* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Slide 1
Pathogenomics wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genome evolution wikipedia , lookup
Biology and consumer behaviour wikipedia , lookup
Epigenetics of neurodegenerative diseases wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Pharmacogenomics wikipedia , lookup
Polymorphism (biology) wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Gene expression programming wikipedia , lookup
Genetics and archaeogenetics of South Asia wikipedia , lookup
Nutriepigenomics wikipedia , lookup
Genetic drift wikipedia , lookup
Genetic testing wikipedia , lookup
Medical genetics wikipedia , lookup
Behavioural genetics wikipedia , lookup
Designer baby wikipedia , lookup
Genetic engineering wikipedia , lookup
History of genetic engineering wikipedia , lookup
Heritability of IQ wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Genome (book) wikipedia , lookup
Population genetics wikipedia , lookup
Public health genomics wikipedia , lookup
Utilizing Genomics in genetic improvement Molecular genetics as a tool in wildlife breeding, management and conservation (An African Buffalo case study) Ben Greyling ARC-API, Irene Menu Role of Mol. Gen. in wildlife management/conservation/breeding The ABC of DNA The African buffalo: A case study Genomics: Where do we stand? The Cattle model: from genetic variation, to marker assisted selection to quantitative variation Cape buffalo – recent developments Primary objective of conservation and management To protect diversity, ensure sustainable use of the resource Driving forces: need to qualify and quantify Role of Mol tools: Supply baseline info Levels of genetic variation, inbreeding Pop structure – genetic distances/assignment? Gene flow between populations? Effective population size vs. census size Admixture (Genomics..) Relationship between variation and fitness/adaptation Gene regulation/expression under environmental control More applications… Forensics and traceability: Individual ID Parentage verification (selection and management tool) Hybrid identification Genomics: Quantitative variation – from genotype to phenotype Epigenetics: Environments effect on genes - heritable trait expression.. …AACGTGTTGACGCCGTAATGCATAAT CTHISWILLEVENTUALLYDRIVEYOUC RAZYCGCTAGCCTTCGGCAATC... The value of Mol Gen tools: Making sense of “useless information” 3000 000 000 letters per cell… T Point mutation (SNP) A A C G C T T T G C G A insertion T A deletion G C A T C T A G A T G C C T C G A A G T African buffalo: A major role player in our ecosystems/metapopulation Largest populations confined to conservancies Model species with regard to pop. dynamics - factors affecting it Genetic variation, structure, gene flow, disease status, etc. Contributed immensely to conservation and management strategies Case studies: Population structure KNP vs. HiP 99% accurate assignment of individuals to pops due to genetic distance Distribution of the Log likelihood of assignment for KNP and HiP 40 Log likelihood of assignment to HiP 35 30 25 20 15 10 5 0 0 5 10 HiP KNP 15 20 25 Log likelihood of assignment to KNP 30 35 40 Case studies: Genetic variation Periods of low Ne for some populations in SA: ?? sustainability of genetic variation ?? compromised adaptation in response to changing environment? Example: Genetic erosion in HiP: 1% per year East vs. southern African subpopulations? Little genetic differentiation East/southern African population a separate management unit, differ substantially from central/west African lineage Substantial variation in both sub-populations Gene expression/regulation: The Y-Chromosome Its raining men Environment and body condition: switch on/switch off… Sex ratio distorted: more males in the wet season Particular genotypes dominate depending on environment (season) – affect sex ratio Sex ratio and BTB-link? Heterozygote-fitness-correlation (HFC) Low genetic variation = low body condition – affect genes on the “Y” Bad genes expressed in southern KNP, link to BTB, what the Y is going on?…. Females can also affect sex ratio… Epigenetic factors? BTB susceptibility may have an epigenetic link – heritable.. Ranches: management-scenario’s Small populations, restricted gene flow Controlled breeding (non-random mating) Fragmented populations and “lines” Breeding and selection among “lines”, e.g. Addo-Lowveld Preference for market-desired phenotypes Potential consequences of ranching Reduction in genetic variation (inbreeding?) Increase in frequency of deleterious alleles Loss of adaptive genes/fitness disease resistance, reproduction, growth etc. Reduction in effective pop size – sustainability of variation? Admixture – potential outbreeding depression Compromised adaptability Genomics to the rescue: Linking the DNA code to performance and phenotype (amongst others…) SNP vs. full genome sequences – from a good amount of info to a desired amount of info Powerful tools to address needs of wildlife industry Substantially applied to livestock Quantitative genetics: Selection tool for superior genetics Fast track genetic improvement Genomics for buffalo? 3K SNP panel already developed identified using next generation sequencing technology Projects in pipeline using the 3K panel = more powerful approach Buffalo and quantitative genetics: Breeding values on the horizon? Scope for genomic breeding values… Requirements for Genomics: Accurate pedigrees Phenotypic records Reference populations DNA (SNP) profiles Test populations The future is now with this technology Are we ready to adopt?