Download RACC BIO Biotechnology

Chapter 20
DNA Technology
and Genomics
PowerPoint Lectures for
Biology, Seventh Edition
Neil Campbell and Jane Reece
Lectures by Chris Romero
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
DNA technology
DNA technology – methods for studying and
manipulating genetic material.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Manipulating Genomes
• Recombinant DNA- combining nucleotide
sequences from 2 different sources
• Genetic engineering – manipulating genes
• Biotechnology – manipulating organisms
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Examples of DNA technology and manipulating
genomes
– Human genome project
• Map all the human DNA down to its
nucleotide sequences
– DNA fingerprinting
– Cancer research, gene therapy
– Agricultural fields (better crops)
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Cloning
Gene cloning - production of multiple identical
copies of a specific gene or other DNA
segment
Recombinant DNA technology allowed scientists
to take the first step towards cloning.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
DNA Cloning and Its Applications: A Preview
• Most methods for cloning pieces of DNA in the
laboratory
– Share certain general features
• 1. use bacteria
• 2. use plasmids
• Plasmids – small, circular DNA molecules
– Replicate separately from the nucleoid
– They are helpful because they can carry
virtually any gene and replicate in bacteria.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Overview of gene cloning
•
1.Plasmid is isolated
from bacteria
2. Gene of interest is
obtained from another
cell.
3.Piece of that gene
is inserted into the
plasmid
4. Bacterial cell
takes up the plasmid
through
transformation
Now recombinant
DNA
EX. Plant gene
carrying resistance
to pests.
5. Cell multiplies with
gene of interest
Cloned
genes
Uses with gene
Uses with protein
Pest resistance
Oil eating bacteria
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Dissolve blood clots
Human growth
hormone
Using Restriction Enzymes to Make Recombinant DNA
• Bacterial restriction enzymes
– Cut DNA molecules at a limited number of
specific DNA sequences, called restriction
sites
– Like “cutting” and “pasting”
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Restriction enzymes
• Restriction enzymes are the cutting tool.
– There are hundreds of restriction enzymes
– They chop up the foreign DNA
• Each restriction enzyme recognizes a specific DNA
sequence or restriction site (usually four to eight
nucleotides long)
– Yielding a set of restriction fragments
• These fragments have “sticky ends” that can bond
with complementary “sticky ends” of other fragments
• DNA ligase is an enzyme
– That seals the bonds between restriction fragments
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
• Using a restriction enzyme and DNA ligase to
make recombinant DNA
Restriction site
DNA 5
3
3
5
GAATTC
CTTAAG
1 Restriction enzyme cuts
the sugar-phosphate
backbones at each arrow
G
G
Sticky end
2 DNA fragment from
another source is added.
Base pairing of sticky
ends produces various
combinations.
G AATT C
C TTAA G
G
Fragment from different
DNA molecule cut by the
same restriction enzyme
G AATTC
CTTAA G
One possible combination
3 DNA ligase
seals the strands.
Figure 20.3
Recombinant DNA molecule
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
G
Cloning a Eukraryotic Gene in a Bacterial Plasmid
• In gene cloning, the original plasmid is called a
cloning vector
– Defined as a DNA molecule that can carry
foreign DNA into a cell and replicate there
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
•
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Storing Cloned Genes in Libraries
• In the above example, no single gene is
targeted for cloning.
• In step 3 there can be thousands of different
recombinant plasmids
• These plasmid-containing cell clones are
referred to as a genomic library.
– Certain bacteriophages have also been used
as cloning vectors for making genomic
libraries.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Nucleic acid probes for finding the genes of interest
• In gene cloning it can be difficult to identify the
colony carrying the specific DNA fragment of
interest.
– Back in step 4, all the white colonies would be
a bacteria with recombinant DNA
– To find a gene of interest it can be based
paired with a complementary sequence on
another nucleic acid molecule.
• Nucleic acid hybridization is one way to obtain
a specific gene of interest
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Nucliec Acid probes
If we know that our hypothetical gene contains
the sequence TAGGCT, a biochemist can use
nucleotides labeled with a radioactive isotope
to synthesize a strand of DNA with ATCCGA
– This short strand (ATCCGA) is called the
nucleic acid probe
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Amplifying DNA in Vitro: The Polymerase Chain
Reaction (PCR)
• The polymerase chain reaction, PCR
– Used if the source of DNA is scanty or impure
– Can produce many copies of a specific target
segment of DNA in a test tube.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
• The PCR procedure
5
APPLICATION With PCR, any specific segment—the target
sequence—within a DNA sample can be copied many times
(amplified) completely in vitro.
3
Genomic DNA
1 Denaturation:
5
Heat briefly
to separate
DNA strands
3
DNA
polymerase
Target
sequence added.
This is the
5
DNA
replication
3
enzyme
5
3
TECHNIQUE The starting materials for PCR are doublestranded DNA containing the target nucleotide sequence to be
copied, a heat-resistant DNA polymerase, all four nucleotides,
and two short, single-stranded DNA molecules that serve as
primers. One primer is complementary to one strand at one end
of the target sequence; the second is complementary to the
other strand at the other end of the sequence.
RESULTS
During each PCR cycle, the target DNA
sequence is doubled. By the end of the third cycle, one-fourth
of the molecules correspond exactly to the target sequence,
with both strands of the correct length (see white boxes
above). After 20 or so cycles, the target sequence molecules
outnumber all others by a billionfold or more.
Figure 20.7
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
2 Annealing:
Cycle 1
yields
2
molecules
Cool to allow
primers to
hydrogen-bond.
Primers
3 Extension:
DNA polymerase
adds nucleotides
to the 3 end of
each primer
Cycle 2
yields
4
molecules
Cycle 3
yields 8
molecules;
2 molecules
(in white boxes)
match target
sequence
New
nucleotides
• mRNA can also be used as the starting material.
– A researcher would isolate mRNA and make singlestranded DNA transcripts from it using reverse
transcriptase (obtained from retroviruses)
– Enzymes are added to break down the mRNA, and
DNA polymerase is used to synthesize a second
strand of DNA
• This DNA is called cDNA or complementary DNA
• Useful for studying specialized functions its smaller,
has no introns.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
DNA sequencing
• the process of determining the exact sequence
of nucleotides in a stretch of DNA
– Used to take a very long time to determine an
exact sequence
– Today it is automated
• Use restriction enzymes to cut long pieces
of DNA into discrete fragments
• These fragments are then analyzed by
machines.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Gel Electrophoresis
• Gel electrophoresis – helps to sort DNA
molecules
–
Separates DNA restriction fragments of different lengths
APPLICATION Gel electrophoresis is used for separating nucleic acids or proteins that
differ in size, electrical charge, or other physical properties. DNA molecules
are separated by gel electrophoresis in restriction fragment analysis of both
cloned genes (see Figure 20.9) and genomic DNA (see Figure 20.10).
Cathode
1 Each sample, a mixture of DNA molecules, is placed in a separate
well near one end of a thin slab of gel. The gel is supported by
glass plates, bathed in an aqueous solution, and has electrodes
attached to each end.
Power
source
Mixture
of DNA
molecules
of different sizes
Gel
Glass
plates
2 When the current is turned on, the negatively charged DNA
molecules move toward the positive electrode, with shorter
molecules moving faster than longer ones. Bands are shown here
in blue, but on an actual gel, DNA bands are not visible until a
DNA-binding dye is added. The shortest molecules, having
traveled farthest, end up in bands at the bottom of the gel.
TECHNIQUE
RESULTS
Figure 20.8
Gel electrophoresis separates macromolecules on the basis of their rate
of movement through a gel in an electric field. How far a DNA molecule
travels while the current is on is inversely proportional to its length. A
mixture of DNA molecules, usually fragments produced by restriction
enzyme digestion, is separated into “bands”; each band contains
thousands of molecules of the same length.
After the current is turned off, a DNA-binding dye is added. This dye
fluoresces pink in ultraviolet light, revealing the separated bands to which it
binds. In this actual gel, the pink bands correspond to DNA fragments of
different lengths separated by electrophoresis. If all the samples were initially
cut with the same restriction enzyme, then the different band patterns indicate
that they came from different sources.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Anode
Longer
molecules
Shorter
molecules
Comparing DNA sequences
• Each persons’ DNA is different
• Restriction fragments (pieces of DNA) are used
to make comparisons
– The number of restriction fragments and their
sizes reflect the specific sequence of
nucleotides in your DNA
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
• Concept 20.3: Entire genomes can be mapped
at the DNA level
• The Human Genome Project
– Sequenced the human genome
• Scientists have also sequenced genomes of
other organisms
– Providing important insights of general
biological significance
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
The strategy of The Human Genome Project
• The public consortium followed a hierarchy of three
stages
1.Linkage mapping
2. physical mapping
3. DNA sequencing
then assembly of the overall sequence
• An alternative approach to sequencing whole
genomes starts with the sequencing of random DNA
fragments
– Powerful computer programs would then assemble the
resulting very large number of overlapping short
sequences into a single continuous sequence
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
The strategy continued
• The Celera whole-genome shotgun approach
omitted the first two stages
Each chromosome was
cut into small fragments
These were cloned in
plasmid or phage vectors
2
3 Sequence each
fragment
ACGATACTGGT
CGCCATCAGT
4
Powerful computers assembled the
overlapping fragments to determine
the overall sequence.
ACGATACTGGT
AGTCCGCTATACGA
…ATCGCCATCAGTCCGCTATACGATACTGGTCAA…
Figure 20.13
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
• Concept 20.4: Genome sequences provide
clues to important biological questions
• In genomics
– Scientists study whole sets of genes and their
interactions
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Identifying Protein-Coding Genes in DNA Sequences
• Computer analysis of genome sequences
– Helps researchers identify sequences that are
likely to encode proteins
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
• Current estimates are that the human genome
contains about 25,000 genes
– But the number of human proteins is much
larger
Table 20.1
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
• Comparison of the sequences of “new” genes
– With those of known genes in other species
may help identify new genes
– .
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Determining Gene Function
• For a gene of unknown function
– Experimental inactivation of the gene and
observation of the resulting phenotypic effects
can provide clues to its function
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Comparing Genomes of Different Species
• Comparative studies of genomes from related
and widely divergent species
– Are providing valuable information in many
fields of biology
– The functions of some human genes have
been identified through the study of similar
yeast genes
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Future Directions in Genomics
• Genomics
– Is the study of entire genomes
• Proteomics
– Is the systematic study of all the proteins
encoded by a genome
• How do the “parts” work in the whole
system? Knowing how proteins interact will
help scientists understand how cells and
organisms function.
•
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
• Concept 20.5: The practical applications of
DNA technology affect our lives in many ways
• Numerous fields are benefiting from DNA
technology and genetic engineering
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Medical Applications
• One obvious benefit of DNA technology
– Is the identification of human genes whose
mutation plays a role in genetic diseases
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Diagnosis of Diseases
• Medical scientists can now diagnose hundreds
of human genetic disorders
– By using PCR and primers corresponding to
cloned disease genes, then sequencing the
amplified product to look for the diseasecausing mutation
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Human Gene Therapy
• Gene therapy
– Is the alteration of an afflicted individual’s
genes
– Holds great potential for treating disorders
traceable to a single defective gene
– Uses various vectors for delivery of genes into
cells
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
• Gene therapy using a retroviral vector
Cloned gene
(normal
allele,
absent
from
patient’s
cells)
Retrovirus
capsid
1 Insert RNA version of normal allele
into retrovirus.
Viral RNA
2 Let retrovirus infect bone marrow cells
that have been removed from the
patient and cultured.
3 Viral DNA carrying the normal
allele inserts into chromosome.
Bone
marrow
cell from
patient
Figure 20.16
4 Inject engineered
cells into patient.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
• Practical problems?
– Proper control mechanisms are present so that
the gene is expressed at the proper time, in
the proper place, and to the proper degree.
– Insertion of the therapeutic gene must not
harm other cell functions.
• Ethical considerations?
– Should it be done on germ cells (cells that
become egg and sperm) thus influencing the
genetic makeup of future generations.
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Pharmaceutical Products
• Applications of DNA technology include
– Large-scale production of human hormones
and other proteins with therapeutic uses
– Production of safer vaccines
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Forensic Evidence
• DNA “fingerprints” obtained by analysis of
tissue or body fluids found at crime scenes
– Can provide definitive evidence that a suspect
is guilty or not
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
• A DNA fingerprint
– Is a specific pattern of bands of RFLP markers
Blood from
Victim’s
on a gel
blood
(V)
blood (D)
clothes
Defendant’s
defendant’s
4 g
D
Jeans
Figure 20.17
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
8 g
shirt
V
• DNA fingerprinting
– Can also be used in establishing paternity
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Environmental Cleanup
• Genetic engineering can be used to modify the
metabolism of microorganisms
– So that they can be used to extract minerals
from the environment or degrade various types
of potentially toxic waste materials
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Agricultural Applications
• DNA technology
– Is being used to improve agricultural
productivity and food quality
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Animal Husbandry and “Pharm” Animals
• Transgenic animals
– Contain genes from other organisms
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
– Have been engineered to be pharmaceutical
“factories”
Figure 20.18
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Genetic Engineering in Plants
• Agricultural scientists
– Have already endowed a number of crop
plants with genes for desirable traits
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
Safety and Ethical Questions Raised by DNA Technology
• The potential benefits of genetic engineering
– Must be carefully weighed against the potential
hazards of creating products or developing
procedures that are harmful to humans or the
environment
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings
• Today, most public concern about possible
hazards
– Centers on genetically modified (GM)
organisms used as food
Copyright © 2005 Pearson Education, Inc. publishing as Benjamin Cummings