Download FEMS Microbiology Letters

Identi¢cation, cloning and characterization of cysK , the gene
encoding O -acetylserine (thiol)-lyase from Azospirillum brasilense ,
which is involved in tellurite resistance
Alberto Ramı́rez1, Miguel Castañeda1, Marı́a L. Xiqui1,2, Araceli Sosa1 & Beatriz E. Baca1
1
Centro de Investigaciones Microbiológicas, Instituto de Ciencias, Benemérita Universidad Autónoma de Puebla, Mexico; and 2Facultad de Medicina,
Benemérita Universidad Autónoma de Puebla, Puebla Pue, México
Correspondence: Beatriz E. Baca, Centro de
Investigaciones Microbiológicas, Instituto de
Ciencias, Benemérita Universidad Autónoma
de Puebla, Apdo. Postal 1622, C. P. 72000,
Mexico. Tel.: 15 222 244 4518; fax: 15 222
244 4518; e-mail: [email protected]
Received 29 May 2006; revised 16 June 2006;
accepted 18 June 2006.
First published online 11 July 2006.
DOI:10.1111/j.1574-6968.2006.00369.x
Editor: Yaacov Okon
Keywords
O -acetylserine (thiol)-lyase (OASS); cysK gene;
Azospirillum brasilense ; tellurite resistance.
Abstract
O-Acetylserine (thiol)-lyase (cysteine synthase) was purified from Azospirillum
brasilense Sp7. After hydrolysis of the purified protein, amino acid sequences of five
peptides were obtained, which permitted the cloning and sequencing of the cysK
gene. The deduced amino acid sequence of cysteine synthase exhibited homology
with several putative proteins from Alpha- and Gammaproteobacteria. Azospirillum
brasilense Sp7 cysK exhibited 58% identity (72% similarity) with Escherichia coli
K12 and Salmonella enterica serovar Typhimurium cysteine synthase proteins. An
E. coli auxotroph lacking cysteine synthase loci could be complemented with
A. brasilense Sp7 cysK. The 3.0-kb HindIII-EcoRI fragment bearing cysK contained
two additional ORFs encoding a putative transcriptional regulator and dUTPase.
Insertional disruption of the cysK gene did not produce a cysteine auxotroph,
indicating that gene redundancy in the cysteine biosynthetic or other biosynthetic
pathways exists in Azospirillum, as already described in other bacteria. Nitrogen
fixation was not altered in the mutant strain as determined by acetylene reduction.
However, this strain showed an eight-fold reduction in tellurite resistance as
compared to the wild-type strain, which was only observed during growth in
minimal medium. These data confirm earlier observations regarding the importance of cysteine metabolism in tellurite resistance.
Introduction
Azospirillum brasilense, a free-living, nitrogen-fixing, and
plant-growth promoting rhizobacterium (PGPR), is widely
used as inoculants throughout the world and is capable of
increasing the yield of important crops and grasses in
various soils and climates (Okon & Labandera-Gonzales,
1994; Dobbelaere et al., 2001). Since plant growth promotion is largely determined by efficient colonization of rhizosphere by inoculants, competition with better adapted
indigenous microflora can greatly influence establishment,
proliferation, and activity of these bacteria (Dobbelaere
et al., 2003; Bashan et al., 2004). Azospirillum has a versatile
metabolism (Hartmann & Zimmer, 1994), and this metabolic flexibility lends itself to a wide variety of possible
biotechnological and environmental applications. Indeed,
Azospirillum not only contributes to improved yields of
economically significant agronomical plants, but these bacteria also have potential for bioremediation, as was described for wastewater (Bashan et al., 2004).
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
Cysteine is an essential amino acid involved in maintaining the catalytic activity and structure of many proteins.
Cysteine residues are required for many essential and
ubiquitous proteins with iron-sulfur (Fe-S) clusters, including cytochromes, ferrodoxins, and nitrogenase (Beinert &
Kiley, 1999). Moreover, cysteine-containing molecules
such as glutathione and thioredoxin play a major role in
maintaining an intracellular reducing environment that
protects against oxidative stress (Carmel-Harel & Storz,
2000).
All living organisms require sulfur for the synthesis of
proteins and essential cofactors. In bacteria, cysteine biosynthesis is the predominant mechanism by which inorganic
sulfur is reduced and incorporated into organic compounds.
Two routes of cysteine biosynthesis are known to exist. In
one route, serine is first acetylated by acetyl-CoA to yield
O-acetyl-L-serine in a reaction that is catalyzed by serine
transacetylase (SAT; EC 2.3.1.30). In the last step,
O-acetylserine (thiol)-lyase (OASS; EC 2.5.1.47) catalyzes
the sulfhydrylation of O-acetyl-L-serine, thereby eliminating
FEMS Microbiol Lett 261 (2006) 272–279
273
Identification of cysK gene involved in tellurite resistance
acetate and adding hydrogen sulfide to produce cysteine.
OASS functions as a homodimer, and its activity is dependent on pyridoxal 5 0 -phosphate (PLP) (Kredich, 1996).
Escherichia coli and Salmonella enterica serovar Typhimurium have two OASS isoenzymes, OASS-A and OASS-B,
which are encoded by cysK and cysM, respectively. Each
isoenzyme has different substrate specificity, and each
complements the other when changing bacterial growth
conditions (Fimmel & Loughlin, 1977; Hulanicka et al.,
1986).
The other route of cysteine biosynthesis is found in
plants, animals, and microorganisms such as Saccharomyces
cerevisiae (Ono et al., 1994) and Lactobacillus lactis (Fernández et al., 2000) involving cystathionine b-synthase (CBS)
and cystathionineg-lyase (CBL) enzymes, which catalyze the
penultimate and last step, respectively, of cysteine production.
Nitrogenase is a remarkable metal enzyme consisting of
two distinct proteins. Dinitrogenase (a2b2 MoFe protein)
and dinitrogenase reductase (also refers to as Fe protein).
Within the a2b2 MoFe proteins, each ab half contains a pair
of unique metal sulfur clusters: an iron P [8Fe-7S] cluster
and an iron-molybdenum sulfur cofactor. The smaller
component has a single [4Fe-4S] cluster covalently linked
to Fe protein. All of them are involved catalytically in the
reduction of N2 (Smith, 2000). As cysteine is a key amino
acid for the formation of [Fe-S] clusters, our effort aimed at
studying cysteine metabolism and particularly the cysteine
synthase enzyme.
Here we describe the purification and partial characterization of O-acetylserine (thiol)-lyase and the identification
of its gene, cysK. We also demonstrate that disruption of
cysK compromises tellurite resistance.
Materials and methods
Bacterial strains, plasmids, and growth
conditions
The strains and plasmids used in this study are described in
Table 1. Escherichia coli strains were grown at 37 1C on
Luria-Bertani (LB) medium containing the appropriate
antibiotics for plasmid maintenance. Antibiotics were used
at the following concentrations (mg mL1): ampicillin, 100;
kanamycin, 30; tetracycline, 10; chloramphenicol, 30; streptomycin, 50. Escherichia coli NK3 and E. coli NK3 pAB901
were grown in M9 medium supplemented with amino acids
(20 mg mL1) in the presence or absence of cysteine
(20 mg mL1). Azospirillum strains were grown in K-lactate
Table 1. Bacterial strains, and plasmids used in this study
Strain or Plasmid
Description
Strains E. coli a5DH
NK3
NK3 (pBAD)
NK3 (pAB901)
S17.1
endA1 hsdR17 supE44 thi-1 l recA1 gyrA96 relA1
DtrpE5 leu-6 thi hsdR hsdM1 cysK cysM
E. coli NK3(pBAD)
E. coli NK3(pAB901)
E. coli Res Mod1 recA proA thi, Sm, Sp,Tp
integrated plasmid RP4 Tc::Mu Km::Tn7 Tra1
Azospirillum
A. brasilense Sp7
A. brasilense AR
A. brasilense AR (pAB1234)
Plasmids
pCR2.1
pBAD-TOPO
pSUP202
pBSL46
pAB300
pAB600
pAB900
pAB901
pAB902
pAB903
pAB1234
pAB905
Antibiotic
resistancea
Reference or source
Sambrook et al. 1989
Hulanicka et al. 1986
This study
This study
Simon et al. 1983
Wild-type ATCC29145
Sp7 cysK::km
Sp7 cysK::km (pAB1234)
Cloning vector lacZ f ori pUC ori
Expression vector PBAD Ap araC
Suicide vector pBR325 mob
Source of Km cassette
pCR2.1 containing a fragment of 300 pb of cysK
pCR2.1 containing a fragment of 600 pb of cysK
pCR2.1 containing a fragment of 912 pb of cysK
pBAD-TOPO containing a fragment of 912 pb of cysK
p SUP202 containing cysK
pSUP202 containing cysK::km
Cosmid containing the cysK gene from a genomic
library of A. brasilense Sp7
pCR2.1 containing a 3.0 kb fragment from
pAB1234 with the cysK region
Km
Km, Tc
Tarrand et al. 1978
This study
This study
Km Ap
Km, Ap
Tc Ap Cm
Ap, Km
Ap, Km
Ap, Km
Ap, Km
Ap, Km
Ap, Km
Ap, Km, Tc
Tc
Invitrogen
Invitrogen
Simon et al. 1983
Alexeyev et al. 1995
This study
This study
This study
This study
This study
This study
This study
Tc
This study
Tc, tetracycline; Km, kanamycin; Ap, ampicillin; Cm, chloramphenicol; Tp, trimetoprim.
FEMS Microbiol Lett 261 (2006) 272–279
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
274
medium or complex D medium as indicated (CarreñoLópez et al., 2000).
Purification of O-acetylserine (thiol)-lyase,
enzymatic assay, and N-terminal analysis
The purification of OASS-A was performed as previously
described (Soto et al., 1996). Briefly, A. brasilense was
cultured and harvested at the end of the logarithmic phase
of growth. The cells were lysed with 500 mg mL1 of lysozyme in 100 mL of buffer TES [50 mM Tris-HCl, pH 8.5,
50 mM EDTA, 50 mM NaCl]. The mixture was stirred for
18 h, at 4 1C and centrifuged at 10 000 g for 20 min. The
supernatant (crude extract) was brought to 30% (w/v) by
adding ammonium sulfate. After stirring for 30 min, the
sample was centrifuged at 10 000 g for 10 min. The supernatant was brought to 70% (w/v) by adding ammonium
sulfate. After stirring for 30 min, the sample was centrifuged
at 10 000 g for 10 min. Both pellets were resuspended in
buffer A [50 mM Tris-HCl, pH8., 20% glycerol], and enzymatic activity was assayed. Proteins were pooled and dialyzed against buffer B [20 mM potassium phosphate, pH 7,
20% glycerol]. The dialyzed enzyme was applied to a
diethylaminoethyl (DEAE)-Sephacel column (1.6 70 cm)
and equilibrated with buffer B. The column was eluted with
a linear gradient of 0–0.35 M KCl in buffer B. The dialyzed
DEAE-Sephacel fractions were applied to a Sephadex G-100
column (2.6 90 cm), equilibrated, and eluted with buffer
B. The fractions displaying enzymatic activity were collected, applied to a Sephadex G-100 column (2 75 cm),
equilibrated with buffer B, and eluted with the same buffer.
The fractions with enzymatic activity were collected, applied
to a phenyl-Sepharose column (1.2 15 cm), equilibrated
with 1.6 M (NH4)2SO4 in buffer B, and eluted with 300 mL
of a decreasing linear gradient of 1.6–0 M (NH4)4SO4 in
buffer B. The fractions collected in all steps were analyzed
for protein concentration and enzymatic activity. Protein
concentrations were determined by the method of Bradford
using Bio-Rad dye reagents and bovine serum albumin
(Sigma Chemicals) as standards. Enzymatic activity was
measured as described below.
O-acetylserine (thiol)-lyase activity was assayed using
O-acetyl-L-serine (OAS) and 5, 5 0 -dithiobis-2-nitrobenzoate (DTNB) as substrates (Tai et al., 1992). One milliliter of
reaction mixture containing 100 mM HEPES, pH 7.0, 50 mM
DTNB, 65 mM L-(-) Dithiothreitol-q10 (DTT), 2 mM OAS,
and the enzymatic preparations was incubated at 37 1C.
Reactions were terminated by placing the mixtures on ice.
Enzyme activity was determined by measuring the decrease
in OD412 (eTNB = 13 600 M1 cm1). One enzyme unit was
defined as the amount of enzyme that consumed 1 mmol of
TNB min1 at 32 1C (Saavedra et al., 2004).
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
A. Ramı́rez et al.
The purified enzyme was subjected to sodium dodecyl
sulphate-polyacrylamide gel electrophoresis (SDS-PAGE),
performed according to Laemmli (1970). The gel was
stained with Coomassie brilliant blue R-250, and the 35kDa band was excised, digested, and sequenced. The amino
acid sequences of five peptides were obtained through the
Stanford Pan Facility USA, under the direction of Dr Dick
Winant. These sequences are shown in Table 2.
DNA manipulations, sequence determination,
and bioinformatic analysis
Standard protocols were followed for DNA isolation and
recombinant procedures (Sambrook et al., 1989). Azospirillum brasilense genomic DNA was employed as a template
for the amplification of the cysK gene using the degenerate
primers CysP1F and C-TER yielding 300 bp; whereas
CysP2F and C-TER yielded 600-bp products, respectively.
Amplification using the CysF and C-TER-S primers yielded
a 912-bp product. The three PCR products were cloned into
the pCR2.1 vector, resulting in pAB300, pAB600 and
pAB900. Each plasmid insert was sequenced, and the
sequences were analyzed using BLAST X. The nucleotide
sequence reported in this study was submitted to GenBank
under the accession number DQ285606.
A library of A. brasilense Sp7 was screened by colony
hybridization analysis. The amplicon of 912 bp from cysK
was used as probe after labeling with [a32P]dCTP by the
random priming method (New England Biolabs). A cosmid
designated pAB1234 was selected, and the presence of the
cysK gene was verified by PCR using CysF and C-TER-S
primers. To analyze further the function of the cysK gene
product and the organization of the genomic region, the
plasmid pAB905 was constructed by cloning a 3.0-kb
HindIII-EcoRI fragment from pAB1234 into pCR2.1. The
fragment was sequenced and bioinformatic analysis was
performed.
Table 2. Sequences of peptides obtained and primers used in this study
Peptide or primer
Sequence
Peptide
1
I X D S I L D T V G AT P LV R
2
R AD E I VAT D P NA
3
IQGIGAGFVPDVLKK
4
LEGIPVGISSGAALAAALEIGSRPENE
5
Y L S TA L F E G L E
Primers
CysP1F . . . . . . . . . . . 5 0 GGCATCGGCGC(CG)GGCTTCGT(CG)
CysP2F . . . . . . . . . . . 5 0 GAGATCGT(GC)AC(CG)GACCC(CG)
C-TER . . . . . . . . . . . . 5 0 CTC(CG)AGGCCCTCGAA(CG)AG
C-TER-S . . . . . . . . . . . 5 0 CTCCAGGCCCTCGAACAG
CysF . . . . . . . . . . . . . 5 0 GACACCGT(CG)GGCGC(CG)ACCCCGCTG
Km1039-57F . . . . . . . 5 0 CCGTGATATTGCTGAAGAGC
Km671-90R . . . . . . . 5 0 GGAGCAAGGTGAGATGACAG
FEMS Microbiol Lett 261 (2006) 272–279
275
Identification of cysK gene involved in tellurite resistance
Construction of an expression vector and
expression in a cysteine auxotroph E. coli NK3
The 912-bp fragment was amplified by PCR from
A. brasilense genomic DNA using CysF and C-TER-S primers, and the resulting product was cloned into the expression vector pBAD. In the resulting construct, pAB901, the
coding region started at aspartic acid of the CysK protein
with the sense orientation of the araC promotor sequence,
as confirmed by restriction analysis (data not shown).
Escherichia coli NK3, a cysteine auxotroph, was transformed
with pAB901 and pBAD according to standard protocols
using CaCl2 (Sambrook et al., 1989).
Construction of A. brasilense cysK::km mutant
strain
For the construction of the A. brasilense cysK::km, the 912bp fragment from pAB900 was first digested with EcoRI,
cloned into the suicide vector pSUP202, linearized with
EcoRI and this yielded pAB902. This plasmid was then
digested with BglII and ligated with a Km cassette obtained
after digestion of pBSL46 with Bam H1 (Alexeyev et al.,
1995). The plasmid obtained, pAB903, was transformed into
E. coli S17.1 (Simon et al., 1983). Interruption of the wildtype cysK was carried out by homologous recombination
with selection of Km resistance after conjugation of E. coli
S17.1 with A. brasilense Sp7. The transconjugants were
selected in minimal medium K-lactate medium added with
Km and cysteine. The mutation was confirmed by PCR
using the Km 1039-57F and Km671-90R primers (data not
shown), and Southern blot analysis (Fig. 2).
Determination of tellurite resistance and
complementation of mutant A. brasilense
cysK::km by a cosmid library from A. brasilense
Sp7
Overnight cultures grown in K-lactate minimal medium
were diluted to 106 cells mL1, and 100 mL were spread onto
K-lactate minimal medium plates containing serial dilutions
of potassium Te (K2TeO3; Sigma). The MICs were also
determined in complex D medium. Determination of MICs
were repeated at least three times with identical results. The
cosmid, pAB1234, was mobilized by biparenteral mating
from E. coli S17.1 to A. brasilense cysK::km essentially as
described elsewhere (Carreño-López et al., 2000). Complementation was verified by determination of MIC as above.
Results and discussion
Purification of OASS
Azospirillum brasilense Sp7 OASS was purified by chromatography on a phenyl sepharose column as described in
FEMS Microbiol Lett 261 (2006) 272–279
M
1
2
3
4
5
6
193
102
60
41
27.6
15
Fig. 1. Coomassie blue-stained gel after SDS-PAGE of protein fractions
isolated during the purification of O-acetylserine (thiol)-lyase from
Azospirillum brasilense. Fifty micrograms of protein were loaded into
each lane. Lane 1: cell-free extract; Lane 2: ammonium sulfate 30%
fraction; Lane 3: ammonium sulfate 70% fraction; Lane 4: fraction of
DEAE-Sephacel chromatography; Lane 5: fraction of Sephadex chromatography; Lane 6: fraction of phenyl sepharose chromatography; Lane
M: molecular weight markers. The band corresponding to the OASS
protein is indicated with an arrow.
Materials and Methods. Fractions having high activities
were pooled and subjected to SDS-PAGE. The recovery yield
of the enzyme from the crude extract was 2.9% (Table 3).
The final preparation contained an amount of impurities as
judged by SDS-PAGE (Fig. 1). The molecular mass was
estimated to be 70 kDa determined by gel filtration chromatography of standard proteins on a Sephadex G-150 column.
The molecular mass determined by SDS-PAGE, was 35 kDa.
The enzyme was present as a band in the gel, consistent with
a homodimeric structure of native enzyme (Fig. 1). Following SDS-PAGE and staining with Coomassie brilliant blue,
the band was excised and subjected to in situ hydrolysis. Five
peptides were obtained and sequenced (Table 2).
Cloning and characterization of cysK
Identification of the cysK gene from A. brasilense Sp7 – the
gene encoding OASS – was achieved by PCR amplification
from genomic DNA using degenerate primers derived from
the amino acid sequences of peptides. The deduced sequence of the PCR-amplified DNA was highly identical to
prokaryotic OASS sequences, particularly to those of Alphaproteobacteria: the deduced sequence exhibited identity 71%
(similarity 84%) with putative proteins from Magnetospirillum magnetotacticum (YP_419562), Rhodospirillum rubrum and (YP_428875); and identity 71% (similarity
80%) with Sinorhizobium meliloti cysK1, (NP_384446),
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
276
A. Ramı́rez et al.
cysK
B
dUTPase Orf Rrf2
Sp7genome
cysK PCR product
1 kb
pAB901
B
pAB900
pAB902
cysK
E
H
pAB905
1 2
Sp7 genome
cysK
E
S
S
km
4.4 kb
pAB902
5.6 kb
Sp7 cysK::km genome
S
cysK::km
E
S 4.4 kb
5.6 kb
Fig. 2. Physical and genetic map of the DNA
region carrying the cysK gene in Azospirillum
brasilense Sp7, the ORF coding a putative
transcriptional regulator (Rrf2), and a putative
dUTPase. The orientation of transcription is
shown by the arrow direction. The arrow shows
araC promoter in pAB901 plasmid. The inverted
triangle shows the position of the Km cassette
insertion in A. brasilense AR strain (cysK::km).
Southern blot shows hybridization results of DNA
from A. brasilense Sp7 (1) and AR (2) strains,
digested with Sal I enzyme and probed with cysK
from pAB900. S (Sal I), B (Bgl II).
Table 3. Purification of OASS from Azospirillum brasilense Sp7
Step
Volume
(mL)
Total protein
(mg)
Total enzyme
(units)
Specific activity
(mmoL min1 mg1)
Recovery
(%)
Crude extract (NH4)2SO4
(30% saturation)
70% saturation
DEAE- Sephacel
Sephadex G 100
Phenyl Sepharose
500
21
30
35
35
17
908
69.6
288.2
250.9
9.9
5.1
30,200
7,455
16,650
9,409
6,129
875
33.2
107.4
57.8
37.7
122.6
172.3
100
24.7
55
31.2
20.3
2.9
The activity of the OASS was measured at 32 1C as described in the text.
Mesorhizobium loti cysK1, (NP_105443) and Agrobacterium
tumefaciens cysK1 (NP_531018). The OASS proteins from
E. coli (AAP31809) and S. enterica serovar Typhimurium
(NP_461365) exhibited lesser identities and similarities to
the A. brasilense CysK protein (58% identity and 72%
similarity; 58% and 71% similarity, respectively). Alignments of the amino acid sequences of these proteins revealed
that the A. brasilense OASS protein shared the PLP-binding
motif (SVKDRIG) found in these proteins. The Lys residue
in this motif is conserved among several OASS proteins of
different origins. In A. brasilense OASS protein, the residue
flanking Lys is an aspartate residue, as found in Grampositive bacteria, archaea, and eukaryotes (Saito et al., 1994;
Mino & Ishikawa, 2003). In enterobacteria this aspartate
residue is replaced by a cysteine residue. Azospirillum
brasilense cysK has G1C content of 69.74% - similar to the
G1C (68%) content of the A. brasilense genome. The
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
sequences of the five peptides derived from the purified
OASS protein were compared to the predicted sequence, and
a perfect match was found. DNA sequence analysis of the
region adjacent to the cysK gene revealed the presence of an
additional ORF, and a partial sequence as illustrated in
Fig. 2. This ORF is located upstream of the cysK gene, and
ends 76-bp upstream of cysK. It encodes a putative protein
of 151 amino acids with a calculated molecular mass of
17 072 Daltons and a pI of 7.06. Using database searches, this
putative protein was found to be very similar to putative
transcriptional regulators from M. magnetotacticum (73%
identity) and R. rubrum (75% identity), which are related to
the UPF0074 iron sulfur assembly transcription factor,
linked to Rrf2 family; to date, the function of these proteins
is not understood. The third ORF shows homology
with the deoxyuridine 5 0 -triphosphatase nucleotidohydrolase (dUTP) gene, involved in the metabolism of the
FEMS Microbiol Lett 261 (2006) 272–279
277
OD600 nm
Identification of cysK gene involved in tellurite resistance
0.6
0.5
0.4
0.3
0.2
0.1
0
0
1
2
3
4
T ( h)
5
6
8
10
Fig. 3. Growth of Escherichia coli NK3. Bacterial growth is shown as
optical density at 600 nm (OD600). Data represent the mean of three
independent replications. Strains E. coli NK3 (~), E. coli NK3pBAD (’),
E. coli NK3pAB901 () grown in minimal medium without cysteine;
Strains E. coli NK3 (B), E. coli NK3pBAD (&), E. coli NK3pAB901 ()
grown in minimal media supplemented with cysteine. T = hours.
thymidine nucleotides. In silico analysis showed that the
organization of three genes was similar only to that found in
bacteria phylogenetically close to Azospirillum such as
M. magnetotacticum and R. rubrum.
The identity of the isolated gene cysK that encodes
functionally active OASS protein was confirmed by functional rescue of E. coli NK3, which lack cysK and cysM
encoding OASS A and B proteins, respectively (Hulanicka
et al., 1986). The bacterial expression vector, pAB901,
carrying the cysK coding region and under the transcriptional control of the araC promotor was constructed and
transformed into E. coli NK3. Escherichia coli NK3 transformed with pAB901 was able to grow in minimal medium
lacking cysteine, as well as E. coli K12. In contrast, E. coli
NK3 cultures that had been transformed with the control
vector, pBAD-TOPO, were unable to support growth in
minimal medium (Fig. 3). Consistent with these results,
crude extract isolated from E. coli NK3 transformed with
pAB901 contained detectable OASS with activity, albeit at
lower levels than in the A. brasilense Sp7 strain. These
expression studies confirm that the pAB901 clone encodes
a functionally active OASS. The expression of functionally
active OASS by complementation experiments has been
successfully used to identify cloned cysK from Spinacia
oleracea (the mitochondrial cysK isoform), Selenomonas
ruminantius, and the archaea Methanosarcina barkeri (Saito
et al., 1994; Kitabatake et al., 2000; Evans et al., 2002).
inactivation of cysK was not sufficient to induce auxotrophy
(data not shown) and suggesting that redundancy in
cysteine biosynthesis exists in A. brasilense Sp7. Indeed, a
second isoenzyme for this step of the cysteine biosynthetic
pathway may also be present in A. brasilense Sp7, as in many
other microorganisms. Moreover, Southern blot hybridization performed on A. brasilense genomic DNA at various
stringencies revealed a single signal at 4.4 kb (Fig. 2). Then if
a second copy of the cysK occurs in A. brasilense Sp7, it is
expected to be quite divergent from the gene cloned here;
the other pathway which uses methionine, as precursor
could occur into Azospirillum genome. These two possibilities, a isoenzyme, or an alternative pathway, could justify
the cysteine prototrophy of the AR strain. The latter
possibility has been reported in Rhizobium etli (Taté et al.,
1999). This bacterium contains a methionine biosynthetic
pathway in which sulfide is incorporated into O-succinylhomoserine to form homocysteine, being subsequently converted to methionine. Cysteine is formed from methionine
via a trans-sulfurylation reaction involving cystathionine,
and then converted to cysteine by cystathionineg-lyase (EC
4.4.1.1). Besides, the analysis of sequenced genomes of
Alphaproteobacteria has revealed the presence of several
genes with sequence similarity to OASS within one genome.
For example, M. magnetotacticum possessed three copies of
cysK: CysK1 (YP_419562), CysK2 (YP_420663) and CysK3
(YP_420416.1) occur and exhibit 73, 38 and 33% identity,
respectively with A. brasilense CysK protein.
We tried to clone the second copy of the cysK gene, by
transforming E. coli NK3 with DNA from the cosmid library
of A. brasilense Sp7; this was unsuccessful, and might indicate
that the second copy was not expressed in E. coli NK3.
In addition, the nitrogenase activity in both A. brasilense
Sp7 and the AR mutant was analyzed. Both strains displayed
similar rates of C2H2 reduction with 36 nmol 0.02 h1 and
34 nmol 0.03 h1, respectively for the wild type and mutant. It has been suggested that the link between cysteine
metabolism and N2 fixation is due to the ability of cysteine
to serve as a source of inorganic sulfur, which is necessary
for the biosynthesis of metal-sulfur clusters. Therefore,
alternative or parallel pathways for cysteine biosynthesis
may provide the sulfur required for the biosynthesis of
nitrogenase.
Phenotypes of A. brasilense cysK mutant
To evaluate the role of cysK in cysteine metabolism, we first
constructed a mutant strain by gene interruption with a Km
cassette; gene inactivation was confirmed by Southern blot
hybridization using cysK as a probe (Fig. 2). The mutant
strain, designated A. brasilense AR, was analyzed for its
ability to grow in the absence of cysteine. Azospirillum
brasilense AR was able to grow in K-lactate minimal medium
in the presence or absence of cysteine, demonstrating that
FEMS Microbiol Lett 261 (2006) 272–279
O-Acetylserine (thiol)-lyase A-mediated
resistance to K2TeO3
It has been demonstrated that disruption of cysK resulted in
a decreased resistance of Gram-negative bacteria to potassium tellurite (K2TeO3) (O’Gara et al., 1997). In the same
way, introduction of the cysK gene from Bacillus stearothermophilus V conferred K2TeO3 resistance to E. coli (Vásquez
et al., 2001). Then we determined if K2TeO3 resistance was
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
278
altered in the A. brasilense AR mutant strain compared to
the A. brasilense Sp7 wild-type strain using K-lactate minimal medium. The wild-type strain was highly resistant to
K2TeO3 (80 mg mL1), showing that under these conditions
tellurium (Te0) is not toxic for A. brasilense Sp7. In contrast,
A. brasilense AR cultures could grow only up to concentrations of 10 mg mL1 in minimal medium. For comparison,
the MIC for E. coli strains lacking K2TeO3 resistance
determinants is approximately 1–2 mg mL1, indicating that
K2TeO3 is extremely toxic (Taylor, 1999). The AR mutant
complemented with pAB1234, the cosmid carrying the cysK
gene, was able to grow up to 80 mg mL1. The MIC of both
strains (Sp7 and AR mutant) decreased to 5 mg mL1 in
complex D medium. K2TeO3 resistance up to 300 mg mL1
has been reported in Rhodobacter sphaeroides and Rhodobacter capsulatus (Moore & Kaplan, 1992; Borghese et al.,
2004). K2TeO3 resistance in R. sphaeroides, as well as in
A. brasilense, is growth mode-dependent, such that complex
media confers a much lower resistance than minimal
medium (Moore & Kaplan, 1992).
In R. sphaeroides, two loci of unrelated determinants are
involved in K2TeO3 resistance – the trgAB genes, which
encode membrane-associated proteins, and cysK. Disruption of cysK decreases K2TeO3 resistance in R. sphaeroides
(O’Gara et al., 1997). Similarly, the cysK gene from Bacillus
stearothermophilus V confers ten-fold higher K2TeO3 resistance to E. coli and S. enterica serovar Typhimurim (Vásquez
et al., 2001). Also, in Staphylococcus aureus a mutation in
cysM, the gene encoding O-acetylserine (thiol)-lyase B,
increased sensitivity to K2TeO3, hydrogen peroxide, and
diamine (a specific thiol oxidant). High levels of glutathione
were produced by E. coli carrying the cysM gene from
S. aureus (Lithgow et al., 2004). The thiol redox enzymes
glutathione reductase and thioredoxin reductase, as well as
their metabolites (i.e., glutathione, glutaredoxin, and thioredoxin), all contain cysteine residues and have been shown
to be involved in K2TeO3 resistance in E. coli. It has been
suggested that thiols reduce K2TeO3, to its less toxic metallic
form, Te0 (Turner et al., 1999).
Apart from the thiols, other mechanisms of K2TeO3
reduction may exist. It has been proposed that a key site of
K2TeO3 reduction is at the membrane through the membrane-associated NarG and NarZ nitrate reductases (NR)
(Taylor, 1999; Sabaty et al., 2001). In addition, hypersensitivity to K2TeO3 has been observed under aerobic growth
conditions in nar mutants (Avazéri et al., 1997). Sabaty et al.
(2001) demonstrated in R. sphaeroides f. sp. denitrificans,
that purified periplasmic nitrate reductase (NapAB) is able
to reduce K2TeO3. Consistent with this, tellurite reductase
activity was not detected in Nap mutants.
We then propose that in A. brasilense, as in other bacteria,
at least two components contribute to K2TeO3 resistance.
One of them, which is likely the major contributor to
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c
A. Ramı́rez et al.
resistance level, involves the metabolism of cysteine ascribed
to O-acetylserine (thiol)-lyase A, encoded by cysK. The basal
level of resistance most probably involves the periplasmic
activity of nitrate reductase, an enzyme recently described in
the A. brasilense Sp245 strain (Steenhoudt et al., 2001).
In conclusion, although OASS is not essential for cysteine
biosynthesis, it is clearly involved, via a currently unknown
biochemical mechanism, in determining K2TeO3 resistance.
Tellurium is not an essential element and is relatively rare in
the environment, but it can be found at high concentrations
near waste discharge sites. Future studies will focus on the
role of A. brasilense in the bioremediation of soils polluted
with K2TeO3.
Acknowledgements
We thank Dr D. Söll for providing the E. coli NK3 strain.
This work was partially supported by a grant of VIEP-SEP.
A.R.M. and A.S.J. were recipients of scholarships from
CONACyT.
References
Alexeyev MF, Shokolenko IN & Croughan TP (1995) Improved
antibiotic-resistance gene cassettes and omega elements for
Escherichia coli vector construction and in vitro deletion/
insertion mutagenesis. Gene 160: 63–67.
Avazéri C, Turner RJ, Pommier J, Weiner JH, Giordano G &
Verméglio A (1997) Tellurite reductase activity of nitrate
reductase is responsible for the basal resistance of Escherichia
coli to tellurite. Microbiol 143: 1181–1189.
Bashan Y, Holguin G & de-Bashan LE (2004) Azospirillum-plant
relationships: physiological, molecular, agricultural and
environmental advances (1997–2003). Can J Microbiol 50:
521–577.
Beinert H & Kiley PJ (1999) Fe-S proteins in sensing and
regulatory functions. Curr Opin Chem Biol 3: 152–157.
Borghese R, Borsetti F, Foladori P, Ziglio G & Zannoni D (2004)
Effects of the metalloid oxyanion tellurite (TeO2
3 ) on growth
characteristics of the photobacterium Rhodobacter capsulatus.
Appl Environ Microbiol 70: 6595–6602.
Carmel-Harel O & Storz G (2000) Roles of the glutathione and
thioredoxin-dependent reductions systems in Escherichia coli
and Saccharomyces cerevisiae responses to oxidative stress. Ann
Rev Microbiol 54: 439–461.
Carreño-López R, Campos Reales NB, Elmerich C & Baca BE
(2000) Physiological evidence for differently regulated
tryptophan dependent pathways for indole-3-acetic acid
synthesis in Azospirillum brasilense. Mol Gen Genet 264:
521–530.
Dobbelaere S, Croonenborghs A, Thys A et al. (2001) Responses
of agronomically important crops to inoculation with
Azospirillum. Aust J Plant Physiol 28: 871–879.
FEMS Microbiol Lett 261 (2006) 272–279
279
Identification of cysK gene involved in tellurite resistance
Dobbelaere S, Vanderleyden J & Okon Y (2003) Plant growthpromoting effects of diazotrophs in the rhizosphere. Crit Rev
Plant Sci 22: 107–149.
Evans JD, Al-Khaldi SF & Martin SA (2002) Cloning of the
O-acetylserine lyase gene from the ruminal bacterium
Selenomonas ruminantium HD4. Curr Microbiol 44: 161–166.
Fernández M, Van Doesburg W, Rutten GAM, Marugg JD, Alting
AC, van Kranenburg R & Kuipers OP (2000) Molecular and
functional analysis of the metC gene of Lactobacillus lactis,
encoding cystahionine b-lyase. Appl Environ Microbiol 66:
42–48.
Fimmel AL & Loughlin RE (1977) Isolation and characterization
of cysK mutant of Escherichia coli K12. J Gen Microbiol 103:
37–43.
Hartmann A & Zimmer W (1994) Physiology of Azospirillum.
Azospirillum-Plant Associations (Okon Y, ed), pp. 15–31. CRC
Press, Boca Raton, FL.
Hulanicka MD, Garrett C, Jaguar-Burdzy G & Kredich NM
(1986) Cloning and characterization of the cysAMK region of
Salmonella typhimurium. J Bacteriol 168: 322–327.
Kitabatake M, So MW, Tumbula DL & Söll D (2000) Cysteine
biosynthesis pathway in the archaeon Methanosarcina barkeri
encoded by acquired bacterial genes? J Bacteriol 182: 143–145.
Kredich NM (1996) Biosynthesis of cysteine. Escherichia coli and
Salmonella. Cellular and Molecular Biology (Neidhardt FC, ed),
pp. 514–527. ASM Press, Washington D.C.
Laemmli UK (1970) Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature 227:
680–685.
Lithgow JK, Hayhurst EJ, Cohen G, Aharonowitz Y & Foster SJ
(2004) Role of a cysteine synthase in Staphylococcus aureus.
J Bacteriol 186: 1579–1590.
Mino K & Ishikawa K (2003) Characterization of a novel
thermostable O-serine sulfhydrylase from Aeropyrum pernix
K1. J Bacteriol 185: 2277–2284.
Moore MD & Kaplan S (1992) Identification of intrinsic highlevel resistance to rare-earth oxides and oxyanions in members
of the class Proteobacteria: characterization of tellurite,
selenite, and rhodium sesquioxide reduction in Rhodobacter
sphaeroides. J Bacteriol 174: 1505–1514.
O’Gara JP, Gomelsky M & Kaplan S (1997) Identification and
molecular genetic analysis of multiple loci contributing to
high-level tellurite resistance in Rhodobacter sphaeroides 2.4.1.
Appl Environ Microbiol 63: 4713–4720.
Okon Y & Labandera-Gonzales CA (1994) Agronomic
applications of Azospirillum. An evaluation of 20 years
worldwide field inoculation. Soil Biol Biochem 26: 1591–1601.
Ono B, Kijima IK, Inoue T, Miyoshi SI, Matsuda A & Shinoda S
(1994) Purification and properties of Saccharomyces cerevisiae
cystathionine b synthase. Yeast 10: 333–339.
FEMS Microbiol Lett 261 (2006) 272–279
Saavedra CP, Encinas MV, Araya MA et al. (2004) Biochemical
characterization of a thermostable cysteine synthase from
Geobacillus stearothermphilus V. Biochimie 86: 481–483.
Sabaty M, Avazéri C, Pignol D & Verméglio A (2001)
Characterization of the reduction of selenate and tellurite by
nitrate reductases. Appl Environ Microbiol 67: 5122–5126.
Saito K, Tatsugichi K, Takagi Y & Murakoshi I (1994) Isolation
and characterization of cDNA that encodes a putative
mitochondrion-localizing isoform of cysteine synthase
(O-acetyl (thiol)-lyase) from Spinacea oleracea. J Biol Chem
269: 28187–28192.
Sambrook J, Fritsch EF & Maniatis T (1989) Molecular Cloning: A
Laboratory Manual, 2nd edn. Cold Spring Laboratory Press,
Cold Spring Harbor, NY.
Simon R, Priefer U & Puhler A (1983) A broad host range
mobilization system for in vivo genetic engineering:
transposon mutagenesis in Gram negative bacteria.
Bio/Technology 1: 37–45.
Smith BE (2000) Chemistry and biochemistry of nitrogenase:
Nitrogen Fixation: From Molecules to Crop Productivity.
(Pedrosa F O, Hungria M, Yates G & Newton WE, eds),
pp. 11–12. Kluwer Academic Press, Amsterdam.
Soto-Urzúa L, Xochihua-Corona YG, Encarnación MF & Baca BE
(1976) Purification and properties of aromatic amino acid
aminotransferase from Azospirillum brasilense UAP14 strain.
Can J Microbiol 42: 294–298.
Steenhoudt O, Keijers V, Okon Y & Vanderleyden J (2001)
Identification and characterization of a periplasmic nitrate
reductase in Azospirillum brasilense Sp245. Arch Microbiol 175:
344–352.
Tai CH, Nalabolu RSR, Jacobson TM, Minter DE & Cook PF
(1993) Kinetics mechanism of the A and B isoenzymes of Oacetylserine sulfhydrylase from Salmonella typhimurium LT-2
using the natural and alternative reactants. Biochem 32:
6433–6442.
Tarrand JJ, Krieg NR & Döbereiner J (1978) A taxonomic study of
the Spirillum lipoferum group, with descriptions of a new
genus, Azospirirllum gen. Nov. and Azospirillum brasilense Sp.
Nov. Can J Microbiol 24: 967–980.
Taté R, Riccio A, Caputo E, Iaccarino M & Patriarca J (1999) The
Rhizobium etli metZ gene is essential for methionine
biosynthesis and nodulation of Phaseolus vulgaris. Mol PlantMicrobe Interact 12: 24–34.
Taylor DE (1999) Bacterial tellurite resistance. Trends Microbiol
111–115.
Turner RJ, Weiner JH & Taylor DE (1999) Tellurite-mediate thiol
oxidation in Escherichia coli. Microbiol 145: 2549–2557.
Vásquez CC, Saavedra CP, Loyola CA, Araya MA & Pichuantes S
(2001) The product of the cysK gene of Bacillus
stearothermophilus V mediates potassium tellurite resistance in
E. coli. Curr Microbiol 43: 418–423.
2006 Federation of European Microbiological Societies
Published by Blackwell Publishing Ltd. All rights reserved
c