* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download Genom
Gene expression wikipedia , lookup
Gene expression profiling wikipedia , lookup
Genomic imprinting wikipedia , lookup
Histone acetylation and deacetylation wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Genetic code wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Molecular cloning wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Community fingerprinting wikipedia , lookup
DNA supercoil wikipedia , lookup
Genome evolution wikipedia , lookup
Point mutation wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Non-coding DNA wikipedia , lookup
Genes, genomes Seminar of molecular and cell biology Mgr. M. Jelínek [email protected] Plan of seminary: • The contain of the lesson • Some views into world of genes • Tasks and then my questions 1) Chemical principles of genes 2) Genes in a cell 3) Genes as a fundamental resourse of informations 4) Genomic as a science http://www.biologyj unction.com/nucleo tide_model_preap. htm 1) Chemical principles of genes Fosfoester bound • The elementary unit of DNA is nucleotide • Nucleotide consists of phosphate and nucleoside • Nucleoside consists of nitrogen-containing base and sugar – ribose or deoxyribose N - Glycosidic bond Thymidine nucleoside Bases and sugars Purins Carbon 5...to phosphate Carbon 7 Pyrimidins Carbon 1...to base Carbon 3...to phosphate Carbon 1 The other functions of nucleotides Energy carriers, chemical groups carriers Specific regulators http://academic.brookl yn.cuny.edu/biology/b io4fv/page/molecular %20biology/dnastructure.html Connection of nucleotides • DNA chain is made of nucleotides connected to each other Nucleid acid are polymers of nucleotids. Double-stranded DNA containing deoxyribose can have several conformations A - DNA BDNA Z - DNA RNA can contain various modificated bases Uracil (Why not in DNA ???) Dihydrouridin Pseudouridin RNA : can have (3D) conformation: the intramolecular base-pairing (one nucleotide can bind two other nucleotides by hydrogen bounds) is a reason for that (A-U, G-C) 10 Modifications of DNA • The methylation of cytosin • GpC islands, in promotores, in non-coding regions • They are involved in the gene imprinting and condenzation of X chromozom Genetic vs epigenetic information and heredity 12 2) Genes in cell - DNA • DNA is mostly situated in nucleus • DNA is in mitochondia, chloroplasts and other semiautonomic organeles • Plasmid DNA • Some external DNA The elementary structural unit of DNA is nucleosome Histons: H2A, H2B, H3, H4 are present in nucleosome core (each twice). This protein octamer - scaffold and DNA altogether form nucleosome The lenght of DNA from one nucleosome to another is 200 bp cca 150 bases pairs is wounded around nucleosome Composition of nucleosome Histons are very conservative proteins containing so call histon fold and long N-ends. Octamer of histons composes from tetramers H3/H4 and two dimers H2A/B 15 Nucleosome is dynamic structure Dynamic of nucleosome condensing and releasing is regulated by other proteins Other various types of histones can be found in some specific nucleosomes and sequences Higher level of chromatin organisation – „solenoid“ Nucleosomes are bound together by H1 activity and activity of N- ends, e.g. H4 free ends Nucleosome beads on DNA wire Very important step in condensation to 30 nm fiber - solenoid This DNA is not expressed 10 000 fold condensated DNA form mitotic... ...chromosome Stick structure is in next step condensated by group of proteins - condensins Important sequences in chromosome Telomere Centromere Origin of replication Condensation of chromosome is tighly associated to its function Modification of chromatin Chromatin remodeling complexes Modification of histons: acetylation, methylation, fosphorylation 21 Histon code Modificated histons are bound to other types proteins - system readers and writers Histon code is second level of genome information realization, genetic code is the first level Pozition effect: genes placed to the heterochromatin region become silent – they are not expressed Modification of DNA and histones are associated in epi-genetic regulation of gene expression If the genetic or epi-genetic information is changed, it can lead to cancer transformation (mutation in somatic cell) or to transmiting of genetic disease ( mutation in germ cell) Histone modifications can be transimited to next generations of cells as well as across the genome 3) Genes are basic source of informations • There are nearly all information that is cell realized by • It is carried through generation • It must be changeable but not too much • Rest of informations is in the histones (histones modification and histone code) • Genom is complete set of DNA (and thus information ) Genofore: it carries gene information Genes • Sequences in nucleid acid • Eukaryotic and prokaryotic genes differs in many features (monocistrony, introns) • Regulation genes - promotors, enhancers • Repetitive sequences: are used for identification • Mobil elementes (transposons): spread in genom • Pseudogenes Gene locus Seqences in DNA: • Coding aminoacids – proteins (mRNA) • Coding RNA as a final product Sekvences in DNA II: Mobile elementes They do not spread in genome absolutly free, they can damage genome if divide too intensively. Useful genes can be multipled and transfered by transposones. Genetical code tripletive, universal, redundant Three bases code one amino acid = triplet = codon 20 coded amino acids Some aminoacids can be encoded by one codon (methionine, tryptophan) some by six codons (leucine, serine, arginine). 4 bases (A, G, C, T) → 64 (43) combination of triplets (codons) initiation codon is codone for methionin too 3 triplets function as stop codons 3 possibilities of reading of the sequence of triplets: reading frames 29 Genomic Task 1 Tyrosine - Y Tryptofan - W Glutamine - Q Arginine - R Asparagine - N Lysine - K Aspartic acid - D Glutamic acid - E AGUGAAAUGAUUAAUGCAAGGUGAGGGGAGAACGAGUGAUAA Task 2 To find nucleotide sequence on web sites A) What is the sequence? B) Which sequences are relative to it?