Download DNA replication

Genetic Information
Week 13: 7-8/12/2011
Sem 1, 2011/2012
Introduction

-
-
-
General outline of biological inheritence and information
transfer.
Info encoded within DNA, directs the functioning of living
cells and is transmitted to offspring, consists of specific
sequence of nitrogenous bases. DNA synthesis involves the
complementary pairing of nucleotide bases on 2 strands of
DNA.
Mechanism by which genetic info is decoded and used to
direct cellular processes begins with the synthesis of RNA.
RNA synthesis- complimentary pairing of ribonucleotide bases
with bases in DNA molecule.
Several types of RNA involved in the synthesis of enzymes,
structural proteins and other types of polypeptides required for
the synthesis of biomolecules.
Central dogma of molecular biology
Describe the flow of genetic information from DNA through RNA
and eventually to protein
replication
DNA
transcription
<------------------
RNA
translation
PROTEIN
Solid arrow indicate types of information transfers that occur in cells. DNA
directs its own replication to produce new DNA molecule; DNA is transcribes
into RNA; RNA is translated into protein. The dashed lines represent
information transfers that occur in certain organisms.
Information Flow
DNA
RNA
Protein
Replication: DNA duplicates itself
Transcription: RNA is made on a DNA
template
Translation: Protein is synthesized
from AAs and the three RNAs.
Reverse Transcription: RNA directs
synthesis of DNA
RNA replication: RNA replicates itself



Because of the importance of DNA, living organisms must
possess:
Rapid and accurate DNA synthesis
Genetic stability- effective DNA repair mechanisms.
Prokaryotic genetic information processes are more
understood than those eukaryotes- minimal growth
requirements, short generation times, simple genetic
composition.
Common method in genetic research- induce mutationobserve changes.
DNA replication




DNA replication is an anabolic polymerization
process, that allows a cell to pass copies of its
genome to its descendants.
Must occur before every cell division
After two strands of DNA separate, each serves as
template for the synthesis of a complementary strand.
Biologists say that DNA replication is
semiconservative replication because each daughter
DNA molecule is composed of one original strand
and one new strand.
PRINCIPAL OF DNA REPLICATION
Discovered by Matthew Meselson and Franklin Stahl, 1958.
DNA REPLICATION PROCESS
c) Synthesis of lagging strand
Initial Processes in DNA Replication




DNA replication begins at a specific sequence of
nucleotides called an origin.
First, a cell removes chromosomal proteins, exposing
the DNA helix.
DNA unwinding
An enzyme called DNA helicase locally
"unzips/unwind" the DNA molecule by breaking the
hydrogen bonds between complementary nucleotide
bases, which exposes the bases in a replication fork.
Other protein molecules stabilize the single strands so
that they do not rejoin while replication proceeds
Primer synthesis
- Formation of short RNA segments called
primers- required for the initiation of DNA
replication (catalyzed by primase, RNA
polymerase).
 DNA synthesis
- The synthesis of a complementary DNA strand
by forming phosphodiester linkages between
nucleotides base-paired to a template strand is
catalyzed by an enzyme DNA polymerase.





DNA polymerases III replicate DNA in only one
direction - 5' to 3' - like a jeweler stringing
pearls to make a necklace, adding them one at a
time, always moving from one end of the string
to the other.
Besides DNA polymerase III, DNA polymerase I
and DNA polymerase II.
DNA polymerase I- DNA repair enzyme and
removing RNA primer during replication.
DNA polymerase II- similar to DNA pol II.

Because the two original (template) strands are
antiparallel cells synthesize new strands in two
different ways:
1) One new strand, called the leading strand, is
synthesized continuously as a single long
chain of nucleotides.
2)The other new strand, called the lagging
strand, is synthesized in short segments that
are later joined by DNA ligase (Okazaki
fragments).
Synthesis of the Leading Strand
A cell synthesizes a leading strand toward the replication fork
in the following series of five steps
1) An enzyme called primase synthesizes a short RNA molecule
that is complementary to the template DNA strand. This RNA
primer provides the 3' hydroxyl group required by DNA
polymerase.
2) Triphosphate deoxyribonucleotides form hydrogen bonds with
their complements in the parental strand. Adenine nucleotides
bind to thymine nucleotides, and guanine nucleotides bind to
cytosine nucleotides.
3) Using the energy in the high-energy bonds of the triphosphate
deoxyribonucleotides, DNA polymerase III covalently joins
them one at a time by dehydration synthesis to the leading
strand.
4) DNA polymerase III also performs a proofreading function. About
1 out of every 100,000 nucleotides is mismatched with its
template; for instance, a guanine might become incorrectly paired
with a thymine.
DNA polymerase III recognizes most such errors and removes the
incorrect nucleotides before proceeding with synthesis. This role,
known as the proofreading exonuclease function, acts like the
delete key on a keyboard, removing the most recent error.
Because of this proofreading exonuclease function, only about
one error remains for every ten billion (1010) base pairs replicated.
5) Another DNA polymerase - DNA polymerase I - replaces the
RNA primer with DNA. Note that researchers named DNA
polymerase enzymes in the order of their discovery, not the order
of their actions.
Synthesis of the Lagging Strand




The steps in the synthesis of a lagging strand are as
follows :
The discontinuous synthesis on the lagging strand
requires primer synthesis for each of the Okazaki
fragments.
The primosome travels along the lagging strand and stops
and reverses direction at intervals to synthesize a short
RNA primer.
Nucleotides pair up with their complements in the
template-adenine with thyamine, and cytosine with
guanine.

DNA polymerase III joins neighboring nucleotides and
proofreads. Each Okazaki fragment requires a new RNA
primer and consists of 1000 to 2000 nucleotides.

DNA polymerase I replaces the RNA primers of Okazaki
fragments with DNA and further proofreads the daughter
strand.

DNA ligase seals the gaps between adjacent Okazaki
fragments to form a continuous DNA strand.
Transcription




TRANSCRIPTION is the synthesis of RNA
under the direction of DNA
DNA strand provide a template for assembling
a sequence of RNA nucleotides
The resulting RNA molecule is the transcript
of the gene’s protein-building instruction
Called mRNA (messenger RNA) – carry
genetic message from DNA
TRANSCRIPTION

Cells transcribe four main types of RNA from DNA :

RNA primer molecules for DNA polymerase to use during
DNA replication

messenger RNA (mRNA) molecules, which carry genetic
information from chromosomes to ribosomes

ribosomal RNA (rRNA) molecules, which combine with
ribosomal polypeptides to form ribosomes-the organelles that
synthesize polypeptides

transfer RNA (tRNA) molecules, which deliver amino acids to
the ribosomes
Initiation of Transcription


RNA polymerases - the enzymes that synthesize RNA
RNA polymerase bind to specific nucleotide sequences
called promoter - include the transcription startpoint (the
nucleotides where RNA synthesis begin)
Initiation of Transcription





Prokaryotic promoters- variable in size (from 20bp –
200 bp), 2 short sequences at positions about 10 and
35 bp upstream of the transcription initiation site are
remarkably similar among bacterial species
(consensus sequences).
-10 region- Pribnow box.
RNA polymerase slides along the DNA until it
reaches a promoter sequence.
Once it bind to the promoter sequence, RNA
polymerase unwinds and unzips the DNA molecule in
the promoter region
After unzip, RNA polymerase initiate RNA synthesis
at the promoter on the template strand

When the transcribed sequence reaches a
length of about 10 nucleotides, the
conformation of the RNA complex changes:
for e.g the σ factor is released- initiation phase
ends.
Elongation of the RNA Transcript



Once the factor detaches, the affinity of the RNA polymerase
complex for the promoter site decreases- the elongation phase
begins.
As RNA polymerase moves along the DNA, it continues to
untwist the double helix for pairing with RNA nucleotides
The enzyme add nucleotides to the 3’ end of the growing RNA
molecule as it continues along the double helix
Elongation of the RNA Transcript


In the wake of transcription, the DNA strands
re-form the double helix and the new RNA
molecule peels away from its DNA.
The incorporation of the ribonucleotides
continues until a termination signal is reached.
Termination of Transcription




Transcription proceeds until shortly after the RNA
polymerase transcribes a DNA sequence called a
terminator
Termination sequences contain palindromes.
The RNA transcript of the DNA palindrome forms a
stable hairpin turn- this structure disrupts the RNADNA hybrid structure.
After the RNA is released, the polymerase
dissociate from the DNA
TRANSLATION

Translation is the process whereby ribosomes
use the genetic information of nucleotide
sequences to synthesize polypeptides
composed of specific amino acid sequences.





In translation process, cell interprets a genetic
message and builds a protein
Message = is a series of codons along an
mRNA molecule
Interpreter = transfer RNA (tRNA)
tRNA = transfer amino acids from cytoplasm’s
amino acid pool to ribosome
The ribosome adds each amino acid brought to
it by tRNA to the growing end of a
polypeptide chain


As a tRNA molecule arrives at a ribosome, it
bears a specific amino acid at one end.
At the other end is a nucleotide triplet called
an anticodon, which binds according to basepairing rules to a complementary codon on
mRNA.

How do ribosomes interpret the nucleotide
sequence of mRNA to determine the correct
order in which to assemble amino acids?
The genetic code




During protein synthesis, nucleic acid base
sequence is converted to amino acid sequencetranslation
Is a coding dictionary that specifies a meaning
for a base sequence
the genetic code define as triplets of mRNA
nucleotides called codons that code for
specific amino acids.
64 possible arrangements - more than enough
to specify 21 amino acids.



61 codons specify amino acids and 3 codons
-UAA, UAG, and UGA-to stop translating
UGA codes for the 21st amino acid, selenocysteine.
Codon AUG also has a dual function, acting as both a
start signal and coding for an amino acid –
methionine.
Genetic code possess the
following properties:

-
-
Degenerate
Several signals have the same meaning.
The genetic code is partially degenerate
because most amino acids are coded for by
several codons.
For eg: Leu is coded by 6 different codons.

-
-
-
-
Specific
Each codon is a signal for a specific amino
acid.
Majority of codons that code for the same
amino acid possess similar sequences.
For eg: serine (UCU, UCC, UCA and UCG)the first and second bases are identical.
Consequently, a point mutation in the third
base of a serine codon would not be
deleterious.

-
-
-
Nonoverlapping and without punctuation
mRNA coding sequence is read by a ribosome
starting from the initiating codon (AUG) as a
continuous sequence taken 3 bases at a time
until a stop codon is reached.
A set of contiguous triplet codons in an mRNA
is called a reading frame.
Open reading frame (orf)- series of triplet base
sequuences in mRNA that do not contain a
stop codon.
Universal
- Coding signals for amino acids are always the
same.

AUG = start codon
Protein Synthesis

-
The translation of a genetic message into the
primary sequence of a polypeptide can be
divided into 3 phases.
Initiation
Elongation
Termination
INITIATION




Initiation- Small ribosomal
subunit binds an mRNA
The anticodon of a specific
tRNA (initiator tRNA) base
pairs with the initiation codon
AUG.
Iniation ends as the large
ribosomal subunit combines
with small subunit.
There are 2 sites on the
complete ribosome for codonanticodon interactions

-
-
There are 2 sites on the complete ribosome for
codon-anticodon interactions:
The P (peptidyl) site- now occupied with
initiator
The A (aminoacyl) site
ELONGATION



During elongation- polypeptide is synthesized
according to the genetic message.
The message is read from 5’-3’ directionpolypeptide synthesis proceeds from the Nterminal to C-terminal.
Elongation begins- as a second aminoacyltRNA becomes bound to the ribosome in A
site becoz of codon-aticodon base pairing.




Peptide bond formation is
catalyzed by peptidyl
transferase- the amino group
of A site amino acid attacks
the carbonyl group of P site
a.a. both a.a are attached to
the A site tRNA.
The uncharged tRNA at P site
moves to E site.
Next step- translocation- the
ribosome moved along
mRNA.
As the mRNA moves, the
next codon enters A site, and
the tRNA bearing the
growing polypeptide chain
moves to P site.


The ribosome releases the
“empty" tRNA from the E
site. In the cytosol, the
appropriate enzyme
recharges it with another
molecule of its specific
amino acid.
The cycle repeats, each time
adding another amino acid
(in this case, threonine, then
alanine, and then glutamine)
until a stop codon enters the
A site.
TERMINATION





During termination the polypeptide chain is released from the
ribosome.
Translation terminates because a stop codon cannot bind an
aminoacyl-tRNA.
Instead, a protein releasing factor binds to the A site.
Subsequently, a peptidyl transferase hydrolyses the bond connecting
the now-completed polypeptide and the tRNA in the P site.
translation ends as the ribosome releases mRNA and dissociates into
small and large subunits.
Mutations of Genes:
Types of mutation

Mutations range from large changes in an
organism's genome, such as the loss or gain of an
entire chromosome, to the most common type of
mutation - point mutations - in which just one
nucleotide base pair is affected.

Mutations include base pair insertions,
deletions, and substitutions.
Effects of Mutations

Some base-pair substitutions
produce silent mutations
because the substitution does
not change the amino acid
sequence because of the
redundancy of the genetic
code.

For example, when the DNA
triplet AAA " is changed to
AAG, the mRNA codon will
be changed from UUU to
UUC; however, because both
codons specify the amino acid
phenylalanine, there is no
change in the phenotype - the
mutation is silent because it
affects the genotype only.

Of greater concern are substitutions that
change a codon for one amino acid into a
codon for a different amino acid.

A change in a nucleotide sequence
resulting in a codon that specifies a
different amino acid is called a missense
mutation; what gets transcribed and
translated makes sense, but not the right
sense.

The effect of missense mutations depends
on where in the protein the different
amino acid occurs.

When the different amino is in a critical
region of a protein, the protein becomes
nonfunctional; however, when the
different amino acid is in a less important
region, the mutation has no adverse effect.

A third type of mutation
occurs when a base-pair
substitution changes an
amino acid codon into a
stop codon.

This is called a nonsense
mutation. Nearly all
nonsense mutations result
in nonfunctional proteins.

Frameshift mutations
(that is, insertions or
deletions) typically
result in drastic
missense and nonsense
mutations, except when
the insertion or deletion
is very close to the end
of a gene
Exercise
The following synthetic mRNA sequence
codes for the beginning of a polypeptide:
5’AUGUCUCCUACUGCUGACGAGGGAAG
GAGGUGGCUUAUCAUGUUU- 3’
 Determine the amino acid sequence of the
polypeptide.
