* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Download File - DNA Barcoding
DNA sequencing wikipedia , lookup
Comparative genomic hybridization wikipedia , lookup
Maurice Wilkins wikipedia , lookup
Agarose gel electrophoresis wikipedia , lookup
Molecular evolution wikipedia , lookup
DNA vaccination wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Gel electrophoresis of nucleic acids wikipedia , lookup
Transformation (genetics) wikipedia , lookup
Molecular cloning wikipedia , lookup
Bisulfite sequencing wikipedia , lookup
Non-coding DNA wikipedia , lookup
Cre-Lox recombination wikipedia , lookup
DNA supercoil wikipedia , lookup
Community fingerprinting wikipedia , lookup
Flora in our wetlands. Kamalpreet Kaur Shivanthi Opatha Mona Lau Jessica Jimenez Maria Panayi Alex Marshall To collect and analyze DNA sequences from plants in order to identify unknown species. To determine whether DNA barcoding can be used successfully by non-experts to identity plants species in our local environment/park/wet lands and to determine whether DNA barcoding could be used to identify plant species and whether the plants are native to that specific area. DNA barcodes are relatively short DNA or genomic sequences taken from a standard position in the genome. They are highly variable between different species and allow for 99% Accurate identification of a specimen. Karkarook Park is located on Warrigal Road in Moorabbin close to Holmesglen. An artificial wetlands and lake created by extracting sand between 1997 and 2001. Fishing is possible, with Redfin perch and rainbow trout reported. The park was revegetated with native plants. As such we expected to find mostly native plants growing in the park. Samples of plant tissue are collected from new growth parts of the plant such as new leaves to ensure the best chance of extracting DNA. DNA is extracted from plant tissue DNA is run on an Agarose gel to ensure successful extraction DNA is then amplifyed by PCR PCRed DNA is sent to Micromon, Monash University for Sequencing . CGACGGCCAGTATGTCACCACAAACAGAGACTAAAG CAGGTGTTGGATTTCAAGCTGGTGTTAAAGATTATA AATTGACTTACTAC.......... The Sequence is then compared against an online Database called blast and checked against a large database. The Blast program gives a list of the most likely match allowing u to identify the plant. Sample 6: Scientific Name: Holcus lanatus Common Name: Yorkshire Fog or Velvet Grass Info: Holcus lanatus commonly known as a Yorkshire fog or Velvet Grass is a perennial grass. The specific epithet lanatus is Latin for “woolly” which describes the plant’s hairy texture. In part of northern Europe the grass is a common native grass species and a hardy pasture grass. Not native to Australia . Data was uploaded onto the Atlas of living Australia web site. And can now be used as a refference for future studys in the area.The Atlas is part of a worldwide effort to Barcode all living organisms on earth. From 13 samples we were able to get 4 plants species DNA sequences during our DNA bar-coding project From our results we were able to identify 4 plants species. They are Holcus Lanatus or Yorksire fog, Juccus Effusus or Soft Rush , Plantago lamceolata or Ribword plantain,and Medicago Truncatula or Barrel clover. This shows DNA barcoding can be used successfuly to identify plant species in Australia with a basic laborator by non experts. Some of our samples were more difficult to extract DNA from. In the future we would investigate alternative methods of DNA extraction eg genomic DNA extraction kits. One of our PCRs did not work due to a large amount of protein in the sample. To avoid this in the future a phenol chloroform extraction to denature the proteins can be used and PCR repeated. All 4 of our samples were found to not be native to Australia. Not as surprising as we first thought given the difficulty of maintaining the wetlands in isolation from the rest of the surround area. Such as paddocks directly next to the park. Given that nonexperts can now positively identify species it will be of great benefit to future conservation work. As an accurate record of what plants are growing in an area can be created and maintained by even a small group of nonexperts. We can also determine if more invasive species are taking hold of an rea and what they have replace. In conclusion: We achieved our aims to use DNA barcoding and identify plants. We did not need any expert knowledge, and only a basic laboratory set up. DNA sequencing was easy to outsource. For future work more samples should be taken and more DNA extracted. We can improve on 4 out of 13 samples yielding DNA!