* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Homework #2
Human genome wikipedia , lookup
Mitochondrial DNA wikipedia , lookup
Non-coding RNA wikipedia , lookup
Nucleic acid tertiary structure wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Epigenomics wikipedia , lookup
Molecular cloning wikipedia , lookup
No-SCAR (Scarless Cas9 Assisted Recombineering) Genome Editing wikipedia , lookup
DNA vaccination wikipedia , lookup
DNA damage theory of aging wikipedia , lookup
Genealogical DNA test wikipedia , lookup
Therapeutic gene modulation wikipedia , lookup
Designer baby wikipedia , lookup
Non-coding DNA wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Epigenetics of human development wikipedia , lookup
Polycomb Group Proteins and Cancer wikipedia , lookup
Genomic library wikipedia , lookup
Primary transcript wikipedia , lookup
Nucleic acid double helix wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
History of genetic engineering wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Genome (book) wikipedia , lookup
Microevolution wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Point mutation wikipedia , lookup
Extrachromosomal DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Skewed X-inactivation wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Y chromosome wikipedia , lookup
X-inactivation wikipedia , lookup
BIO 184 Laboratory CSU, Sacramento Spring 2005 Homework Assignment #2 Due Friday April 8th 1. A chromosome has the following segments, where represents the centromere: A B C D E F G What type of chromosome mutations are required to change this chromosome into each of the following chromosomes? (In some cases, more than one chromosome mutation may be required). Be specific with regards to the movement of segments (meaning use the letters for reference). a. A B A B C D E b. A B C F E D G c. A B C D E d. A B C F E D e. A B C D E F 2. The following diagram represents two nonhomologous chromosomes: F G F E D G C D F E A B C D E F G R S T U V W X G What type of chromosome mutation would produce the following chromosomes? Be specific with regards to the movement of segments (meaning use the letters for reference). a. b. A B C D R S T U V W X E F A U V B C D E F G R S T W X G BIO 184 Laboratory CSU, Sacramento c. d. Spring 2005 A B T U V F G R S C D E W X A B C W G R S T U V D E F X 3. A species has 2n = 20 chromosomes. How many chromosomes will be found per cell in each of the following mutants? a. b. c. d. e. monoploid triploid trisomic for chromosome 16 (aneuploid cell type) monosomic for chromosome 3 (aneuploid cell type) autotriploid 4. How many Barr bodies are present in humans with the following karyotype? a) an XY male b) c) d) e) an XX female an XO female an XXY male an XXXX female 5. A young couple is planning to have children. Knowing that there have been a substantial number of stillbirths, miscarriages, and fertility problems on the husband’s side of the family, they see a genetic counselor. A chromosome analysis reveals that, whereas the woman has a normal karyotype, the man possesses only 45 chromosomes and is a carrier of a Robertsonian translocation between chromosomes 22 and 13. a) List all the different types of gametes that might be produced by the man. b) What types of zygotes will develop when each of the gametes produced by the man fuses with a normal gamete produced by the woman? c) If trisomies and monsomies entailing chromosome 13 and 22 are letha, what proportion of the surviving offspring will be carriers of the translocation? BIO 184 Laboratory CSU, Sacramento Spring 2005 6. A female with Turner’s syndrome (XO) is found to be colorblind (X-linked recessive trait). Both his mother and father have normal vision. a) Explain how this could have occurred by a nondisjunction event and whether the nondisjunction occurred in the father or in the mother. b) Did the nondisjunction event occur in the first or at the second meiotic division (or is impossible to distinguish given the information)? c) Repeat the question (both A &B) except substitute Klinefelter’s syndrome (XXY) for Turner’s syndrome. 7. Part A. Which of the following relations will be found in the percentages of bases of a double stranded DNA molecule? a. A + T = G + C b. A + G = T+ C c. A + C = G + T d. A + T = 1.0 C +G e. A + G = 1.0 C +T f. A = G C T g. A = T G C h. A = G T C Part B. If 20% of the bases in human are C a) what percentage are A? b) what percentage are G? c) what percentage are T? BIO 184 Laboratory CSU, Sacramento Spring 2005 8. Part A. An RNA virus that infects plant cells is copied into a DNA molecule once it enters the plant cell. What would be the sequence of bases in the first strand of DNA made complementary to the section of viral RNA shown here? 5’ CCCCCAUAAUUCAGCCAGGGGGACUA 3’ Part B. Will the above RNA be able to form a hairpin structure and why? 9. A student mixes some heat-killed type IIIS (smooth) Steptocooccus pneumonia with live type IIR (rough) and injects the mixture into a mouse. The mouse develops pneumonia and dies. The student recovers some type IIIS bacteria from the dead mouse. a. Is this enough evidence that DNA is the transforming principle? Why? b. How would the student refine the experiment to determine whether DNA is the transforming agent? 10. Describe how the naked DNA double-stranded helix becomes packaged into the metaphase chromosome.