Download RNA notes 2015 - OG

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

Mutation wikipedia , lookup

Bottromycin wikipedia , lookup

Protein wikipedia , lookup

RNA polymerase II holoenzyme wikipedia , lookup

Cell-penetrating peptide wikipedia , lookup

Eukaryotic transcription wikipedia , lookup

RNA silencing wikipedia , lookup

Community fingerprinting wikipedia , lookup

Gel electrophoresis of nucleic acids wikipedia , lookup

Polyadenylation wikipedia , lookup

Molecular cloning wikipedia , lookup

Replisome wikipedia , lookup

Transcriptional regulation wikipedia , lookup

RNA-Seq wikipedia , lookup

List of types of proteins wikipedia , lookup

Non-coding DNA wikipedia , lookup

Cre-Lox recombination wikipedia , lookup

Vectors in gene therapy wikipedia , lookup

RNA wikipedia , lookup

Silencer (genetics) wikipedia , lookup

Molecular evolution wikipedia , lookup

Biochemistry wikipedia , lookup

Non-coding RNA wikipedia , lookup

Artificial gene synthesis wikipedia , lookup

Messenger RNA wikipedia , lookup

Gene expression wikipedia , lookup

Ribosome wikipedia , lookup

Expanded genetic code wikipedia , lookup

Deoxyribozyme wikipedia , lookup

Genetic code wikipedia , lookup

Nucleic acid analogue wikipedia , lookup

Epitranscriptome wikipedia , lookup

Transcript
AMINO ACID
tRNA
ANTICODON 
CODON 
mRNA
Protein Examples
Hemoglobin is a protein in your blood
that transports oxygen
Collagen is a proteins that makes your
cartilage and tendons
Keratin is a protein that makes
up your hair & fingernails
Enzymes that break down your food are proteins
Everything in you is made of or
by proteins!
DNA is like a code that instructs the cell to
make proteins
A gene is a sequence of DNA that carries the
code for making one protein
RNA is like DNA except…
DNA – Deoxyribonucleic
acid
RNA – Ribonucleic Acid
* 2 strands vs. 1 strand
Nitrogen
Bases
* Thymine vs. Uracil
(others are the same)
Sugars
&
Phosphates
* Deoxyribose vs. Ribose
* Nucleus vs. Cytoplasm
RNA
DNA
Types of RNA
1. mRNA – “messenger” RNA
- Carries copies of instructions from DNA for
making amino acids into proteins
2. tRNA – “transfer” RNA
- Transfers each amino acid to the ribosome as
specified by the code on mRNA
3. rRNA – “ribosomal” RNA
- Makes up part of the ribosome, where
proteins are made
•
Both DNA and RNA are involved in
protein synthesis
2 parts of protein synthesis:
1. Transcription – DNA is converted to RNA
-
Occurs in the nucleus
2. Translation – RNA is converted to a
protein
-
Occurs in the cytoplasm
• Transcription (the 1st part of
Protein Synthesis)
• Converts DNA to RNA
• DNA (in the nucleus) needs to
send a code to the ribosome (in
the cytoplasm)
• Problem: DNA can’t fit through
the nuclear pores
• A special “messenger” is
used to copy and carry the
code…
Transcription Cont’d
• messenger RNA (mRNA) goes
into the nucleus and copies the DNA
• Uses enzyme – RNA Polymerase
• DNA
AGGTATCGCAGATCGACAGATC
•RNA
UCCAUAGCGUCUAGCUGUCUAG
• The next step is that mRNA moves
from the nucleus to the cytoplasm
and to the ribosome
nd
(2
Translation
part of protein
synthesis)
• Amino acids – building blocks of proteins,
carried to ribosomes by ______________
tRNA
Amino Acids
• Polypeptides – long chains of ____________
3 nucleotide bases in mRNA which
• Codon – group of ____
carries code for making _______________________
ONE amino acid
• Ex:
AUG - Methionine
3
• Anticodon – group of _____
nucleotide bases in tRNA
codon
which is complementary to one ___________________
Translation Cont’d
• mRNA
____________ attaches to the ribosome
• tRNA
____________ carries amino acids to the
ribosome and matches them to the coded
mRNA message (codon)
• Amino acids bond together, forming a long
Polypeptide chain
chain called a ____________________
• Finally, polypeptides fold into various
types of proteins and there you have it!
Translation (the 2nd part of Protein Synthesis)
• Translation – a process that converts mRNA into a protein
• Occurs on the ribosome in the cytoplasm of a cell
• ______________
- building blocks of proteins; join together
Amino acids
into long chains called polypeptides
Codon
• ____________
- a sequence of 3 bases on mRNA that codes
for a single amino acid
Anticodon
• _____________
– sequence of 3 bases on tRNA that is
complementary to one mRNA codon
“UCU” is the
codon that makes
an amino acid
called SERINE
• Another form of RNA called
transfer RNA (tRNA) carries
amino acids to the ribosome
and matches them to the
coded mRNA message
•The tRNA lines up with 3
bases in mRNA (codon)
•tRNA anticodon GAA
•mRNA codon CUU
•tRNA drops off the amino acid in the correct spot
mRNA attaches to the ribosome
AMINO ACID
tRNA
ANTICODON 
CODON 
mRNA
Any change in the DNA structure (specifically the order
of nitrogen bases) is a mutation.
Mutations can be helpful, harmful, or neutral.
Helpful – can create diversity in a population
Harmful – can cause things like cancer
Neutral – can have absolutely no effect
at all
A mutagen is something that causes
mutations in the DNA (for example:
smoking, radiation from the sun etc)
Slooze Worm
An insertion mutation is when a nitrogen base is added to the existing DNA
A deletion mutation is when a nitrogen base is subtracted from the DNA
A substitution mutation is when one nitrogen base is put in place of another.
If our DNA was AATTGGCC
An insertion would be AATTAGGCC
A deletion would be AATGGCC
A substitution would be AAATGGCC
Gene Sequencing – Determining the order of nucleotide bases within a gene
DNA Fingerprinting – technique used in criminal investigations. DNA
Fingerprinting takes the DNA out of a cell and separates it. This will allow
investigators to distinguish body cells of different individuals (since they
are unlikely to have the same DNA)
Cloning – take the DNA out of one of your cells then take the DNA out of a
zygote (fertilized egg). Put the DNA from your cell into the zygote.
Genetic engineering is the
process of moving genes
from the chromosomes of
one organism to those of
another organism.
Recombinant DNA is
formed by joining DNA
molecules.from two
different organisms
What would represent the strand of DNA from which the mRNA strand in the
diagram was made?
A.CUCAAGUGCUUCB.GAGUUCACGAAG
C.GAGTTCACGAAGD.AGACCTGTAGGA
What is the amino acid sequence in the portion of the protein molecule coded
for by the piece of mRNA shown in the diagram?
A. Ser-Tyr-Arg-GlyB.Leu-Lys-Cys-PheC.Val-Asp-Pro-HisD.Pro-GluLeu-Val