* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download The human genome of is found where in the human body?
DNA sequencing wikipedia , lookup
Eukaryotic transcription wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Genetic code wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Gene expression wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Community fingerprinting wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
DNA vaccination wikipedia , lookup
Molecular evolution wikipedia , lookup
Point mutation wikipedia , lookup
Molecular cloning wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Biosynthesis wikipedia , lookup
Non-coding DNA wikipedia , lookup
DNA supercoil wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
The human genome of is found where in the human body? • • • • Nucleus Ribosome Smooth ER Cell membrane The cellular structure where proteins are made is called the • • • • Nucleus Smooth ER Ribosome Cell membrane DNA and Biotechnology Announcements • Circulation lab: Due Today! • Homework Assignment #2: Due Wednesday! • Textbook Reading: – Chapter 21: Pgs 449-461 – Chapter 19: Pgs 406-412 • Online work: Chapter 21- Due Wednesday! Lecture Outline • DNA- Structure, function, and importance • How DNA works – The central dogma – Transcription and Translation – The DNA code – DNA replication • PCR- Function, usefulness, how it works • PCR Lab The importance of DNA The DNA double helix is the code of life • The blueprint for all structures in your body which are made of protein • DNA is comprised of nucleotides Nulceotides are the monomers of nucleic acid polymers • Consist of a sugar, a phosphate, and a nitrogen-containing base • Sugar can be deoxygenated • Bases contain the genetic information There are 4 kinds of DNA bases Adenine always matches with Thymine, Cytosine always matches with GuanineHydrogen bonds hold bases together Living things are extremely complex • Cellular machinery is sophisticated and required for life • Cellular machinery is made largely of proteins • Blueprints for all cellular machinery are contained in genes • Genes are inherited from parents • Humans have ~30,000 genes Proteins give living things the variety of their structures Protein variety is generated by 1o structure- the sequence of amino acids which make the protein Amino Acids • Proteins consist of subunits called amino acids Figure 2.12 How DNA works • Replication • Transcription • Translation The sequence of DNA bases is the code for the primary structure of proteins All cells require a copy of the genome • • • • Genome- all the genes of the cell Human genome is made of DNA DNA is similar in all cells Gene- 1 DNA Molecule (+ proteins the genetic information to produce a single product (protein) • DNA replication copies all cellular DNA Replication of DNA Figure 21.2 In vivo, enzymes such as DNA polymerase make DNA replication happen The DNA code Computers use binary digital code 01000011 01101000 01100001 = A 01100101 01100101 01100010 =B 01110011 01100101 01000011 =c 01100010 01110101 01110010 01100111 00100111 = apostrophe 01100101 01110010 Etc. 00100000 01000100 01100101 01101100 • http://www.geek01110101 01111000 notes.com/tools/17/tex 01100101 = t-to-binary-translator/ cheeseburger deluxe • • • • • How does the DNA code work? • atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaa gttcgtatggaaggttccgttaacggtcacgagttcgaaatcga aggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgct aaactgaaagttaccaaaggtggtccgctgccgttcgcttggga catcctgtccccgcagttccagtacggttccaaagcttacgttaa acacccggctgacatcccggactacctgaaactgtccttcccgg aaggtttcaaatgggaacgtgttatgaacttcgaagacggtggt gttgttaccgttacccaggactcctccctgcaagacggtgagttc =GFP The DNA code is (nearly) universal It uses groups of 3 bases (codon) 3 bases = 1 codon = 1 amino acid And what are these U’s for? RNA is ribonucleic acid • Ribose sugar is not deoxygenated • RNA is singlestranded • RNA has Uracil, not Thymine • There are many kinds: mRNA, rRNA, tRNA, siRNA, etc. RNA can fold back on itself • Single strand offers greater flexibility Kinds of RNA mRNA tRNA The Central Dogma of Molecular Biology • DNA RNA Protein • DNARNA : Transcription • RNA Protein: Translation DNA RNA Protein Trait The Universality of the DNA code makes this possible Firefly gene (Luciferase) in a tobacco plant Transcription and Translation Transcription: DNA RNA DNA Codes for RNA, Which Codes for Protein Figure 21.3 DNA information is transcribed into mRNA Note in DNA: sense strand vs. antisense strand Translation: RNA Protein tRNA’s carry an amino acid at one end, and have an anticodon at the other Amino acid attachment site: Binds to a specific amino acid. Amino acid (phenylalanine) Anticodon: Binds to codon on mRNA, following complementary base-pairing rules. Anticodon mRNA Figure 21.6 The ribosome matches tRNA’s to the mRNA, thereby linking amino acids in sequence tRNA’s add amino acids one by one according to mRNA instructions until the protein is complete In this way, the proteins in nature are virtually limitless Proteins are incredibly diverse at the molecular level A few examples Insulin Rubisco ATP synthase Fibrin Nitrogenase Protein function depends greatly on shape In the DNA code, syntax is critical • • • • • • • THE RED DOG ATE THE BIG CAT THE RED DOT ATE THE BIG CAT THG ERE DDO GAT ETH EBI GCA THR EDD OGA TET HEB IGC AT THE RED DOG ATE THE BBI GCA T THE RED RED DOG ATE THE BIG CAT RED DOG ATE THE BIG CAT Damaged DNA (a mutation) causes damaged proteins Consequences of a single base substitution • Misshapen protein • Misshapen red blood cell • Clogged capillaries • Cellular damage • Resistance to malaria Because the DNA code is universal, genes can be moved from one living thing to another Cell with gene of interest Bacterium Step 1: Isolate DNA from two sources. Step 2: Cut both DNAs with the same restriction enzyme. Plasmid Source (donor) DNA Fragments of source DNA Step 3: When mixed, the DNAs recombine by base pairing. Figure 21.14 (1 of 2) PCR PCR can replicate DNA in vitro 1. dNTPs 2. Mg++ containing Buffer 3. Taq polymerase 4. Primers for your gene of interest 5. Thermal cycler 6. A gene (piece of DNA) you are interested in All together = DNA xerox machine! PCR can replicate DNA in vitro • Step 1- Melting – DNA denatures • Step 2- Annealing – Primers bind to complementary sequences • Step 3- Elongation – Taq DNA polymerase adds free nucleotides to strands • Cycle is complete, DNA has doubled • Process can begin again dNTPs • Individual DNA nucleotides • Four kinds- A, C, G, and T • They match up with template DNA Taq Polymerase • DNA polymerase isolated from Thermophilus aquaticus bacteria • Lives in hot springsheat resistant • Optimal Taq temp- 72C Primers • Single-stranded DNA sequences of 15-30 bp specific to gene of interest • One at the 5’ start, the other at the 3’ end of your gene Thermal Cycler • Melting point of DNA= ~94C • Annealing temp = 55C • Optimal Taq polymerase temp= 72C When one DNA molecule is copied to make two DNA molecules, the new DNA contains 1. 2. 3. 4. 5. A) 25% of the parent DNA. B) 50% of the parent DNA. C) 75% of the parent DNA. D) 100% of the parent DNA. E) none of the parent DNA. Importance of PCR With 6 billion base pairs in a human genome still means 6 million differences PCR can amplify DNA, a great help in forensics and diagnostics • Other uses: modifying genes, detecting genes • How it works: 1. High heat breaks H-bonds between base pairs 2. Primers bind to sequence of interest 3. Heat-tolerant Taq polymerase copies 4. Goto 1 5. Each round doubles the amount of DNA DNA is pretty stable, and ancient DNA can be studiedPCR allows amplification of a very small sample Whodunnit? Suspect 1 or 2? Genetic Engineering Figure 21.15 Genetic Engineering Double-stranded DNA sample Step 1: Double-stranded DNA is unzipped by gentle heating, forming single strands that serve as templates for new strands. Step 2: The templates are mixed with primers, nucleotides, and DNA polymerase. + Primer Step 3: The mixture is cooled to allow for base pairing. Figure 21.15 (1 of 2) Genetic Engineering Step 4: Complementary DNA strands form on each template strand. The amount of DNA is now doubled. Repeat procedure: The amount of DNA is doubled again. The procedure is repeated many times, doubling the amount of DNA with each round. Figure 21.15 (2 of 2) Different sequences of DNA are cut by different restriction enzymes • Sequences which are cut differently have different sized pieces • Electrophoresis can differentiate them in the same way Human DNA can differ in length at various sites DNA of different length is easily measured using gel electrophoresis