Download Convergent Evolution in the Genetic Basis of Müllerian Mimicry in

Copyright ! 2008 by the Genetics Society of America
DOI: 10.1534/genetics.107.082982
Convergent Evolution in the Genetic Basis of Müllerian Mimicry in
Heliconius Butterflies
Simon W. Baxter,*,1 Riccardo Papa,† Nicola Chamberlain,‡ Sean J. Humphray,§
Mathieu Joron,** Clay Morrison,†† Richard H. ffrench-Constant,‡
W. Owen McMillan†† and Chris D. Jiggins*
*Department of Zoology, University of Cambridge, Cambridge CB2 3EJ, United Kingdom, †University of California, Irvine, California
92697, ‡University of Exeter, Cornwall TR10 9EZ, United Kingdom, §The Wellcome Trust Sanger Institute, Cambridge
CB10 1SA, United Kingdom, **Institute for Evolutionary Biology, University of Edinburgh, Edinburgh EH9 3JT,
United Kingdom and ††Department of Genetics, North Carolina State University,
Raleigh, North Carolina 27695
Manuscript received October 5, 2007
Accepted for publication August 31, 2008
ABSTRACT
The neotropical butterflies Heliconius melpomene and H. erato are Müllerian mimics that display the same
warningly colored wing patterns in local populations, yet pattern diversity between geographic regions.
Linkage mapping has previously shown convergent red wing phenotypes in these species are controlled by
loci on homologous chromosomes. Here, AFLP bulk segregant analysis using H. melpomene crosses identified
genetic markers tightly linked to two red wing-patterning loci. These markers were used to screen a H.
melpomene BAC library and a tile path was assembled spanning one locus completely and part of the second.
Concurrently, a similar strategy was used to identify a BAC clone tightly linked to the locus controlling the
mimetic red wing phenotypes in H. erato. A methionine rich storage protein (MRSP) gene was identified within
this BAC clone, and comparative genetic mapping shows red wing color loci are in homologous regions
of the genome of H. erato and H. melpomene. Subtle differences in these convergent phenotypes imply
they evolved independently using somewhat different developmental routes, but are nonetheless regulated
by the same switch locus. Genetic mapping of MRSP in a third related species, the ‘‘tiger’’ patterned H.
numata, has no association with wing patterning and shows no evidence for genomic translocation of wingpatterning loci.
O
NLY recently has it become feasible to study the molecular basis of phenotypic adaptation in higher
organisms, which has generated considerable interest in
identifying genes controlling adaptive traits (Nachman
et al. 2003; Mundy 2005; Protas et al. 2006). Commonly,
positional cloning of qualitative traits involves performing crosses for trait segregation, creating linkage maps
using the progeny, identification of the genomic region
responsible for variation, and then genetic mapping of
candidate genes to test for association by linkage (Heckel
et al. 1998). This approach has been successful in associating candidate genes to the causal locus in several
cases, including insecticide resistance in Heliothis virescens (Gahan et al. 2001), pelvic reduction in threespine
sticklebacks (Shapiro et al. 2004), wing color patterning
in butterflies (Kronforst et al. 2006b), albinism in cave
population Astyanax fish (Protas et al. 2006), and
Sequence data from this article have been deposited with GenBank
under accession nos. FI109935–FI109945, FI107283–FI107295, FI136209–
FI136223, EU711403–EU711404, and AC216670.
1
Corresponding author: Department of Zoology, University of Cambridge,
Downing St., Cambridge CB2 3EJ, United Kingdom.
E-mail: [email protected]
Genetics 180: 1567–1577 (November 2008)
adaptive variation in coat color of mice (Steiner et al.
2007). Identifying the adaptive trait becomes more
difficult where no suitable candidate genes exist or all
known candidates can be ruled out by linkage mapping. In this case, sequencing of genomic bacterial
artificial chromosome (BAC) clones spanning the genome region is required. Recently, (Colosimo et al.
2005) positionally mapped and sequenced the locus
controlling armor plating in threespine sticklebacks
from a genomic BAC library and identified a strong
candidate for determination of lateral plate phenotypes. Identifying genetic markers tightly linked to the
plate morph locus was achieved by screening stickleback crosses with amplified fragment length polymorphism (AFLP) markers, enabling markers linked to
the region of interest to be identified without any prior
knowledge of the genome sequence. Markers developed in this way can also facilitate comparative studies
to determine whether the same regions of the genome
are involved in adaptation in different species.
A comparative mapping approach has already been
applied to the three butterfly species, Heliconius melpomene, H. erato, and H. numata ( Joron et al. 2006). The first
two species are comimics that share the same warningly
1568
S. W. Baxter et al.
colored wing patterns in local populations and different
phenotypes between geographic regions of Central and
South America, while H. numata is a species with polymorphic populations in which a single genetic locus
controls multiple morphs. A positional cloning approach in H. melpomene led to identification of markers
linked to the Yb patterning locus, which controls a
yellow hind-wing bar. These were subsequently mapped
in the other two species and found to be tightly linked
to the H. erato locus Cr, which has similar phenotypic
effects to Yb, and the H. numata locus P, which controls
whole-wing phenotypic polymorphism. This surprising
result indicates that a single genetic locus is controlling
both convergent and divergent phenotypes in different
lineages ( Joron et al. 2006).
Wing color and pattern variation among the !25
mimetic races of H. melpomene and H. erato is controlled
by several unlinked loci with major phenotypic effect
(Sheppard et al. 1985). Extensive crossing experiments
have shown that in H. melpomene, genetic factors on at
least 4 of the 21 chromosomes are involved in wing color
patterning (Sheppard et al. 1985; Joron et al. 2006).
H. erato has a similar architecture, with the involvement
of at least 4 different chromosomes. Recent work has
shown preliminary evidence for further homology between the two species in addition to that of Yb and Cr.
The locus Ac, which controls a dumbbell-shaped element in H. melpomene, is on the homologous chromosome to Sd, which controls forewing band shape in H.
erato (Kronforst et al. 2006a). Loci controlling red wing
pattern elements genetically map to the same chromosome as Cubitus interruptus (Ci) in H. erato (D locus), H.
melpomene (B and D loci), and sister species H. cydno (G
locus) ( Joron et al. 2006; Kronforst et al. 2006a).
While H. melpomene B/D (hereafter HmB/HmD) and
H. erato D (HeD) control broadly similar, and adaptively
convergent mimetic pattern elements, there are nonetheless some fundamental differences both in the action
of the switch loci in the two species and in the phenotypic expression of their pattern elements. First, HeD
controls both red/orange and yellow color in the medial forewing band. In contrast the H. melpomene yellow
forewing is controlled by a completely unlinked locus,
N, and is possibly influenced by an additional locus M
(Mallet 1989). Second, the hind-wing ray elements
in H. erato are determined by vein position, with all pattern elements lying in intervein compartments. The H.
melpomene rays involve an orange band that bisects vein
boundaries and is apparently homologous in position
to the yellow band controlled by the locus Yb on LG15.
Thus, these genes control adaptively convergent patterns but their resultant phenotypes and mode of action
are sufficiently distinct, leading to speculation whether
the same genes are homologous (Nijhout 1991) or not
(Mallet 1989). We here carry out fine-scale mapping to
determine whether red patterning elements of HmB/
HmD and HeD are indeed homologous.
Genetic analysis using AFLPs provides a method for
rapidly generating large numbers of markers that can be
used to analyze poorly characterized genomes (Heckel
et al. 1999; Brugmans et al. 2002; Kazachkova et al.
2004; Jiggins et al. 2005). Previous genetic work on H.
melpomene wing patterning relied on the discovery of an
AFLP marker tightly linked to the Yb locus on linkage
group 15 ( Jiggins et al. 2005). Here we apply an AFLP
method for targeted identification of molecular markers
linked to phenotypic traits of interest in Lepidoptera.
Markers flanking H. melpomene HmB and HmD were
developed and, unexpectedly, show these loci to be
tightly linked. BAC library screening using AFLP markers linked to red patterning loci identified candidate
clones for sequencing that will ultimately enable positional cloning of these phenotypes. Finally, comparative
mapping shows a gene linked to HeD in H. erato is in a
homologous chromosomal region to HmB/HmD of H.
melpomene, however is unlinked to wing patterning in the
related species H. numata.
MATERIALS AND METHODS
Wing pattern phenotypes: Here, we use the terminology
HmB for the locus controlling presence or absence (Hmb) of
the H. melpomene red medial forewing band and HmD for the
locus controlling the presence or absence (Hmd) of the red
forewing base, hind-wing bar, and hind-wing rayed phenotype.
A single locus, D, controls this convergent pattern in H. erato,
referred to here as HeD. Note that HeD was originally termed
DRy by Sheppard et al. (1985) and subsequently simplified to D
by ( Jiggins and McMillan 1997) (Figure 1).
Insect crosses: All H. melpomene crosses were performed
within sealed, outdoor cages at the Smithsonian Institute,
Panama. Single-pair matings were set up between H. m.
melpomene collected from French Guiana (4"549 N, 52"219
W), homozygous for the HmB phenotype and H. m. malleti
collected from Ecuador (0"109 S, 77"419 W) homozygous for
the HmD phenotype. Crosses were then performed between
unrelated F1 heterozygotes, to generate three large F2 broods
that were reared to adulthood (brood 44 with 164 progeny;
brood 48 with 109 progeny; and brood 52 with 99 progeny).
The combined 372 F2 progeny segregated for the presence or
absence of HmB and HmD phenotypes in Mendelian ratios of
1:2:1 (100 bD/b-:197 B-/-D:75 Bd/-d), not differing significantly
from expected x2 ¼ 4.66, P . 0.1 [2 degrees of freedom (d.f.)].
A similar crossing strategy was preformed on H. erato at the
University of Puerto Rico. For this cross, outbred stocks of H.
erato etylus, collected from the Zamora River (3"559 S, 78"509
W) and H. himera, collected from Vilcabamba (4"169 S, 79"139
W), both in Loja Province in southern Ecuador were crossed to
produce F1 hybrid lines. Unrelated F1 individuals were crossed
to produce a family containing 92 progeny that segregated for
the H.e. etylus HeDet phenotype and H. himera HeDhi phenotypes in the expected 1:2:1 Mendelian ratio (23 HeDetHeDet:44
HeDetHeDhi:25 HeDhiHeDhi) not differing significantly from
expected x2 ¼ 0.26, P . 0.8 (2 d.f.) (Kapan et al. 2006). For
all crosses, wings were removed from butterflies and stored
in paper envelopes, and bodies preserved in a salt-saturated
solution of 10% DMSO and 0.2 m EDTA at –20".
H. numata crosses have been described previously ( Joron
et al. 2006). Here, two polymorphic F2 broods were analyzed
that segregated for three alleles of the supergene P from the
Mimicry in Heliconius Butterflies
Figure 1.—Heliconius melpomene and H. erato comimics. D
phenotype: Dorsal and ventral wings from H. melpomene ecuadorensis and H. erato etylus, displaying the D phenotype.
Specimens were collected near Zamora, Ecuador. The yellow
forewing patch is controlled by HeD in H. erato and by a
second locus (called N) in H. melpomene. B phenotype:
H. melpomene melpomene and H. erato hydara were collected near
Cayenne, French Guiana (4"919 N, 52"369 W). All individuals
are males.
morphs H. numata f. elegans (P ele), H. n. f. aurora (P aur), and H. n.
f. silvana (P sil) from eastern Peru. Four phenotypes segregated
for brood 502 among 88 F2 progeny (21 P eleP aur:18 P eleP sil:32
P silP aur:17 P silP sil) (also see Figure 2C in Joron et al. 2006) and
two phenotypes segregated for brood 472 among 80 progeny
(45 P eleP sil:35 P silP sil).
Nucleotide extraction and processing: Genomic DNA was
extracted from small sections of abdomen or thorax with the
DNeasy tissue kit (QIAGEN) and resuspended in TE buffer
(10:0.1, pH 8.0). AFLP templates were prepared for 35 H.
melpomene brood 44 progeny, F1 parents, and grandparents
using half reactions of AFLP analysis system II (Invitrogen Life
Technologies) according to manufacturer’s instructions, with
EcoRI and MseI restriction enzymes. AFLP PCR reactions were
performed using fluorescently labeled Eco primers with two or
three selective bases and paired with an Mse primer containing
three selective bases. AFLP PCR reactions were diluted 1/60
in water, and 1 ml added to 9 ml of HiDi formamide solution
containing 0.01 ml of GeneScal-500 LIZ size standard (Applied
Biosystems). Products were separated on a 3730 DNA Analyzer
(Applied Biosystems) using GeneMapper. Data files were
converted to GeneScan format and AFLP peaks sized using
GeneScan Analysis software (version 3.1.2). Analyzed files
were then imported into Genographer (version 2.0), which
digitally reconstructed chromatogram peaks to form images
similar to electrophoretic gels.
Sequencing AFLP markers: AFLP PCR reactions containing
bands linked to the color pattern loci were separated using
polyacrylamide gel electrophoresis (acrylamide 6%, 13 TBE,
7 m urea) at 1750 V, 80 W for 1.5–3 hr. Acrylamide gels were
stained with Silver Sequence (Promega) to visualize DNA
bands, which were then excised and resuspended in water. All
products were reamplified and sequenced using BigDye terminator v3.1 (Applied Biosystems) using an ABI3730. Ten
AFLP markers were sequenced (FI109935–FI109944) and used
to design genotyping assays for genetic mapping in H. melpomene
1569
brood 44, and where possible, broods 48 and 52. Genotyping
was performed using (i) size variation in PCR products when
separated using agarose gel electrophoresis or (ii) sequencing
F1 parents from crosses to identify restriction enzymes that
recognize single nucleotide polymorphisms segregating in F2
progeny. CodonCode Aligner V1.5.2 software was used to
analyze sequence chromatograms.
Genetic markers and linkage map assembly: As crossing
over between sister chromatids does not occur during oogenesis in Lepidoptera, all markers on the same chromosome
inherited from the mother are in complete linkage. Three H.
melpomene F2 broods (44, 48, and 52) segregating for HmB and
HmD were genotyped for two linkage group 18 (LG18) molecular markers, nuclear gene Cubitus interruptus and microsatellite Hm14. Alleles inherited from the F1 mother were used
to assign chromosome prints to progeny. This provided a
molecular diagnostic to determine whether HmB/D heterozygous progeny inherited a Bd or bD chromosome from the F1
mother. To calculate recombinational distances between HmB
and HmD and known markers on LG18, chromosomes inherited from F1 fathers were analyzed (crossing over does
occur during spermatogenesis in Lepidoptera). Direct estimation of recombination between HmB and HmD was not
possible as these dominant cosegregating phenotypes are inherited in repulsion (Figure 2).
Linkage map assembly: The H. erato linkage map was
adapted from Kapan et al. (2006). MapMaker Macintosh
2.0 was used to assemble maps for H. melpomene and H. numata.
H. numata brood 472 contained 80 F2 individuals and was
genotyped for RpS30 and MRSP (there was no variation at Ci),
and brood 502 contained 88 individuals and was genotyped for
RpS30 and Ci (there was no variation at MRSP).
H. melpomene BAC library preparation, screening, and end
sequencing: A H. melpomene BAC library was constructed using
vector pECBAC1 and contains 18,816 clones with an average
insert size of 123 kb, providing a 7.93 genome coverage
(Amplicon Express) ( Joron et al. 2006). A bacterial clone
physical map of the genome was then constructed using
HindIII restriction enzyme fingerprinting (Humphray et al.
2001; Schein et al. 2004). BAC library plates were directly
cultured into 170 ml 23 TY in 384-well plates. After overnight
growth the BAC DNA was extracted by alkaline lysis on a
Packard MiniTrack and digested with HindIII in the 384-well
plates. Following electrophoresis on 121 lane 1% agarose gels,
the data were collected using a Typhoon 8600 fluorimager
and raw images were entered into the fingerprint database
using the software IMAGE (http://www.sanger.ac.uk/Software/
Image). The output of normalized band values, sizes, and gel
traces were analyzed in FPC (Soderlund et al. 2000), which
bins and orders clones on the basis of shared bands, taking
marker data into account when available. Fingerprinting was
successful for 17,494 clones, of which 13,010 assembled into
2086 contigs (the remainder were singletons). Each contig
averaged 6.2 clones and 791 contigs contained 5 or more
clones. A WebFPC database displaying all contigs is available at
http://www.sanger.ac.uk//Projects/H_melpomene/WebFPC/
helim/small.shtml.
H. melpomene BAC library clones were printed onto nylon
membranes and hybridization performed using eight probes
linked to the HmB and HmD loci including three AFLP markers, Hm_eCCmCTA (primers CC-CTA_F2 X CC-CTA_R2),
Hm_eCGmATG213, and Hm_eACTmGTA195; four BAC end
sequences, bHM40A21_sp6, bHM36K2_sp6, bHM28L23_sp6,
and bHM40C14_sp6; and gene MRSP (primers MRSP_F1 3
MRSP_R1). PCR products were generated under the following
conditions: 50 ng genomic DNA of H. melpomene 13 reaction
buffer, 2.5 mm MgCl2, 0.2 m dNTP, 50 pmol each primer, Taq
polymerase (Bio-Line). PCR products were then labeled with
1570
S. W. Baxter et al.
H. erato BAC library preparation and screening: Two H.
erato BAC libraries, one partially restricted with EcoRI and one
with BamHI, were created from a line of H. erato petiverana
collected in Gamboa, Panama, and inbred for several generations (C. Wu, D. Proestou, D. Carter, E. Nicholson, F. A.
Santos, S. Zhao, H.-B. Zhang and M. R. Goldsmith,
unpublished results). Both libraries contain 19,200 clones
arrayed in 384-well plates and the average insert sizes for the
EcoRI and BamHI libraries were estimated to be 153 kb and 175
kb, respectively. Libraries were printed to nylon membranes in
a high-density array. Under this array strategy, each clone was
spotted twice in an effort to minimize false positives in
screening experiments. An AFLP marker tightly linked to
the HeD locus, He_CCAC491 (FI109945) (Kapan et al. 2006),
was isolated, sequenced, and used to probe the H. erato BAC
libraries. Probing both BAC libraries identified 10 positive
clones, the largest of which, BBAM-25K4 (AC216670), was
sequenced at 83 coverage by the Baylor College of Medicine’s
Genome Sequencing Center (Houston).
RESULTS
Figure 2.—HmB and HmD phenotypes are inherited in repulsion. Schematic of LG18 chromosomes from an F1 cross
between the heterozygous Bb/Dd female (dark gray) and male
(light gray). Crossing over of sister chromatids does not occur
during oogenesis, so F2 progeny inherit either bD or Bd genotypes from the F1 female. As all LG18 chromosomal markers
are completely linked when inherited from the F1 mother,
molecular markers are used to assign chromosome prints. Recombination between HmD and HmB or Hmd and Hmb may
occur in the F1 male during spermatogenesis. Consequently,
phenotypes are only informative for one of the B/b alleles
or one of the D/d alleles and are therefore in repulsion.
For example in the case of a bD/b- F2 individual, the F1 femalederived chromosome contributed b/D and F1 male-derived
chromosome b/-. Here, it is unclear whether one or two
HmD alleles are present, as the F1 female HmD phenotype
masks any contribution by the F1 male. Male informative genotypes from heterozygous B-/D- progeny were deduced using
chromosome prints. A B-/D- F2 heterozygote that inherited a
b/D chromosome from the F1 female must have inherited a
dominant HmB allele from the F1 father to produce the observed phenotype. A hyphen ‘‘-’’ signifies unknown malederived alleles.
a-32P using Prime-It II random primer labeling kit (Stratagene)
and hybridization performed as outlined in ( Joron et al. 2006)
(Table 1). BAC clones identified by the eight probes are listed in
supplemental Table 1.
Molecular markers for red wing pattern loci: Genetic
crosses have previously shown HmB and HmD are dominant loci on the same linkage group (Turner 1972),
designated linkage group 18 (LG18) in H. melpomene
( Jiggins et al. 2005; Joron et al. 2006). To generate
molecular markers linked to these loci, AFLP bulk segregant analysis was performed on the F1 parents of
brood 44 and two F2 progeny bulks. The first bulk
contained 12 F2 individuals, homozygous Hmb (no red
forewing band, HmbD/b-), and the second bulk contained 12 F2 individuals homozygous for Hmd (no red
hind-wing rays, bar, and red forewing base, HmBd/-d). As
the F2 progeny were siblings, the two bulks were expected to share many AFLP bands, but should be
strongly differentiated in genome areas tightly linked
to Hmb or Hmd. In Lepidoptera, chromosomal crossing
over occurs during spermatogenesis and not oogenesis
(Maeda 1939; Turner and Sheppard 1975; Traut
1977). Therefore, AFLP analysis focused on bands inherited from the F1 father for recombinational linkage
mapping. Two hundred fifty-six AFLP primer combinations produced !5100 bands in both F2 bulks, inherited
from the F1 father. In addition, 19 bands were present
in only one bulk and represented candidate molecular
markers for red pattern elements. AFLP primer combinations for these 19 bands were reanalyzed in F1 parents
and 35 individual progeny (including the 24 individuals
used to assemble the bulks). Ten AFLP markers were
confirmed linked to Hmb or Hmd and 9 of the bands
were excluded as false positives due to banding patterns
not consistent with linkage group 18.
Five AFLP markers (Hm_eACAmCAT133, Hm_eCTm
GCG148, Hm_eACTmGTA195, Hm_eCGmGAA139, and
Hm_eCCmACA177) were present in 16/16 of the Hmb
individuals tested and absent from most of the Hmd
individuals, suggesting these markers were genetically
linked to the Hmb phenotype. The remaining five markers
(Hm_eCCmCTA386, Hm_eCGmATG213, Hm_eACCm
CAG224, Hm_eCTmCTC156, and Hm_eCAmAGC355)
AAACGACCTGGGGAATTTTT
CGTGTCACGTAGAGTCACGAA
TCCCATTCAAGCCTGTAGGT
TGTGAAAGTTGGTCACGTTTG
AGTCTGTGGTTGGTGCCATTa
GACCAGCGATTGACAAGACA
TTGGTGTTACAAAGCGGTGA
ACGAACGCTTCGTGCTCTAT
AGCCGCAGGAAAAACCTAGTa
ATGCCATGCCTTTTTACCAG
GAGGCGTTGAGTGAGGAAAC
TAACAAGGCGTTGAGTGCAG
BAC end primers
bHM5K10_t7F
bHM5K10_t7R
bHM40C14_sp6F
bHM40C14_sp6R
bHM7G5_sp6F
bHM7G5_sp6R
bHM35J3_t7F
bHM35J3_t7R
bHM7G5_t7F
bHM7G5_t7R
bHM40A21_sp6F
bHM40A21_sp6R
TCGACGGCTAATGCATAAAAa
AAGGCGACTTCGAATGACATA
GGTACCACTACTCGGGGAGA
ACAGCGGCTAACGAAATGAT
GCTGTATTTCTATCTCGCACTGG
GCACTCTTTCGAGGGTGGTA
GAACACGCTGTGCTTTTCAA
AATGGTTGGCAGAACCAGAC
GGGTCGTTGAAGAGAACATGG
TACGCCAGTCAATGAAGACG
MRSP
MRSP_F1
MRSP_R1
MRSP_F2
MRSP_R2
bHM47N1_t7F
bHM47N1_t7R
bHM5D10_sp6F
bHM5D10_sp6R
bHM36K2_sp6F
bHM36K2_sp6R
TTCTCAGCCCTAACAGTTTCA
ATTCACCGCCGCTAATACAA
TCCCGTCTTAGCGAGCAC
GTTCTCTACTTTCCGCCCATT
TATCTCGCGAAGCTCTCGTA
GGCAGAGGGAACCTTGTGT
AATTCCGCCACTAAACAGGA
GGTAGCTGACGCTGGTGAC
TCGCCCGATGATAATATAA
GACATCTACGTCACTATTCCC
TAAGGCTTATTTTTACTTGGC
TCTGGTGTAGAGGCAATGT
GATGCTATTCGCTGAA
ACTCCAGTGAATAATAAGTTT
Sequence
AFLP markers
ACC_CAG_F
ACC_CAG_R
CC-CTA_F1
CC-CTA_R1
CC-CTA_F2
CC-CTA_R2
CG-ATG F1
CG-ATG R1
ACA-CAT F1
ACA-CAT R1
ACT-GTA F1
ACT-GTA R1
CT-CTC_F1
CT-CTC_R1
Primer
LPA
LPA
LPA
55
55
55
LPA
NlaIII
LPF
—
LPF
—
LPF
LPF
AluI
58
58
58
58
58
58
58
58
58
MseI
LPA
58
60
—
60
—
LPA
68
59
LPA
Brood
44
58
Annealing
temp.
—
LPF
LPF
—
LPF
LPA
—
SspI
LPA
—
BanII
—
LPA
—
—
—
LPA
—
Brood
48
HaeIII
LPF
LPF
—
LPF
LPA
LPF
NlaIII
LPA
—
StyI
—
seq
—
—
—
LPA
—
Brood
52
Mapping method in H. melpomene
Primer sequences for linkage mapping and H. melpomene BAC library probes
TABLE 1
FI107287
Contig 1080
Contig 1352
Contig1224
(continued )
FI107291
FI107290
FI107288
FI107294
FI107286
FI107293
FI107289
FI107292
EU711403
EU711404
FI109935
FI109936
FI109937
FI109941
FI109939
FI109939
FI109944
Accession no.
NA
Contig 936
Contig 1080
Contig 1305
NA
NA
NA
NA
Contig 1729
NA
NA
Contig 16
NA
Contig 1729
Contig 446
Contig 936
NA
Contig 196
Nonspecific
NA
BAC screen result
Mimicry in Heliconius Butterflies
1571
—
—
—
58
TGCCAATTAAGGATGCCATT
TTTCAACACTCTTGCCCTCA
bHM3O8_t7F
bHM3O8_t7R
LPA, length polymorphism identified using agarose gel electrophoresis; LPF, length polymorphism identified using fluorescently labeled PCR products resolved on an
ABI3730 sequencer. Restriction endonucleases used for identification of polymorphic sites in PCR products are listed. Seq, polymorphism identified using direct sequencing.
No polymorphism was detected in broods marked with a ‘‘—’’.
a
Primers fluorescently labeled.
FI136219
FI107285
Contig
Contig
Contig
Contig
—
—
58
—
LPF
58
seq
seq
NA
1080
1352
1224
446
FI107295
FI107284
NA
LPA
LPA
58
LPA
NA
—
AluI
—
58
AGAGCGGCTTCGTTCAGAT
AGGGACCCAAATCCGTACAT
GACGTCGCTTCGTACCAAAT
CATGGCACTTCGGTTAGACA
GCGGCGTGCAAATTATACTCa
ATCCATTCATTCTGGCTTCG
TGAGCAGATATTTTCGCGTTA
ACGAATTTAGCGTTGGCAAT
bHM49H2_sp6F
bHM49H2_sp6R
bHM28F19_sp6F
bHM28F19_sp6R
bHM7N20_sp6F
bHM7N20_sp6R
bHM28L23_sp6F
bHM28L23_sp6R
BAC screen result
Brood
52
Brood
48
Brood
44
Annealing
temp.
Sequence
Primer
Mapping method in H. melpomene
(Continued)
TABLE 1
FI107283
S. W. Baxter et al.
Accession no.
1572
were absent in all HmbD/b- individuals and present in most
of the HmBd/-d, suggesting these DNA fragments were
linked to the Hmd phenotype. Recombination events
between AFLP markers and Hmd were observed in two
individuals that were not used in the bulked segregant
analysis (Table 2).
HmB and HmD are tightly linked loci: The 10 Hmb- or
Hmd-linked AFLP bands were sequenced, following
separation with polyacrylamide gel electrophoresis,
and ranged in size from 133 bp to 386 bp. Oligonucleotides were designed for each AFLP marker (Table 1) for
recombinational linkage mapping in brood 44 to determine distances to HmB and HmD. A linkage map of
LG18 was constructed using 164 progeny from brood 44
using microsatellite Hm14, recently identified LG18
nuclear genes Bm44, Ribosomal protein gene S30 (RpS30)
(Pringle et al. 2007) as well as Ci and 6 of the 10 AFLP
sequence-tagged sites (Hm_eCGmATG213, Hm_eACCm
CAG224, Hm_eACAmCAT133, Hm_eACTmGTA195,
Hm_eCTmCTC156, and Hm_eCCmCTA386). The remaining four AFLP HmB/D-linked markers either contained no sequence variation, which is required for
linkage mapping, or amplified .2 alleles (Figure 3). All
AFLPs that were successfully mapped were within 5.9 cM
of Hmb and Hmd and closely linked to nuclear gene
Bm44. There were no recombinants between AFLP
marker Hm_eCGmATG213 and the HmB/D locus.
Although HmD and HmB were inherited in repulsion,
molecular markers show both phenotypes genetically
map to the same chromosomal region in brood 44. To
test the robustness of the association, two additional
broods were genotyped for two HmB/D-linked AFLP
markers. From the combined 372 progeny of broods 44,
48, and 52, 199 inherited the B or b from the F1 male and
173 inherited D or d from the F1 male. The first marker,
Hm_eCCmCTA386, showed 1/173 recombinants to the
HmD/d locus and 1/199 recombinants to HmB/b. A
marker flanking the two wing-patterning loci, Hm_
eACTmGTA195, showed 3/173 recombinants to HmD/
d and 4/199 recombinants to HmB/b. The AFLP marker
closest to HmB/D in brood 44 (Hm_eCGmATG213) was
not polymorphic in broods 48 or 52.
BAC tile path surrounding HmB and HmD loci: Radiolabeled probes designed from three HmB/D-linked AFLP
markers (Hm_eACTmGTA195, Hm_eCCmCTA386, and
Hm_eCGmATG213) were hybridized to H. melpomene BAC
library filters and positive clones referenced against the
BAC fingerprint database. Hm_eACTmGTA195 hybridized to a single clone, in contig 1729 (Figure 4). Genetic
markers designed from the sequenced BAC end of contig
1729 were mapped in 372 progeny from H. melpomene
broods. Three recombination events were detected between contig ends, enabling orientation and an estimation
of recombination frequency in physical distance (3/372
recombinants in !140 kb).
Probe Hm_eCCmCTA386 hybridized to 19 of 32 BAC
clones within the same fingerprint contig 196. Again,
Mimicry in Heliconius Butterflies
1573
TABLE 2
AFLP markers identified using bulked segregant analysis that are linked to HmB/b and HmD/d
wing-patterning loci
Band present in F2 progeny
H. melpomene AFLP marker
Hm_eCCmCTA386
Hm_eCGmATG213
Hm_eACCmCAG224
Hm_eCAmAGC355
Hm_eCTmCTC156
Hm_eACAmCAT133
Hm_eCTmGCG148
Hm_eACTmGTA195
Hm_eCGmGAA139
Hm_eCCmACA177
Accession no.
Size (bp)
bb/D- progeny
B-/dd progeny
FI109939
FI109941
FI109944
FI109943
FI109935
FI109937
FI109938
FI109936
FI109940
FI109942
386
213
224
355
156
133
148
195
139
177
0/16
0/16
0/16
0/16
0/16
16/16
16/16
16/16
16/16
16/16
19/19
19/19
19/19
15/16
17/19
1/18
1/19
1/18
1/18
2/19
recombination was used to orientate the clone, with one
end containing no recombinants to the HmB or HmD
loci. Probe Hm_eCGmATG213 hybridized to all 6
clones from contig 446 and 5 of the 10 clones from
contig 936. The BAC ends from contigs identified using
Figure 3.—Linkage map of H. melpomene LG18 (77.3 cM,
log likelihood ¼ #92.61). Three nuclear genes (Ci, RpS30,
and Bm44), one microsatellite marker (Hm14), and six AFLP
sequence-tagged sites were genetically mapped in 164 F2 individuals from brood 44. The linkage map was constructed using MapMaker 2.0. Four AFLP markers identified by an
asterisk were positioned manually on the basis of AFLP banding patterns for up to 35 individuals. All AFLP markers are
within a 6.5-cM region.
AFLPs were used to rescreen the library and close the
gap between contigs 446 and 196. A BAC tile path
spanned the color-pattern locus HmB, flanked by
recombinant individuals (Figure 4). The HmD locus is
located in a larger region, overlapping with HmB.
Primers designed for 22 BAC end sequences were used
to confirm clone overlap between the distinct contigs
(supplemental Figure 1, supplemental Table 2).
Convergent patterns map to homologous loci: The
loci controlling red wing pattern elements in H.
melpomene and H. erato are known to be on homologous
chromosomes ( Joron et al. 2006; Kapan et al. 2006;
Kronforst et al. 2006a). A previously identified H. erato
AFLP marker (He_CCAC491), positioned 1.5 cM from
the HeD locus (Kapan et al. 2006), was sequenced and
used to screen a H. erato BAC library. The probe hybridized to clone BBAM-25K4 (GenBank AC216670); however, recombinational linkage mapping ruled out the
possibility that the HeD locus was contained within this
clone. To identify nuclear genes close to HeD, BBAM-25K4
was sequenced and contained a gene encoding a Methionine Rich Storage Protein (MRSP) (EU711403). Comparative mapping of MRSP in H. melpomene broods identified
2/173 recombinants to the HmD locus and 2/199 recombinants to the HmB locus and is positioned farther
from contig 196 (Figure 4). H. melpomene BAC library
screening was performed with MRSP and identified
contig 16, containing 63 clones that did not overlap with
any previously detected contigs. For H. erato, we observed
one recombinant between the HeD locus and MRSP from
88 F2 individuals (in the H. erato etylus 3 H. himera cross).
Color diversity in a third Heliconius species, H.
numata, is controlled by a single locus called P on
linkage group 15 of this species. Theoretical models
converge on the view that supergenes cannot form by
bringing together previously unlinked loci through a
graduation tightening of linkage or through translocation of genetic elements from different regions of the
genome; instead, supergenes are believed to form via the
1574
S. W. Baxter et al.
Figure 4.—Analysis of recombinants spanning the HmB/D region on LG18. A H. melpomene BAC library was probed with three
AFLP markers (open circles) linked to the HmB and HmD loci. Hm_eACTmGTA195 hybridized with 1 BAC clone, bHM40C14,
within contig 1729. Hm_eCCmCTA386 hybridized to 19 clones from contig 196, (containing 32 clones). Hm_eCGmATG213 hybridized to 6 clones from contig 446 (containing 6 clones) plus 5 clones from contig 936 (containing 10 clones). PCR amplification using BAC end primers designed from contig 446 successfully amplified in BAC clones from contig 936, and vice versa,
demonstrating these two contigs overlap (supplemental Figure 1). This implies contigs 446 and 936 may represent very divergent
haplotypes for the B/D region, as fingerprinting did not group these clones into a single contig. The BAC ends of some clones
were sequenced and used to design genotyping assays for the 372 progeny (solid circles). As HmB and HmD are inherited in repulsion, recombinants from BAC ends to these loci are listed independently. Recombinants between contig ends were observed,
enabling orientation of the HmB and HmD loci. The H. melpomene BAC library was screened using additional BAC end probes
(solid squares), bHM40A21_sp6 (contig 936), bHM28L23_sp6 (contig 1305), and bHM36K2_sp6 (contig 196), which created
a single tile path spanning the HmB locus and part of the HmD locus. Finally, a gene near the H. erato HeD locus (MRSP) was
used as a probe. For full details of BAC screening results see supplemental Table 1. Accession nos. for BAC end sequences
are FI107283–FI107295 and FI136209–FI136223. The figure scale is based on relative sizes of fingerprinted contigs.
recruitment of linked genetic elements (Charlesworth
and Charlesworth 1975; Turner 1977; Le Thierry
d’Ennequin et al. 1999). To empirically evaluate those
theoretical results, we wanted to determine whether
there was evidence for translocation from the HmB/
HmD region to the P locus in H. numata. Three genes,
MRSP, RpS30, and Ci were genetically mapped in crosses
segregating for P phenotypes. Both MRSP and RpS30
mapped to LG18 in H. numata, separated by 2.9 cM,
while RpS30 and Ci were distantly linked at 59 cM,
demonstrating the same gene order and similar distances between markers as in H. melpomene and H. erato.
This provides no evidence for large-scale rearrangements between LG18 and LG15 in H. numata. The
distances between Ci and MRSP in these three species
are H. erato, 74.4 cM; H. melpomene, 68.7 cM; and H.
numata, 61.9 cM (Figure 5).
DISCUSSION
The mimetic color patterns of Heliconius butterflies
are striking phenotypic adaptations controlled by few
loci of major effect. Through adapting traditional AFLP
methods, we have identified molecular markers tightly
linked to the HmB and HmD loci, controlling the
presence or absence of red and orange pattern elements
in H. melpomene. Here we used the process of DNA-based
bulked segregant analysis, which has been widely applied in plant studies to identify markers linked to a
phenotypic locus (Michelmore et al. 1991). The principle involves dividing siblings of a cross into different
pools corresponding to a segregating phenotype. The
pools (or bulks) are largely heterozygous, except around
the locus controlling the phenotype. When analyzed with
PCR-based methods such as AFLPs, markers that are
differentially amplified between the bulks should genetically map near the locus of interest. Although we have yet
to identify the actual gene(s) controlling red wing pattern
phenotypes, this work nonetheless demonstrates that
positional cloning for phenotypic traits is a feasible goal
for nonmodel organisms outside plant research fields.
Our comparative genetic mapping data in H. melpomene and H. erato have shown that homologous chromosomal regions are responsible for similar (but not
Mimicry in Heliconius Butterflies
Figure 5.—Linkage maps comparing homologous chromosomes from H. erato, H. melpomene, and H. numata. H. erato
linkage map adapted from Kapan et al. (2006), showing HeD
in the most likely position (70% probability density). BAC library screening using H. erato AFLP marker He_CCAC491
identified clone BBAM-25K4. Sequence analysis identified a
MRSP gene, which was genetically mapped along with Ci in
all three species. Two H. melpomene AFLP markers (Hm_eACTm
GTA195 and Hm_eCTmCTC156) and one microsatellite
(Hm14) cross amplified in H. numata and were genetically
mapped to LG18. Numbers shown are centimorgans.
identical) red wing phenotypes in these two species.
This provides further evidence of homologous genomic
regions shared between H. melpomene and H. erato, which
control similar pattern elements ( Joron et al. 2006).
There are however notable interspecific differences
between the D locus of these species. First, the H. erato
HeD locus controls not only the switch for presence or
absence of red elements, but the switch between yellow
and red in the forewing, while the yellow forewing band
in H. melpomene is controlled by a separate unlinked
locus, N. Second, the rayed phenotype of H. melpomene
consists of a nail-shaped ray and a hind-wing bar that
cuts across several wing veins and appears to be vein
independent. In contrast the hind-wing rayed pattern of
H. erato appears to be entirely vein dependent with all
pattern elements lying in intervein regions. Differences
such as these between the species have led some to
speculate that the loci controlling pattern in the two
species are unlikely to be homologous (Mallet 1989).
1575
The results presented here and in a previous study
( Joron et al. 2006) imply that common genetic switch
mechanisms are responsible for convergent patterns in
H. melpomene and H. erato, and these evolved independently in the two lineages. Despite findings consistent
with this hypothesis, it may not prove true for all races of
H. melpomene. Sheppard et al. (1985) reported recombination between HmB and HmD loci, on the basis of a
series of H. melpomene progeny tests involving parental
individuals collected from Suriname or Belém do Para,
Brazil, (HmD homozygotes) and Apure in southwestern
Venezuela or Trinidad (HmB homozygotes) (Turner
and Crane 1962). Parental genotypes were calculated
on the basis of phenotypes of progeny, and in 3 of
11 cases, parents must have undergone recombination
events to produce the phenotypes observed in the progeny. From this, Sheppard et al. (1985) calculated a
crossover rate of 3/11 ¼ 27% (SE 6 13%). In contrast,
here we show HmB and HmD to be tightly linked, more
similar to that of the HeD locus in H. erato that controls
the parallel red wing phenotype. Individuals used to
genetically map the HmB/D loci in this study were
collected from Ecuador (HmD) and French Guiana
(HmB), and therefore it is possible that the genetic
linkage relationships of these loci vary across the geographic range of H. melpomene, perhaps due to chromosomal rearrangement, which would explain the
apparent discrepancy in our results. Alternatively, it
has been suggested that two genes producing similar
phenotypes to HmB may be present on LG18 ( J. R. G.
Turner, personal communication). There is evidence
to support two independent loci controlling a different
phenotype in H. melpomene: the yellow forewing band
(Mallet 1989; Mallet et al. 1990). Generally, individuals with genotypes NNNN display a strong yellow forewing band and NBNB do not. In some cases however,
field-caught individuals expected to be NBNB present a
yellow band that may be due to a second locus mm
(Mallet et al. 1990). Determining whether multiple
loci control similar phenotypes in H. melpomene requires
further crossing experiments and linkage mapping
using markers linked to known color pattern loci.
There are several cases of convergent phenotypes that
arose independently, either within the same gene or
through different adaptive mechanisms. Protas et al.
(2006) for example reported that albinism in two
isolated populations of the Mexican cave fish Astyanax
arose via independent mutations in the same pigmentation gene, Oca2. Hoekstra et al. (2006) investigated
variable coat color between subpopulations of beach
mice along the Florida Gulf Coast and identified a single
nucleotide polymorphism (SNP) in the melanocortin-1
receptor pigmentation gene (Mc1r) with a major phenotypic effect. When compared to beach mice with
similar coat variability along the Atlantic coast, the
causal-derived SNP was absent, suggesting phenotypic
adaptation evolved independently in this case. The
1576
S. W. Baxter et al.
major-effect loci that control color pattern across the
Heliconius species investigated so far demonstrate a
common ‘‘toolbox’’ of genes controlling pattern polymorphism. Between the comimetic species, homologous loci have broadly similar effects on color pattern,
suggesting functional similarities. However, the common switch loci may affect downstream pathways in
different ways, which would explain differences in mode
of action of the major loci in different lineages.
The H. numata wing-patterning supergene is controlled at a single locus ‘‘P’’ on LG15, which enables this
species to mimic specific Melinaea butterflies. According to theory, mimicry supergenes are unlikely to be
formed by bringing together unlinked patterning genes
to a single chromosomal region, e.g., via a translocation;
instead, they are more likely to originate from a major gene
mutation, followed by a series of linked modifiers to
perfect the mimicry (Charlesworth and Charlesworth
1975) or by the selection of gene clusters through a sieve
effect from redundant gene networks (Turner 1977;
LeThierry d’Ennequin et al. 1999). Our data represent
the first explicit empirical evaluation of those predictions: in accordance with theory, we have found no
genomic evidence, at this level of resolution, for the
translocation of H. numata’s HmB/HmD orthologous
region from LG18 to LG15, to form part of the P supergene. Although the translocation hypothesis may be
entirely ruled out only following definitive identification and cloning of the HmB/D genetic elements, the
formation of the P supergene in H. numata does not
appear to have involved a rearrangement of chromosomal regions unlinked in related species. Nevertheless,
it is interesting to note the differences in recombination
rates between markers RpS30 and MRSP flanking HmB
and HmD loci. In H. melpomene, 7.7 cM separates these
two genes, yet in H. numata, the region is only 2.9 cM.
The centimorgan differences may simply be an artifact
of brood size, reduced recombination, or physical
genome size differences. This lends support to the
hypothesis that the genes involved in switching red
patterns in various Heliconius species are positionally
conserved in H. numata, but play little or no role in the
gene networks underlying pattern polymorphism in this
species. Whatever the explanation, these observations
clearly imply that there is not a simple mapping of
phenotype to genotype. Instead, a conserved developmental switch has been adopted to generate both
divergent and convergent patterns in different ecological and genetic contexts.
In H. melpomene, we have demonstrated the feasibility
of cloning color pattern genes using AFLP bulk segregant analysis, coupled with a BAC screening walk.
Recombinants either side of the HmB locus were determined, within a physical distance of !700 kb, and a
recombinant bordering one side of the HmD locus was
identified, producing a larger region to search for
candidate genes. It is striking that multiple overlapping
fingerprinted contigs, each containing many clones,
were identified in the proximity of HmD/HmB. That
these clones clustered into different contigs when
fingerprint data were analyzed implies that this region
either must contain highly divergent alleles sampled in
our BAC library or possibly contains duplicated genomic segments. The H. melpomene BAC library was constructed using six pupae of unknown wing pattern from
a polymorphic laboratory population segregating for
different alleles of HmB and HmD. Consequently, it is
not unexpected that allelic variability has been sampled,
which might reflect different color patterns. Sequencing multiple, overlapping clones will therefore be a
useful tool for identifying allelic variants for future
studies of field populations.
In our crosses, the components forming HmD and
HeD (proximal red patch at the base of the forewing, the
red hind-wing bar plus red hind-wing rays) are always
observed together, in both species studied (Figure 1).
Nonetheless, these phenotypes are not always associated. Rare recombinants (or mutants) are known in
both species, in which the forewing patch and hind-wing
bar are separated from the hind-wing rays (Mallet
1989). Furthermore, the races H. melpomene meriana and
H. erato amalfreda display the red forewing proximal
patch and hind-wing bar, but not the ray phenotype.
These races and occasional recombinants suggest the
HeD and HmD loci are controlling these red pattern
elements by separate, tightly linked sites that may or may
not be part of the same gene.
The data presented here represent an important step
toward cloning the HmB/D gene(s) in H. melpomene and
HeD in H. erato. For HmB, we have now assembled a
continuous BAC tile path encompassing the locus and
are sequencing the BAC clones to identify candidate
genes (supplemental Figure 1). The recombination
fraction in H. melpomene is estimated to be 180 kb/1
cM, and just outside the HmB/D tile path (contig 1729,
Figure 4) we have found 3/372 recombinants within
!140 kb, which does not differ from expected (x2 ¼
0.25, P . 0.6). Of course, factors such as inversions,
duplications, or recombinational ‘‘deserts’’ could potentially complicate cloning of the locus, but we are
nonetheless optimistic that this study represents a
significant step toward identification of the HmB/D
gene(s). This will offer novel insights into the molecular
evolution underlying these dramatic color patterns and
the role of single loci in regulating developmental
pathways in a recent evolutionary radiation. The study
also demonstrates the feasibility of this method for
positional cloning that can be applied to other nonmodel organisms with major-effect genes of economic
or evolutionary interest.
We are grateful for the helpful comments and discussion provided
by two anonymous reviewers. Technical support was received from
Sequencing and Genotyping Facility at Universidad de Puerto Rico
and The Wellcome Trust Sanger Institute, United Kingdom. The
Mimicry in Heliconius Butterflies
Ministerio del Ambiente in Ecuador granted permission to collect
butterflies and Autoridad Nacional del Medio Ambiente granted
permission to work in Panama. This work was supported by the
Biotechnology and Biological Sciences Research Council, the National
Science Foundation (DEB-0715096 and IBN-0344705), the Royal
Society, and the Smithsonian Tropical Research Institute.
LITERATURE CITED
Brugmans, B., A. Fernandez del Carmen, C. W. B. Bachem, H. van
Os, H. van Eck et al., 2002 A novel method for the construction
of genome wide transcriptome maps. Plant J. 31: 211–222.
Charlesworth, D., and B. Charlesworth, 1975 Theoretical genetics of Batesian mimicry. 2. Evolution of supergenes. J. Theor.
Biol. 55: 305–324.
Colosimo, P., K. Hosemann, S. Balabhadra, G. J. Villarreal, M.
Dickson et al., 2005 Widespread parallel evolution in sticklebacks by repeated fixation of Ectodysplasin alleles. Science
307: 1928–1933.
Gahan, L. J., F. Gould and D. G. Heckel, 2001 Identification of a
gene associated with Bt resistance in Heliothis virescens. Science
293: 857–860.
Heckel, D. G., L. J. Gahan, J. C. Daly and S. Trowell, 1998 A genomic approach to understanding Heliothis and Helicoverpa
resistance to chemical and biological insecticides. Philos. Trans.
R. Soc. Lond. B, Biol. Sci. 353: 1713–1722.
Heckel, D. G., L. J. Gahan, Y. B. Liu and B. E. Tabashnik,
1999 Genetic mapping of resistance to Bacillus thuringiensis
toxins in diamondback moth using biphasic linkage analysis.
Proc. Natl. Acad. Sci. USA 96: 8373–8377.
Hoekstra, H. E., R. J. Hirschmann, R. A. Bundey, P. A. Insel and J.
P. Crossland, 2006 A single amino acid mutation contributes
to adaptive beach mouse color pattern. Science 313: 101–104.
Humphray, S., S. Knaggs and I. Ragoussis, 2001 Contiguation of
bacterial clones. Methods Mol. Biol. 175: 69–108.
Jiggins, C. D., J. Mavarez, M. Beltrán, O. McMillan, J. S. Johnston
et al., 2005 A genetic linkage map of the mimetic butterfly, Heliconius melpomene. Genetics 171: 557–570.
Jiggins, C. D., and W. O. McMillan, 1997 The genetic basis of an
adaptive radiation; mimicry in two Heliconius sibling species.
Proc. R. Soc. Lond. B 264: 1167–1175.
Joron, M., R. Papa, M. Beltrán, N. Chamberlain, J. Mavarez et al.,
2006 A conserved supergene locus controls colour pattern diversity in Heliconius butterflies. PLoS Biol. 4: 1831–1840.
Kapan, D. D., N. S. Flanagan, A. Tobler, R. Papa, R. D. Reed et al.,
2006 Localization of Müllerian mimicry genes on a dense linkage map of Heliconius erato. Genetics 173: 735–757.
Kazachkova, N., J. Fahleson and J. Meijer, 2004 Establishment of
the amplified fragment length polymorphism (AFLP) technique
for genotyping of pollen beetle (Meligethes aeneus): a noxious insect
pest on oilseed rape (Brassica napus). Mol. Biol. Rep. 31: 37–42.
Kronforst, M., D. Kapan and L. Gilbert, 2006a Parallel genetic
architecture of parallel adaptive radiations in mimetic Heliconius butterflies. Genetics 174: 535–539.
Kronforst, M., L. Young, D. Kapan, C. McNeely, R. O’Neill et al.,
2006b Linkage of butterfly mate preference and wing color
preference cue at the genomic location of wingless. Proc. Natl.
Acad. Sci. USA 103: 6575–6580.
Le Thierry d’Ennequin, M., B. Toupance, T. Robert, B. Godelle
and P. H. Gouyon, 1999 Plant domestication: a model for
studying the evolution of linkage. J. Evol. Biol. 12: 1138–1147.
1577
Maeda, T., 1939 Chiasma studies in the silkworm Bombyx mori. Jpn.
J. Genet. 15: 118–127.
Mallet, J., 1989 The genetics of warning colour in Peruvian hybrid
zones of Heliconius erato and H. melpomene. Proc. R. Soc. Lond. B
236: 163–185.
Mallet, J., N. Barton, G. Lamas, J. Santisteban, M. Muedas et al.,
1990 Estimates of selection and gene flow from measures of
cline width and linkage disequilibrium in Heliconius hybrid
zones. Genetics 124: 921–936.
Michelmore, R. W., I. Paran and R. V. Kesseli, 1991 Identification
of markers linked to disease-resistance genes by bulked segregant
analysis: a rapid method to detect markers in specific genomic
regions by using segregating populations. Proc. Natl. Acad. Sci.
USA 88: 9828–9832.
Mundy, N. I., 2005 A window on the genetics of evolution: MC1R and
plumage colouration in birds. Proc. Biol. Sci. 272: 1633–1640.
Nachman, M. W., H. E. Hoekstra and S. L. D’Agostino, 2003 The
genetic basis of adaptive melanism in pocket mice. Proc. Natl.
Acad. Sci. USA 100: 5268–5273.
Nijhout, H. F., 1991 The Development and Evolution of Butterfly Wing
Patterns. Smithsonian Institution Press, Washington, DC.
Pringle, E. G., S. W. Baxter, C. L. Webster, A. Papanicolaou, S. F.
Lee et al., 2007 Synteny and chromosome evolution in the Lepidoptera: evidence from mapping in Heliconius melpomene. Genetics 177: 417–426.
Protas, M. E., C. Hersey, D. Kochanek, Y. Zhou, H. Wilkens et al.,
2006 Genetic analysis of cavefish reveals molecular convergence in the evolution of albinism. Nat. Genet. 38: 107–111.
Schein, J., T. Kucaba, M. Sekhon, D. Smailus, R. Waterston et al.,
2004 High-throughput BAC fingerprinting. Methods Mol. Biol.
255: 143–156.
Shapiro, M., M. Marks, C. Peichel, B. Blackman, K. Nereng
et al., 2004 Genetic and developmental basis of evolutionary pelvic reduction in threespine sticklebacks. Nature 428: 717–723.
Sheppard, P. M., J. R. G. Turner, K. S. Brown, W. W. Benson and M.
C. Singer, 1985 Genetics and the evolution of Müllerian mimicry in Heliconius butterflies. Philos. Trans. R. Soc. Lond. B 308:
433–613.
Soderlund, C., S. Humphray, A. Dunham and L. French, 2000 Contigs
built with fingerprints, markers, and FPC V4.7. Genome Res. 10:
1772–1787.
Steiner, C. C., J. N. Weber and H. E. Hoekstra, 2007 Adaptive variation in beach mice produced by two interacting pigmentation
genes. PLoS Biol. 5: 1880–1889.
Traut, W., 1977 A study of recombination, formation of chiasmata
and synaptonemal complexes in female and male meiosis of
Ephestia kuehniella (Lepidoptera). Genetica 47: 135–142.
Turner, J. R. G., 1972 The genetics of some polymorphic forms of
the butterflies Heliconius melpomene (Linnaeus) and Heliconius erato (Linnaeus). II. The hybridization of subspecies of H. melpomene from Surinam and Trinidad. Zoologica 56: 125–157.
Turner, J. R. G., 1977 Butterfly mimicry: the genetical evolution of
an adaptation. Evol. Biol. 10: 163–206.
Turner, J. R. G., and J. Crane, 1962 The genetics of some polymorphic forms of the butterflies Heliconius melpomene Linnaeus
and Heliconius erato Linnaeus. I. Major genes. Zoologica 47:
141–152.
Turner, J. R. G., and Sheppard, 1975 Absence of crossing-over in
female butterflies (Heliconius). Heredity 34: 265–269.
Communicating editor: D. Rand