hopper,A.K. (1998) Mol. Biol. Cell, 9, 3041–3055.
21. Grosshans,H., Hurt,E. and Simos,G. (2000) Genes Dev., 14, 830–840.
22. Minet,M., Dufour,M.E. and Lacroute,F. (1992) Plant J., 2, 417–422.
23. Sikorski,R.S. and Hieter,R. (1989) Genetics, 122, 19–27.
24. Szweykowska-Kulinska,Z., Senger,B., Keith,G., Fasiolo,F. and
Grosjean,H. (1994) EMBO J., 13, 4636–4644.
25. Schiestl,R.H. and Gietz,R.D. (1989) Curr. Genet., 16, 339–346.
26. Schlaich,N.L. and Hurt,E.C. (1995) Eur. J. Cell Biol., 67, 8–14.
27. Foster,P.G., Huang,L., Santi,D.V. and Stroud,R.M. (2000) Nature Struct.
Biol., 7, 23–27.
28. Gu,X., Liu,Y. and Santi,D.V. (1999) Proc. Natl Acad. Sci. USA, 96,
14270–14275.