* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download 17GeneToProtein
Gene expression profiling wikipedia , lookup
Molecular cloning wikipedia , lookup
RNA interference wikipedia , lookup
RNA silencing wikipedia , lookup
Community fingerprinting wikipedia , lookup
Biochemistry wikipedia , lookup
Gene regulatory network wikipedia , lookup
Synthetic biology wikipedia , lookup
List of types of proteins wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Expanded genetic code wikipedia , lookup
Non-coding DNA wikipedia , lookup
Polyadenylation wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Molecular evolution wikipedia , lookup
Genetic code wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
RNA polymerase II holoenzyme wikipedia , lookup
Point mutation wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Non-coding RNA wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Messenger RNA wikipedia , lookup
Ch. 17:From Gene to Protein How Genes Work AP Biology 2007-2008 What do genes code for? How does DNA code for cells & bodies? how are cells and bodies made from the instructions in DNA DNA AP Biology proteins cells bodies The “Central Dogma” Flow of genetic information in a cell How do we move information from DNA to proteins? DNA replication AP Biology RNA protein DNA gets all the glory, but proteins do all the work! trait Metabolism taught us about genes Inheritance of metabolic diseases suggested that genes coded for enzymes each disease (phenotype) is caused by non-functional gene product lack of an enzyme Tay sachs PKU (phenylketonuria) albinism metabolic pathway A AP Biology enzyme 1 Am I just the sum of my proteins? disease disease disease disease B C D E enzyme 2 enzyme 3 enzyme 4 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum AP Biology "for their discovery that genes act by regulating definite chemical events" Figure 17.2 RESULTS EXPERIMENT Growth: Wild-type cells growing and dividing Classes of Neurospora crassa No growth: Mutant cells cannot grow and divide Wild type Minimal medium (MM) (control) Minimal medium Does one gene Control one trait? CONCLUSION Condition MM ornithine Beadle & Tatum X MM citrulline X MM arginine (control) Summary of results Gene (codes for enzyme) X Can grow with or without any supplements Wild type Must be supplied Must be supplied ornithine, Must be supplied citrulline or citrulline, or arginine arginine arginine to grow Class I mutants (mutation in gene A) Class II mutants Class III mutants (mutation in (mutation in gene B) gene C) Precursor Precursor Precursor Precursor Enzyme A Enzyme A Enzyme A Enzyme A Ornithine Ornithine Ornithine Ornithine Gene B Enzyme B Enzyme B Enzyme B Enzyme B Citrulline Citrulline Citrulline Citrulline Gene C Enzyme C Enzyme C Enzyme C Enzyme C Gene A AP Biology Class I mutants Class II mutants Class III mutants Arginine Arginine Arginine Arginine a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome trait AP Biology Transcription from DNA nucleic acid language to RNA nucleic acid language AP Biology 2007-2008 RNA ribose sugar N-bases uracil instead of thymine U : A C : G single stranded lots of RNAs DNA AP Biology mRNA, tRNA, rRNA, siRNA… transcription RNA Transcription Making mRNA transcribed DNA strand = template strand untranscribed DNA strand = coding strand synthesis of complementary RNA strand same sequence as RNA transcription bubble enzyme RNA polymerase 5 C DNA G 3 A G T A T C T A build RNA 53 G A G C A T C G T A C T 3 G C A U C G U C G T A G C A T T A C A G C T G A T A T 3 5 unwinding rewinding mRNA AP Biology coding strand 5 RNA polymerase template strand RNA polymerases 3 RNA polymerase enzymes RNA polymerase 1 RNA polymerase 2 AP Biology transcribes genes into mRNA RNA polymerase 3 only transcribes rRNA genes makes ribosomes only transcribes tRNA genes each has a specific promoter sequence it recognizes Which gene is read? Promoter region binding site before beginning of gene TATA box binding site binding site for RNA polymerase & transcription factors Enhancer region binding site far upstream of gene turns transcription on HIGH AP Biology Transcription Factors Initiation complex transcription factors bind to promoter region AP Biology suite of proteins which bind to DNA hormones? turn on or off transcription trigger the binding of RNA polymerase to DNA Matching bases of DNA & RNA Match RNA bases to DNA bases on one of the DNA strands A G C A G G U U C A AG U C G A U A C 5' RNA A C C polymerase G A U 3' T G G T A C A G C T A G T C A T CG T A C CG T AP Biology U C Eukaryotic genes have junk! Eukaryotic genes are not continuous exons = the real gene expressed / coding DNA introns come out! introns = the junk inbetween sequence intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology mRNA splicing Post-transcriptional processing eukaryotic mRNA needs work after transcription primary transcript = pre-mRNA mRNA splicing edit out introns make mature mRNA transcript intron = noncoding (inbetween) sequence ~10,000 bases eukaryotic DNA exon = coding (expressed) sequence pre-mRNA primary mRNA transcript mature mRNA transcript AP Biology ~1,000 bases spliced mRNA Discovery of exons/introns Richard Roberts CSHL Philip Sharp MIT beta-thalassemia AP Biology 1977 | 1993 adenovirus common cold Sequence must be accurate No room for mistakes! Oops! This trait Won’t be expressed! a single base added or lost throws off the reading frame AUG-CGU-UCU-GAU-AAA-GGU-CAC-… AUG-CGG-UCC-GAC-AAG-GGC-CAU-… AUG-CGC-UCA-GAU-AAG-GGG-CAC-… Met-Arg-Ser-Asp-Lys-Gly-His-… AUG-CGU-GUC-(U-GA)(U-AA)(A-GG)(U-CA)(C-… Met – Arg- AP Biology Val- STOP RNA splicing enzymes snRNPs Whoa! I think we just broke a biological “rule”! small nuclear RNA exon proteins Spliceosome exon 3' spliceosome 5' 3' cut & paste gene No, not smurfs! “snurps” mature mRNA AP Biology intron 5' several snRNPs recognize splice site sequence snRNPs snRNA lariat 5' exon 5' 3' exon 3' excised intron Alternative splicing Alternative mRNAs produced from same gene when is an intron not an intron… different segments treated as exons different traits from one mRNA One gene can code for more than one trait? So, it’s not just junk DNA! AP Biology The Transcriptional unit (gene or genes?) enhancer 1000+b 20-30b 3' RNA TATA polymerase translation start TAC translation stop exons transcriptional unit (gene) 5' DNA ACT DNA UTR promoter UTR introns transcription start transcription stop 5' pre-mRNA AP Biology 5' GTP mature mRNA 3' 3' AAAAAAAA More post-transcriptional processing Need to protect mRNA on its trip from nucleus to cytoplasm enzymes in cytoplasm attack mRNA protect the ends of the molecule add 5 GTP cap So, these enzymes add poly-A aretail like a dog…give it a longer tail, mRNA produces more protein bone tolasts chewlonger: on http://vcell.ndsu.edu/ani mations/transcription/m ovie-flash.htm so it doesn’t chew your shoes! 3' mRNA 5' AP Biology P G P P A a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome trait AP Biology mRNA Transcription in real time. http://www.youtube.com/watch?v=5MfSYnItYvg The Central Dogma http://www.youtube.com/watch?v=J3HVVi2k2No AP Biology Translation from nucleic acid language to amino acid language AP Biology 2007-2008 How does mRNA code for proteins? DNA TACGCACATTTACGTACGCGG 4 ATCG mRNA 4 AUCG protein AUGCGUGUAAAUGCAUGCGCC ? Met Arg Val Asn Ala Cys Ala 20 How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? AP Biology mRNA codes for proteins in triplets DNA TAC-GCA-CAT-TTA-CGT-ACG-CGG codon mRNA AUG-CGU-GUA-AAU-GCA-UGC-GCC protein Met-Arg–Val–Asn-Ala-Cys-Ala AP Biology Cracking the code 1960 | 1968 Nirenberg & Khorana Crick determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT Nirenberg (47) & Khorana (17) determined mRNA–amino acid match added fabricated mRNA to test tube of ribosomes, tRNA & amino acids AP Biology created artificial UUUUU… mRNA found that UUU coded for phenylalanine Marshall Nirenberg 1960 | 1968 Har Khorana AP Biology The code Code for ALL life! strongest support for a common origin for all life Code is redundant several codons for each amino acid 3rd base “wobble” Why is the wobble good? Start codon AP Biology AUG methionine Stop codons UGA, UAA, UAG a a From gene to protein nucleus cytoplasm transcription DNA a a translation mRNA a a a a a a a a a a a protein a a a a a a a ribosome aa trait AP Biology Transfer RNA structure “Clover leaf” structure anticodon on “clover leaf” end amino acid attached on 3 end AP Biology Loading tRNA Oooh! Dehydration Synthesis again! Aminoacyl tRNA synthetase enzyme which bonds amino acid to tRNA bond requires energy ATP AMP bond is unstable so it can release amino acid at ribosome easily Trp C=O OH OH Trp C=O O Trp H2O O activating enzyme tRNATrp anticodon AP Biology tryptophan attached to tRNATrp AC C UGG mRNA tRNATrp binds to UGG condon of mRNA Ribosomes Facilitate coupling of tRNA anticodon to mRNA codon organelle or enzyme? Structure ribosomal RNA (rRNA) & proteins 2 subunits AP Biology large small E P A Ribosomes A site (aminoacyl-tRNA site) P site (peptidyl-tRNA site) holds tRNA carrying next amino acid to be added to chain holds tRNA carrying growing polypeptide chain Met E site (exit site) AP Biology empty tRNA leaves ribosome from exit site U A C A U G 5' E P A 3' Building a polypeptide Initiation Elongation brings together mRNA, ribosome subunits, initiator tRNA adding amino acids based on codon sequence Termination 3 2 1 end codon Leu Val Met Met Met Met Leu Ala Leu Leu release factor Ser Trp tRNA U AC 5' C UGAA U mRNA A U G 3' E P A AP Biology 5' UAC GAC A U G C U GA A U 5' 3' U A C GA C A U G C U G AAU 5' 3' U A C G A C AA U AU G C U G 3' A CC U GG U A A 3' How are the codons matched to amino acids? 3 DNA 5 mRNA amino acid tRNA anticodon mRNA codon AP Biology 5 TAC-GCA-CAT-TTA-CGT-ACG-CGG AUG-CGU-GUA-AAU-GCA-UGC-GCC Met UAC “Anti” means “against”, so the anticodon must go “against” its complementary mRNA codon. So easy, a bird-brain like me can get it! AUG http://vimeo.com/6812276 3 Destinations: Protein targeting Signal peptide address label start of a secretory pathway AP Biology secretion nucleus mitochondria chloroplasts cell membrane cytoplasm etc… RNA polymerase DNA Can you tell the story? amino acids exon intron tRNA pre-mRNA http://www.biost udio.com/demo_ freeman_protein _synthesis.htm 5' GTP cap mature mRNA poly-A tail large ribosomal subunit http://www.youtube .com/watch?v=NJx obgkPEAo polypeptide 5' small ribosomal subunit AP Biology aminoacyl tRNA synthetase tRNA E P A ribosome 3' The Central Dogma http://www.youtube.com/watch?v=J3HVVi2k2No AP Biology Bacterial chromosome Protein Synthesis in Prokaryotes Transcription mRNA Psssst… no nucleus! Cell membrane Cell wall AP Biology 2007-2008 Prokaryote vs. Eukaryote genes Prokaryotes Eukaryotes DNA in cytoplasm circular chromosome naked DNA no introns DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons introns come out! intron = noncoding (inbetween) sequence eukaryotic DNA exon = coding (expressed) sequence AP Biology Translation in Prokaryotes Transcription & translation are simultaneous in bacteria DNA is in cytoplasm no mRNA editing ribosomes read mRNA as it is being transcribed AP Biology Translation: prokaryotes vs. eukaryotes Differences between prokaryotes & eukaryotes time & physical separation between processes takes eukaryote ~1 hour from DNA to protein no RNA processing AP Biology Any Questions?? What color would a smurf turn if he held his breath? AP Biology 2007-2008