* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Transcription & Protein Synthesis
Metalloprotein wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Non-coding DNA wikipedia , lookup
RNA silencing wikipedia , lookup
Polyadenylation wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Proteolysis wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Point mutation wikipedia , lookup
Messenger RNA wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Biochemistry wikipedia , lookup
Gene expression wikipedia , lookup
Epitranscriptome wikipedia , lookup
Transcription, Translation & Protein Synthesis Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Do you remember what proteins are made of ? Hundreds of Amino Acids link together to make one Protein There are 20 types of amino acids, some we can make, and some we can’t There are infinite combinations of amino acids Can be hundreds or thousands monomers Long These long chains are called polypeptide chains Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Protein Synthesis Protein synthesis is the process in which a cell makes protein based on the message contained within its DNA. However: – DNA is only found in the nucleus – Proteins are only made outside the nucleus – in the cytoplasm. Houston, we have a problem. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Protein Synthesis How do the many different messages within the DNA molecule get to the many ribosomes outside the nucleus? A molecular cousin of DNA – RNA – is used to carry these messages. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Ribonucleic Acids (RNA) The job of RNA (ribonucleic acid) is to carry messages from the DNA (in the nucleus) to the ribosomes (in the cytoplasm). There are three types of RNA: 1. mRNA – carries a message from the DNA to the cytoplasm 2. tRNA – transports amino acids to the mRNA to make a protein 3. rRNA – make up ribosomes, which make protein. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Ribonucleic Acids (RNA) RNA is almost exactly like DNA, except: – Contains a ribose sugar, instead of a deoxyribose sugar (hence the name…) – Contains uracil instead of thymine. – RNA is single-stranded, not double-stranded (usually…) Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Ribonucleic Acids (RNA) Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Protein Synthesis Occurs in TWO steps: 1. Transcription – the genetic information from a strand of DNA is copied into a strand of mRNA 2. Translation – the mRNA, with the help of the ribosome, forms a chain of amino acids (eventually forming a protein) based on the information contained on the mRNA. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL The Central Dogma This order of events is called the central dogma of molecular biology: DNA Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL RNA P R O T E I N Step One: Transcription 1. 2. 3. DNA unzips: enzymes split apart base pairs and unwind the DNA double helix. Bases pair up: Free nucleotides in the cell find their complementary bases along the new strands with the help of RNA polymerase. What will be different?? New backbone formed: The sugar-phosphate backbone is assembled to complete the RNA strand, and separates from the DNA strand. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step One: Transcription Watch this simplified animation: http://www.stolaf.edu/people/giannini/flashani mat/molgenetics/transcription.swf Watch the more complex animation! http://www- class.unl.edu/biochem/gp2/m_biology/anim ation/gene/gene_a2.html Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step One: Transcription Try it! What RNA strand will be made from the following DNA sequence? TACGCATGACTAGCAAGTCTAACT AUGCGUACUGAUCGUUCAGAUUGA Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step 1½: RNA Editing An mRNA molecule has to be “edited” in order to be useful. There’s a lot of unnecessary information that needs to be removed. An mRNA sequence that does NOT code for protein is called an interon. A sequence that is useful in making a protein is called an exon. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step 1½: RNA Editing DNA transcription pre-RNA (in nucleus) exon 1 interon RNA editing exon 2 interon interon interon RNA (in cytoplasm) exon 1 Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL exon 2 exon 3 exon 3 Step Two: Translation “to decode or decipher the meaning of” Now that our mRNA molecule has been made, it’s time for its message to be made into a protein sequence. How does the mRNA sequence translate into an amino acid sequence? Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation Problem: – There are 20 different amino acids. – There are 4 RNA bases. A T C G phe ile leu val met Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL pro ser ala thr his tyr asn gln asp lys cys glu arg trp gly Step Two: Translation Watch this simplified animation: http://www.stolaf.edu/people/giannini/flashani mat/molgenetics/translation.swf Watch the more complex animation! http://www- class.unl.edu/biochem/gp2/m_biology/anim ation/gene/gene_a3.html Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation 1. So how do you exactly go about determining what protein your cells are going to make? 2. FIRST, Divide the mRNA sequence into codons. As you just saw and heard, codons are three-base sections of mRNA: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA ? Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL The Genetic Code Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met ? Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL The Genetic Code Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met arg Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL thr asp arg ser asp ??? The Genetic Code Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL Step Two: Translation 2. Since each 3-letter combination “codes” for an amino acid, you need to figure out what amino acid matches up with each codon: AUG|CGU|ACU|GAU|CGU|UCA|GAU|UGA met met Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL thr asp arg ser asp STOP RECAP: 1. 2. 3. DNA is transcribed into mRNA in the nucleus. The mRNA leaves the nucleus and enters the cytoplasm. The protein is translated from the mRNA sequence using tRNA and amino acids. Mr. Armfield – Level II Biology 1,2 Science Department Deerfield High School, Deerfield IL