* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Bio1100Ch19W
List of types of proteins wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Community fingerprinting wikipedia , lookup
Genomic imprinting wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Ridge (biology) wikipedia , lookup
Genome evolution wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Transcription factor wikipedia , lookup
Gene expression wikipedia , lookup
Gene expression profiling wikipedia , lookup
Gene regulatory network wikipedia , lookup
Histone acetylation and deacetylation wikipedia , lookup
Secreted frizzled-related protein 1 wikipedia , lookup
Molecular evolution wikipedia , lookup
Non-coding DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Point mutation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
CHAPTER 19 THE ORGANIZATION AND CONTROL OF EUKARYOTIC GENOMES All cells contain all genes…. …yet a given cell only expresses 5% of it’s genes How does the cell know which genes to turn on and which to turn off?? Part of the answer lies in _____________________ DNA is packaged into ___________ • Histones • are present in all organisms • are _______________that package DNA • have positive charged charged amino acids bind tightly to ___________________________ charged DNA. • give the appearance of beads on a string • are temporarily displaced by polymerases during transcription and replication DNA wrapped around histones form a _______________ Fig.19.2 • DNA is further packed tighter and tighter into fibers and domains by mostly unknown mechanisms Fig. 19.2 Cells in must accomplish two tasks: • 1. Continually turn on and off certain genes in response to signals from the environment. • 2. Regulate expression of genes common for cell function and specialized functions (liver vs kidney function) How is expression of all these genes regulated??? Many levels of control are available to control expression of any given gene… Factor affecting transcription Transcription rate RNA processing …..but most regulation is at the level of _______________ RNA stability Translation Protein modification Protein cleavage Protein stability Fig. 19.3 So how do we regulate transcription???? 1. ______________________________ • Chromosomes regions that remain highly condensed are called__________________, •Regions less condensed are called _______________. • Genes located in highly condensed regions are mostly not expressed • In contrast, genes located in less condensed regions are often expressed 2. __________________ (-CH3) groups added to DNA bases after DNA synthesis. • High methylation correlates with _____________DNA CH3 CH3 AGCGTGATGATGCGCACATA DNA 3. Histone _____________ (addition of an acetyl group -COCH3) Acetylated histones grip DNA less tightly, providing easier access for transcription proteins in this region. nucleosome Ac Ac H4 H3 H2A H2B Ac Ac Increased acetylation = increased transcription DNA Peptide-CH-CH2-CH2-CH2-CH2-NH-C-CH3 O Acetylation of lysine Several ___________________can transcription factors acetylate or deacetylate histones 4. DNA__________________ Fig. 19.5 Specific _______________ near promoters bind specific Fig. 19.6 transcription factors These transcription factors then assist in loading ____________ on the gene by “talking” to the transcription initiation complex Tissue-specific expression is due to _____________ action of transcription factors Example: HNF3a HNF4 HNF1a C/EBP HNF3a Liver-specific genes Genetics, Russell, p6. Transcription factors 1850 (6%) 30,000 genes 320 cell types 700 Liver-specific genes Cancer results from genetic changes that affect the cell cycle • Cancer - a disease in which cells escape from the control methods that normally regulate cell growth and division. • ________________ - genes that can cause cancer • Discovered in viruses • ________________ are close counterparts of oncogenes found in other organisms. If overexpressed- cause uncontrolled cell growth What can cause proto-oncogenes to over-express?? 1. _____________ 3. _____________ 2. ____________ Fig. 19.11 Tumor-suppressor genes These prevent cancer by repairing DNA or preventing rapid cell division If mutate a tumor suppressor gene- leads to ________ The Ras gene- (a protooncogene) is mutated in _____ of human cancers The _____ gene- (a tumor suppressor) is mutated in 50% of human cancers •Called the “___________________ of the genome” because: 1. It stops the cell cycle 2. It repairs damaged DNA 3. It caused the cell to _______________ if not repairable Most cancers are due to multiple gene mutations Fig. 19.13 Colorectal cancer Some viruses carry oncogenes- lead to cancer •leukemia, liver cancer, and cancer of the cervix. Some folks are _______________ to cancer • 15% of colorectal cancers involve inherited mutations. • Between 5-10% of breast cancer cases, the 2nd most common U.S. cancer, show an __________ predisposition. • Mutations to one of two tumor-suppressor genes, BRCA1 and BRCA2, increases the risk of breast and ____________ cancer. New technology- A blood test to determine if a woman has any point mutations in her BRCA1 or BCRA2 genes