* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Investigating the effects of different types of mutations
RNA polymerase II holoenzyme wikipedia , lookup
RNA silencing wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Biochemistry wikipedia , lookup
Real-time polymerase chain reaction wikipedia , lookup
Gene regulatory network wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Gene nomenclature wikipedia , lookup
Endogenous retrovirus wikipedia , lookup
Expression vector wikipedia , lookup
Epitranscriptome wikipedia , lookup
Ancestral sequence reconstruction wikipedia , lookup
Proteolysis wikipedia , lookup
Promoter (genetics) wikipedia , lookup
Transcriptional regulation wikipedia , lookup
Non-coding DNA wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Community fingerprinting wikipedia , lookup
Protein structure prediction wikipedia , lookup
Biosynthesis wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Genetic code wikipedia , lookup
Nucleic acid analogue wikipedia , lookup
Deoxyribozyme wikipedia , lookup
Gene expression wikipedia , lookup
Molecular evolution wikipedia , lookup
Silencer (genetics) wikipedia , lookup
Investigating the effects of different types of mutations The Genetic Code How does information go from a sequence made of the four different bases of DNA (adenine, guanine, thymine and cytosine) to a protein sequence made up of one of 20 different amino acids? The sequence of DNA that encodes for a protein is called a gene. Genes encode for all proteinsfrom the enzymes needed in respiration to the tough keratin protein that makes up your fingernails. The first step in the production of a protein is creating a messenger that can pass from the DNA in the nucleus to the ribosomes in the endoplasmic reticulum. This messenger is RNA and the process of making RNA from DNA is called transcription. In the endoplasmic reticulum the RNA binds to a ribosome which is made of two subunits, large and small. The ribosome moves along the messenger RNA. At each codon a tRNA with a complementary sequence to the codon and carrying an amino acid enters the ribosome. The ribosome takes the amino acid and adds it to the growing chain of amino acids (also known peptide). When the ribosome encounters one of the three stop codons it releases the completed protein and the RNA message. http://www.nature.com/nature/journal/v443/n7107/fig_tab/nature05002_F1.html So from the DNA sequence of a gene it is possible to predict the RNA sequence, and in turn the primary sequence (the order of the amino acids) of the protein it encodes. Amino acids can be referred to by name (eg Glycine), by three letter abbreviation (Gly) or by single letter abbreviation (G). For example Step #1: Transcribe DNA RNA Remember, RNA does not have thymine, it has uracil instead. So: AU TA CG GC For example: DNA (decode top strand) ACATCTTATACGTTC TGTAGAATATGCAAG UGUAGAAUAUGCAAG Becomes RNA Step #2: Translate RNA Protein (chain of amino acids) Second Letter U C A UUU UAU UCC UAC UGC UUA UCA UAA UGA UUG UCG UAG UGG CUU CCU CAU CUC CCC CAC C CCA CAA CUA CUG A CCG Proline (P) CAG Stop (*) Histidine (H) Glutamine (Q) CGA Asparagine (N) AGU CGG AAU AUC ACC AAC ACA AAA AGA AAG AGG Serine (S) ACG Threonine (T) GUU GCU GAU GUC GCC GAC GUA GCA GAA GUG Valine (V) Arginine (R) AGC Isoleucine (I) Methionine (M) Tryptophan (W) CGC ACU AUA Cysteine (C) Stop (*) CGU AUU AUG G Leucine (L) Serine (S) UGU GCG Alanine (A) GAG Lysine (K) Aspartic acid (D) Glutamic acid (E) Arginine (R) GGU GGC GGA GGG Glycine (G) U C A G U C A G U C A G U C A G Third Letter First Letter U Tyrosine (Y) G UCU UUC Phenylalanine (F) For example: RNA Becomes protein UGUAGAAUAUGCAAG C R I C K What do the following secret DNA messages say? Message 1 CCGCTTTTACTCTGATAGACGAGT GGCGAAAATGAGACTATCTGCTCA Message 2 TCGACATATCTTTTAACGCTT AGCTGTATAGAAAATTGCGAA Message 3 CTATTGCGCTAGAGTTTGCTTCGTTGG GATAACGCGATCTCAAACGAAGCAACC Message 4 ACCGTAATATACCTC? TGGCATTATATGGAG What is one possible DNA sequence that would encode for the protein HELP ME Mutations Every now and then the sequence of DNA can change. This can be due to damage to the DNA by chemicals or radiation such as UV light, or by errors made during transcription. There are a number of different types of mutation and these mutations have different effects on the protein. For example, consider the DNA sequence: ATGATCAGTACCGCGAAAGAA TACTAGTCATGGCGCTTTCTT What would the protein sequence be? Now consider the different mutations in the table below. Work out the sequence of the protein from the DNA sequence and rate how severe you think the effects of the mutation are from 0 (no change) to 10 (major change). Note, if you find a stop codon, write a * and don’t decode the rest of the sequence. Q Type of mutation 1 2 3 4 5 Original sequence Single base change Single base change Single base change Single base insertion Single base deletion Large insertion Large insertion Large deletion Large deletion Large deletion 6 7 8 9 10 11 DNA sequence Protein sequence ATGATCAGTACCGCGAAAGAA Severity 0 ATGAACAGTACCGCGAAAGAA ATGATCAGTACCGCGAAGGAA GTGATCAGTACCGCGAAAGAA ATGATCAAGTACCGCGAAAGAA ATGACAGTACCGCGAAAGAA ATGATCAGTACCACTAUGGCGAAAGAA A T G A T C A G A A A A AT A C C G C G A A A G A A ATGAAAGAA ATG ATGATCAGTACCAAAGAA Q12. Did all single base change mutations have the same in severity? Explain your answer. Q13. Did all insertion and deletion mutations have the same severity? Explain your answer. Q14. Most proteins are encoded from genes that are about 3 kbp (3000 base pairs in length). How long would a typical protein be? Q15. In general, what sort of mutation (or mutations) would have the greatest effect on the function of the protein? The least? Justify your answer. Q16. A 3.3 kbp gene encoding for a protein that produces melanin (hair pigment) in rats has 300 bases deleted from the middle of the sequence. Do you think the protein will still be functional? Explain your answer. Q17. If this mutation was in the only functional copy of this gene in the individual (ie, assume the other copy of this gene on the other chromosome was already non-functional but one normal copy of the gene is enough for normal melanin production), what do you think the phenotype (appearance) of the rat will be. Why? Q18. A 2.5 kbp gene encoding for a protein important for the production of petals in a daisy has a single base change 369 bp into the gene sequence. Do you think the resultant protein from this mutated gene will be functional? Explain your answer. Q19. If this mutation was in the only functional copy of this gene in the plant (ie, assume the other copy of this gene on the other chromosome was already non-functional but one normal copy of the gene is enough for a normal flower), what do you think the phenotype (appearance) of the daisy will be. Why?