* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Practice Questions
Real-time polymerase chain reaction wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Metalloprotein wikipedia , lookup
Molecular cloning wikipedia , lookup
Community fingerprinting wikipedia , lookup
DNA supercoil wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Non-coding DNA wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Protein structure prediction wikipedia , lookup
Biochemistry wikipedia , lookup
Proteolysis wikipedia , lookup
Gene expression wikipedia , lookup
Messenger RNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Transfer RNA wikipedia , lookup
Epitranscriptome wikipedia , lookup
Point mutation wikipedia , lookup
More Translation Standard Practice Questions 1. Which mutations do you think would get passed from parent to offspring? Somatic (body) mutations, or germ cell (sex cell or gametes) mutations? a. b. 2. What is the correct order of translation from beginning to end? Write the number next to the letter from 1-7 a. b. c. d. e. f. g. 3. If you were in the sun and obtained skin cancer, can it be passed down to your children? A really bad doctor took X-Rays of a patient’s leg. The doctor didn’t give the patient a protective lead apron to wear over the genital region and the patient’s gametes (sperm or egg cells) were severely mutated as a result of the high powered rays. Will this mutation be passed down the offspring? The Ribosome shifts along the mRNA over to the next codon __ The polypeptide chain becomes the actual protein by folding into the correct shape that will help it perform its function. __ tRNA carrying methionine attaches to mRNA with help of the anticodon __ The stop codon is reached and the polypeptide chain is released __ A new tRNA lands next to the first tRNA and the amino acids form a peptide bond __ The empty tRNA leaves the ribosome and the growing polypeptide chain remains on the second tRNA __ A ribosome attaches to the start codon (AUG) on mRNA __ What is the amino acid sequence from this mRNA? UUCAUGCCAGAUGGGUAUACUAAAUAGAAC 4. What is the central dogma and finish the order by placing the following words in correct order below (RNA, protein, trait, DNA) _______ _______ ______________ DNA to DNA is called ____________________ RNA to Protein is called ___________________ DNA to RNA is called ____________________ Protein to Trait is called ___________________ 5. Suppose that you are given a polypeptide sequence containing the following sequence of amino acids: Amino acid sequence tyrosine, proline, aspartic acid, isoleucine, and cysteine. Use the genetic code info given in the table below to determine the DNA sequence that codes for this polypeptide sequence. Circle the correct DNA sequence below: a. AUGGGUCUAUAUACG c. b. ATGGGTCTATATACG d. GCAAACTCGCGCGTA ATAGGGCTTTAAACA More Translation Standard Practice Questions 1. Which mutations do you think would get passed from parent to offspring? Somatic (body) mutations, or germ cell (sex cell or gametes) mutations? a. b. 2. What is the correct order of translation from beginning to end? Write the number next to the letter from 1-7 c. d. e. f. g. h. i. 3. If you were in the sun and obtained skin cancer, can it be passed down to your children? A really bad doctor took X-Rays of a patient’s leg. The doctor didn’t give the patient a protective lead apron to wear over the genital region and the patient’s gametes (sperm or egg cells) were severely mutated as a result of the high powered rays. Will this mutation be passed down the offspring? The Ribosome shifts along the mRNA over to the next codon __ The polypeptide chain becomes the actual protein by folding into the correct shape that will help it perform its function. __ tRNA carrying methionine attaches to mRNA with help of the anticodon __ The stop codon is reached and the polypeptide chain is released __ A new tRNA lands next to the first tRNA and the amino acids form a peptide bond __ The empty tRNA leaves the ribosome and the growing polypeptide chain remains on the second tRNA __ A ribosome attaches to the start codon (AUG) on mRNA __ What is the amino acid sequence from this mRNA? UUCAUGCCAGAUGGGUAUACUAAAUAGAAC 4. What is the central dogma and finish the order by placing the following words in correct order below (RNA, protein, trait, DNA) _______ _______ ______________ DNA to DNA is called ____________________ RNA to Protein is called ___________________ DNA to RNA is called ____________________ Protein to Trait is called ___________________ 5. Suppose that you are given a polypeptide sequence containing the following sequence of amino acids: Amino acid sequence tyrosine, proline, aspartic acid, isoleucine, and cysteine. Use the genetic code info given in the table below to determine the DNA sequence that codes for this polypeptide sequence. Circle the correct DNA sequence below: a. AUGGGUCUAUAUACG c. b. ATGGGTCTATATACG d. GCAAACTCGCGCGTA ATAGGGCTTTAAACA