Download File - DNA Barcoding

Flora in our wetlands.
 Kamalpreet Kaur
 Shivanthi Opatha
 Mona Lau
 Jessica Jimenez
 Maria Panayi
 Alex Marshall
To collect and analyze DNA sequences from plants in
order to identify unknown species.
To determine whether DNA barcoding can be used
successfully by non-experts to identity plants species in
our local environment/park/wet lands and to determine
whether DNA barcoding could be used to identify plant
species and whether the plants are native to that
specific area.
 DNA barcodes are relatively short DNA or genomic
sequences taken from a standard position in the
genome. They are highly variable between different
species and allow for 99% Accurate identification of a
specimen.
 Karkarook Park is located on Warrigal Road in
Moorabbin close to Holmesglen.
 An artificial wetlands and lake created by extracting
sand between 1997 and 2001.
 Fishing is possible, with Redfin perch and rainbow
trout reported.
 The park was revegetated with native plants. As such
we expected to find mostly native plants growing in
the park.
 Samples of plant tissue are collected from new growth
parts of the plant such as new leaves to ensure the best
chance of extracting DNA.
 DNA is extracted from plant tissue
 DNA is run on an Agarose gel to ensure successful
extraction
 DNA is then amplifyed by PCR
PCRed DNA is sent to Micromon, Monash
University for Sequencing .
 CGACGGCCAGTATGTCACCACAAACAGAGACTAAAG
CAGGTGTTGGATTTCAAGCTGGTGTTAAAGATTATA
AATTGACTTACTAC..........
 The Sequence is then compared against an online
Database called blast and checked against a large
database.
 The Blast program gives a list of the most likely match




allowing u to identify the plant.
Sample 6:
Scientific Name: Holcus lanatus
Common Name: Yorkshire Fog or Velvet Grass
Info: Holcus lanatus commonly known as a Yorkshire
fog or Velvet Grass is a perennial grass. The specific
epithet lanatus is Latin for “woolly” which describes
the plant’s hairy texture. In part of northern Europe
the grass is a common native grass species and a hardy
pasture grass. Not native to Australia .
 Data was uploaded onto the Atlas of living Australia
web site. And can now be used as a refference for
future studys in the area.The Atlas is part of a
worldwide effort to Barcode all living organisms on
earth.
 From 13 samples we were able to get 4 plants species
DNA sequences during our DNA bar-coding project
 From our results we were able to identify 4 plants
species. They are Holcus Lanatus or Yorksire fog,
Juccus Effusus or Soft Rush , Plantago lamceolata or
Ribword plantain,and Medicago Truncatula or Barrel
clover.
 This shows DNA barcoding can be used successfuly to
identify plant species in Australia with a basic laborator by
non experts.
 Some of our samples were more difficult to extract DNA
from. In the future we would investigate alternative
methods of DNA extraction eg genomic DNA extraction
kits.
 One of our PCRs did not work due to a large amount of
protein in the sample. To avoid this in the future a phenol
chloroform extraction to denature the proteins can be used
and PCR repeated.
 All 4 of our samples were found to not be native to
Australia. Not as surprising as we first thought given
the difficulty of maintaining the wetlands in isolation
from the rest of the surround area. Such as paddocks
directly next to the park.
 Given that nonexperts can now positively identify
species it will be of great benefit to future conservation
work. As an accurate record of what plants are growing
in an area can be created and maintained by even a
small group of nonexperts.
 We can also determine if more invasive species are
taking hold of an rea and what they have replace.
 In conclusion: We achieved our aims to use DNA
barcoding and identify plants.
 We did not need any expert knowledge, and only a
basic laboratory set up. DNA sequencing was easy to
outsource.
 For future work more samples should be taken and
more DNA extracted. We can improve on 4 out of 13
samples yielding DNA!