Download Frequent Loss of Heterozygosity at the TEL Gene Locus

RAPID COMMUNICATION
Frequent Loss of Heterozygosity at the TEL Gene Locus in Acute
Lymphoblastic Leukemia of Childhood
By Kimberly Stegmaier, Shona Pendse, George F. Barker, Patricia Bray-Ward, David C. Ward, Kate T. Montgomery,
Kenneth S. Krauter, Carol Reynolds, Jeffrey Sklar, Mia Donnelly, Stefan K. Bohlander, Janet D. Rowley,
Stephen E. Sallan, D. Gary Gilliland, and Todd R. Golub
TEL is a new member of the ETS family of transcription
factors which is rearranged in a numberof hematologic malignancies with translocations involving chromosome band
1 2 ~ 1 3In
. some cases, both TEL alleles are affected, resulting
in loss of wild-type TEL function in the leukemic cells. In
addition, 5% of children with acute lymphoblastic leukemia
(ALL)have 12p12-pl3 deletions,suggesting that a tumor
suppressor gene resides on 12p. These observationsled us
to consider whether TEL loss of function may contribute to
the pathogenesis of ALL. In this report we show that the
TEL gene maps between the polymorphic markers D12S89
and D12S98, and we use these flanking markers to screen
paired diagnosis and remission samples from 81 children
with ALL for loss of heterozygosity (LOH) at the TEL gene
locus. Fifteen percent of informative patients showed E L
LOH which was not evident on cytogenetic analysis.
Detailed
examination of patients with LOH at this locus showedthat
the critically deleted region included two candidate tumor
suppressorgenes: TEL and KIPI, the geneencoding the
cyclin-dependent kinase inhibitor p27. These studies show
that LOH at the TEL locus is a frequent finding in childhood
ALL.
0 1995 by The American Society of Hematology.
T
results in unregulated ABL tyrosine kinase activity.‘” Chimeric transcription factors such as the E2A-PBX1 fusion
arising from the t(1; 19)(q23;p13) translocation inpre-B
ALL have been shown to act as dominant transforming proteins in cell culture and animal
A number of
fusion partners have also been identified for the MLL gene,
which is frequently rearranged in leukemias with translocations involving 11q23.I4
A recent addition to this group of chimeric transcription
factors is the TEL-AMLl fusion, which is the consequence
of the t(12;21)(p13;q22) associated with childhood pre-B
ALL.’’ AMLl is the DNA-binding subunit of core binding
factor (CBF), and has also been implicated in the pathogenesis of myeloid leukemias.“ TEL is a putative transcription
factor belonging to the ETS family of DNA-binding proteins,
and was initially identified because of its fusion to the platelet-derived growth factor receptor p gene in chronic myelomonocytic leukemia (CMML).” One of the striking findings
in patients with TEL-AML1 fusions is that the other TEL
allele is deleted, resulting in foss of wild-type TEL function
in the leukemic cells. Loss of wild-type TEL function is
similarly observed in some patients with TEL-ABL fusions,
in which one TEL allele is disrupted by a chromosomal
translocation, and the other allele is deleted.’*
These findings ledus to consider whetherloss of TEL
function may contribute to the pathogenesis of human leukemia. The TEL gene mapsto chromosome band 1 2 ~ 1 3 a,
region of the genome that is involved in cytogenetically
apparent deletions in 5% of childhood
In addition,
fluorescence in situ hybridization (FISH) analysis of hematologic malignancies selected for the presence of cytogenetically evident deletions of 12p13 showed that the TEL gene
is within the commonly deleted region of 12p.” However,
the incidence of loss of heterozygosity (LOH) at this locus
is not known. In this report we place the TEL gene on the
emerging chromosome 12 physical map, identify neighboring polymorphic microsatellite markers, anduse these
markers to screen for LOH at the TEL gene locus in a large
series of patients with childhood ALL. We find that TEL is
deleted in 15% of children with ALL, representing one of the
HE GENETIC BASIS of acute lymphoblastic leukemia
(ALL) is becoming better understood as the common
chromosomal rearrangements associated with the disease are
cloned. Among the best studied of these abnormalities are
DNA rearrangements that result in overexpression of otherwise normal transcription factors as a consequence of their
juxtaposition with either Ig or T-cell receptor regulatory elements. Examples include overexpression of MYC in B-cell
leukemias,’ and overexpression of SCL/TALl or RBTNl in
T-cell
Another class of transforming proteins implicated in the
pathogenesis of ALL includes chimeric proteins resulting
from chromosomal translocations. For example, the BCRABL fusion protein is the consequence of the t(9;22)
(q34;qll) translocation, or Philadelphia chromosome, and
From the Division of Hemutology/Oncology and the Department
of Pathology, Brigham and Women’s Hospital, Harvard Medical
School. Bosron. MA; the Department of Genetics, Yale University,
New Haven, CT; the Depurtrnent of Cell Biofogy, AIbert Einstein
College of Medicine, Yeshiva University. Bronx, NY; the Division of
Biostatistics. Quality Control Center, Dana-Farber CancerInstitute,
Boston, MA; the Section of Hematolog)~/Oncology,University of
Chicago, Chicago,IL; and the Division of Pediatric Oncology, Children‘s Hospital and Dana-Farber Cancer Institute, Harvard Medical School, Boston, MA.
Submitted March 9, 1995; accepted April 14, 1995.
Supported in part by National Cancer Institute Grants No. CA
42557(J.D.R.) and CA 57261 (D.G.G.). Department of Energy
Grant No. FG02-86ER60408(J.D.R.), and National Institutes of
Health Grants No. POIHG00965 (K.T.M., K.S.K.), CA 68484
(S.E.S.). and DLO1977-05 and IPSO DK49216-01 (T.R.G.). K.S. is
a Howard Hughes Medical Institute Medical Student Fellow.
Address reprint requests to Todd R. Golub, MD,Division of Pediatric Oncology, Dana-Farber Cancer
Institute, 44 Binney St, Boston,
MA 021 15.
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be hereby marked
“advertisement” in accordance with 18 V.S.C. section 1734 solely to
indicate this fact.
0 1995 by The American Society of Hematology.
0006-4971/95/8601-0055$3.00/0
38
Blood, Vol 86, No 1 (July l ) , 1995: pp 38-44
E L LOH IN CHILDHOOD ALL
39
most common genetic abnormalities reported in childhood
leukemia.
MATERIALS AND METHODS
Identification of yeast artifcial chromosomes (YACs) containing
the TEL gene. A series of YACs mapping to12p12-pl3 was
screened by polymerase chain reaction (PCR) using oligonucleotide
primers derived from the 3’ untranslated region of the TEL cDNA.
Primers 350-1 (5’-GGAATCTCTCCATCTGTAATTCCTCACCCT-3‘) and 350-2 (5“CCACGTGGCAGGAAAAAGAGGAACCTGA-3’) were used in 30 cycles of PCR (94°C X 1’; 58°C X l’;
72°C X 1’) to amplify a 250-bp fragment from genomic DNA. YACs
positive for TEL by PCR were confirmed by Southern blotting using
a full-length TEL cDNA probe as previously described.” The KIPlcontaining YAC 954g10 was similarly obtained using the primers
77 (5”TTGCCGAGTTCTACTACAGA-3‘)
and 80 (5”TGCGTCCACAAATGCGTGTC-3’).
FISH. Bone marrow (BM) cells from a patient with CMML
and t(5; 12)(q33;p13) translocation (patient 1 in reference 17) were
cultured overnight and arrested in metaphase with colcemid. After
fixation in methano1:acetic acid 3:1, the cells were air dried on glass
slides. Total yeast DNA from a clone containing YAC 912d5 was
biotinylated using a nick translation kit (BRL, Gaithersburg, MD)
and purified over a Sephadex G-50 (Pharmacia, Piscataway, NJ)
spin column. A cosmid mapping to 5p was similarly prepared, and
was used to identify chromosome 5. The chromosome 12-specific
centromeric probe was purchased from Oncor. Hybridization was
performed as previously described,” and the probes were detected
with fluorescein avidin (Vector Laboratories, Burlingame, CA). The
images were visualized on a Zeiss Axioskop epifluorescence microscope coupled to a cooled CCD camera. The fluorescein and propidium iodide images were recorded separately as gray-scale images,
pseudocolored and merged using Gene Join and Adobe Photoshop.
Patient eligibility and sample preparation. Children less than
18 years of age who were enrolled on Dana-Farber Cancer Institute
protocols 87-001 or 91-001 for childhood ALL between February
1, 1991 and May 31, 1993, were eligible for study. Patient samples
were procured with informed consent. Only patients for whom BM
samples were available at diagnosis and for whom either BM or
peripheral blood (PB) samples were available during remission were
studied. Selection of patients was made without regard to BM karyotype, immunophenotype, or clinical course. After mononuclear cell
isolation by Ficoll sedimentation, 10 pL of the mononuclear cell
pellet was boiled for 10 minutes in 100 pL water and centrifuged
for 5 minutes at 12,OOOg. One microliter of the supernatant was used
for PCR. In some cases, genomic DNA was prepared using standard
methods,” and 20 to 100 ng of DNA was used for PCR.
Microsatellite PCR analysis. Forty cycles of PCR(94°C X 1’;
58°C X l’; 72°C X 1’) were performed using an MJ (Watertown,
MA) thermal cycler as previously described.“ One of the oligonucleotide primers was end-labeled with y3’P-ATP using polynucleotide
kinase (New England Biolabs, Beverly, MA). The primer combinations, some of which have been previously reported:’ are shown in
Table 1.PCR products were separated on formamide-containing
polyacrylamide gels, and were visualized by autoradiography. Genotypes were scored, and LOH was assigned when a microsatellite
allele was absent at diagnosis but present in remission.
RESULTS
Genomic localization of the TEL gene. To facilitate the
study of loss of heterozygosity at the TEL locus, it was
necessary to determine its precise genomic localization. A
series of YACs mapping to 12p12-pl3 was obtained from
the CEPH mega-YAC library based on YAC sequence
tagged site (STS) content (P.B.-W., D.C.W., unpublished
results, March 1994), and these YACs were then screened
by PCR. Oligonucleotide primers derived from the 3’ untranslated region of TEL identified the following YACs:
912d5, 964~10,74883, 720hl1, and 958b8. Southern blotting of PCR-positive YACs with a full-length TEL cDNA
verified the presence of the TEL gene on these clones (data
not shown).
To confirm the mapping of TEL to these YACs, TELpositive YACs were used as probes for metaphase FISH
analysis of a patient with t(5; 12)(q33;p13) CMML, which
is known to disrupt the TEL gene.” As shown for YAC
912d5 in Fig 1, one YAC signal was visualized on the normal
copy of chromosome 12, and the other YAC signal was split
between the derivative chromosome 12 and the derivative
chromosome 5. This result showed that YAC 912d5 indeed
contained the TEL gene, enabling the TEL locus to be integrated into the existing 12p physical map.
Based on the STS content of TEL-positive YACs,the TEL
gene was placed between the markers D12S89 and D12S98
(Fig 2). D12S89, TEL, and D12S98 are all present on the
720-kb YAC 720hl1, suggesting that the maximum distance
separating D12S89 and D12S98 is 720 kb. Figure 2 also
illustrates the close proximity of the TEL gene to the KIPl
Table 1. Microsatellite Primer Sequences
Marker
D12S336
D12S77
D12S89
GACCCCGTGCTA
D12S98
D12S358
AAAAAGGTGCCTCCCATTTA
GGCAGCCAAATAACACATCT
D l 2S320
D125364
CCCTGGAAGTCCCATC
CCTTCTCTCTTCCTCC
G
D12S269
D12S308
D12S70
D12S62
D12S363
CA Strand
GGGGCATGAGAATCGC
GAAGGGCAACAACAGTGAA
ATTTGAGAGCAGCGTGm
GCCTITGGGAAACTTTGG
GT Strand
TGGCAAGGATGTAGAGTGG
CICTCCCCCACTC
CCATATGGGGAGTAGGGGT
CAAAGCCTGACGTAGAAGCAIT
GCACAGATGAGATCCCGT
CCAGTCCTGAACAGGC
TGTGCAGACATCAAAAGGA
TGTAGAAAAGAGAATGATGATGCC
ATCTTGAAGCCCTGTGCAAG
GAGGGGTGGCATCTCT
Primer sequences are shown in 5’ + 3’ orientation.
AACCATCTGGGCITGGA
TTACTATCTACCCCCTGACTGACA
CAGAGAmCTTAAATGCCT
CTCAAATGAAATCAGCATAAA
STEGMAIER ET AL
40
L
L'
Fig 1. FISH mapping of YAC 91245. YAC 912d5 containing the E L gene was hybridized to metaphase chromosomes of a patient with
t15;12Nq33;pl3) CMML known t o disrupt the E L gene. The two copies of chromosome 12 are visualized with a chromosome 12-specific
centromeric probe (yellow) and the derivative chromosome 5 is visualized with a probe (green) mapping to 5p. The YAC signals (red) are
visualized onthe normal chromosome 12, the derivative 12, and the derivative 5, indicating that theYAC 912d5 spansthe t(5;12) translocation
breakpoint.
gene encoding the cyclin-dependent kinase (cdk) inhibitor
maps to the 1,520-kb YAC 954g10:'
which
~ 2 7 ? ~ .k7Pl
"
overlaps with the 1,390 kb
TEL YAC 964~10.
The maximum
distanceseparating TEL and KIP1 is therefore2,910kb,
although the actual distance is likely smaller, because there
is some overlap between the two YACs.
Screening for LOH ut the TEL locus. Having localized
the TEL gene relative to known markers in the region (Fig
2), the flanking polymorphic microsatellite markers D12S89
and D12S98 were usedto screen matched pairs of leukemic
ALL
andremissionsamplesobtainedfromchildrenwith
who were treated on Dana-Farber Cancer Institute protocols
87-001 or 91-001.Eighty-onepatientswereeligiblefor
study. Analysis of remission marrow
or PB samples showed
that 63/81 (78%) of patients were informative (heterozygous)
at D12S89, and 53/81 (65%) were informative at D12S98.
TEL LOH IN CHILDHOOD ALL
41
YACs
W
m
/I
/l
/
*
D125336
+
-
w
%
m
W
.
I
0
N
g
D12S89
TEL
Dl 2S98
Dl 26358
\ 1
\t
Dl 2S364
KIP7
D12S363
W
m
-
P
IC)
\
marker D12S77 and the centromeric marker D12S70 was
delineated. This region, deleted in all nine patients, contains
both the TEL gene and the gene encoding p27, KIPI.
Using the Fisher exact test algorithm,29there was nocorrelation between LOH at the TEL locus and patient gender,
age at diagnosis, immunophenotype, risk group, or remission
status, although the duration of follow-up is short (data not
shown). Cytogenetic analysis was available for 58/81 (72%)
patients evaluated. Only 1 of the 58 patients had cytogenetic
findings suspicious for loss of genetic material from 12p,
and this patient (patient 8) was among the nine patients who
exhibited LOH at the TEL locus (Table 3). Patient 8 has
extra material on the short arm of chromosome 12
[add( 12p)], likely the result of an unbalanced translocation.
Such an unbalanced translocation would result in the loss of
the telomeric portion of 12p. The remainder of the patients
with TEL LOH had deletions too small to be detectable by
routine cytogenetic analysis.
0
DISCUSSION
12
Fig 2. Physical mapping of the E L gene. The location of the TEL
gene relative to other chromosome 12 markers is shown. E L is
flanked by the markers D12S89 and D12S98, which are both present
on the 720-kb EL YAC 720hll. E L and KIP1 are present on the
overlapping YACs 9 6 4 4 0 and 954010. respectively.
Leukemic BM samples of informative patients were then
screened for LOH at D12S89 and D12S98 (Table 2). Nine
of 63 (14%) patients had LOH at marker D12S89. The same
9 patients (9/53 or 17%) had LOH at D12S98. Because
D12S89 and D12S98 flank the TEL gene, the incidence of
LOH at the TEL locus in this childhood ALL population is
also 14% to 17%, or approximately 15%.
The nine patients with TEL LOH were studied in more
detail to determine the extent of the deletions in each patient.
Ten additional polymorphic microsatellite markers were
placed on the physical map (K.T.M.,K.S.K., unpublished
results, 1994) and were analyzed for LOH. An example of
this type of analysis is shown for patient 4 in Fig 3. Patient
4 had LOH at markers D12S89, D12S98, and D123358, was
not informative at D12S364, and showed no LOH at markers
D12S336 and D12S363. The results using all markers in the
nine patients with TEL LOH are shown schematically in Fig
4. A critically deleted region bordered bythe telomeric
Interstitial deletions of the short arm of chromosome 12
have been observed at the cytogenetic level in a wide variety
of hematopoietic neoplasms, and are particularly common
in childhood ALL.I9 This has led to the hypothesis that a
tumor suppressor gene maymap to 12pl2-pl3, although
candidate genes have not been identified. In this report we
have shown that LOH at the TEL gene locus on 12pI3 occurs
in approximately 15% of childhood ALL, thus ranking it
among the most common genetic abnormalities identified in
childhood cancer. It is not surprising that the frequency of
LOH detected by PCR is considerably higher than the 5%
incidence of 12p deletions reported at the cytogenetic level,
because small deletions maynotbe detectable by routine
cytogenetic analysis. In fact, only one of the patients with
TEL LOH in this study for whom BM karyotypes were available showed cytogenetic evidence of 12p deletion.
The screening strategy used in this study used two polymorphic microsatellite markers (D12S89 and D1 2898)
which flank the TEL gene. This approach offers several advantages compared with other methods of screening for gene
deletion, such as interphase FISH, competitive genomic hybridization, and Southern blotting. First, only small amounts
of genomic DNA are needed for this PCR-based assay, facilitating the screening of large numbers of patients efficiently.
Second, because the patients' normal heterozygous hematopoietic cells serve as the internal control, the need for quantitative Southern blotting techniques to measure gene dosage
Table 2. LOH at the
Marker
Patients Studied
E L Locus in Childhood ALL
LOH
Informative
~
D12S89
D12S98
81
81
63/81 (78%)
53/81 (65%)
~~
~~
9/63 ( 14%)
9/53 (17%)
Eighty-one remission BM or PB samples were analyzed at the indicated microsatellite markers. Patients were judged to be informative
if heterozygous at that locus. Leukemic marrow samples from informative patients were analyzed for loss of one of the two alleles, indicative of LOH.
STEGMAIER ET AL
42
D 1 2 S 3 3D61 2 S 8D91 2 S 9D81 2 S 3 5D81 2 S 3 6D41 2 S 3 6 3
LLLLLL
R
R
R
R
R
R
Fig 3. Patient 4 microsatellite analysis. The allelotypes for patient4 at six markers are shown. Leukemic (L) and remission (R) DNA samples
were amplified with 32P-labeledprimers and the PCR products visualized by autoradiography after separation on polyacrylamide gels. There
is no LOH at marker D12S336 or D12S363, because the ratio of the upper and lower alleles is the same in the L and R samples. For many
markers, the lower allele is preferentially amplified compared with the upper allele. Markers D12S89,D12S98, and D12S358 show LOH,
exhibiting a relative diminution
of one of the two alleles in the leukemic sample. The deleted allele is not entirely
absent because some normal
cells are present in the marrow sample. The patient is homozygous atD12S364, and therefore not informative.
isnot required. Finally, the integration of microsatellite
markers into the expanding physical map facilitates the use
of ordered, neighboring markers to delineate the precise
boundaries of deletions in individual patients. One limitation
of PCR-based screening methods is that only heterozygous
individuals canbe
evaluated for LOH. For the marker
D12S89, for example, only 78% of the 81 patients studied
were informative. In addition, gene duplication, resulting in
PCR amplification of one allele in excess of the other, can be
mistaken for gene deletion. The determination of the precise
incidence of TEL LOH in hematologic malignancy will require larger studies using multiple genetic markers and complementary techniques for assessing gene dosage.
The critically deleted region of 12p is bordered by the
telomeric marker D1 2377 and the centromeric marker
D1 2S70. This invariably deleted region contains two candidate genes, TEL and K I P ] . In further support of this, FISH
analysis of hematologic malignancies with cytogenetically
apparent 1 2 ~ 1 3deletions has recently shown that TEL and
KIP1 map within the commonly deleted region of 12p.'* Our
interest in TEL as a potential tumor suppressor gene arose
from the observation that both TEL alleles are affected in
some patients with ALL. In particular, the t( 12;21)(p13;q22)
translocation associated with childhood ALL results in fusion of TEL to the AMLI gene on chromosome 2 1 . l 5 However, in both of the cases studied the other TEL allele was
deleted, resulting in the absence of an)' :'d-tvPe TEL expression in the leukemic cells. Itis not CILII i'lom these
Patients
1 2 3 4 5 6 7 8 9
0
D12589
TEL +
41
D12598
41
D125358
0
D12S320
a1
D125364
0 D125269
KIP1
a present
0 deleted
X informative
not
+
0
D125308
0
D12570
41 D12562
0
D125363
critically
deleted
region
Fig 4. Critically deleted region of12p. Microsatellite analysis of the9 patients with LOH at
the TEL locus is shown. Leukemic and remission marrow samples were amplified with the indicatedmicrosatellite
markers
and assessed for LOH. The critical region deleted in all patients
is
bordered
by D12S77 and
D12S70, and includes both TEL
and KIP1.
43
TEL LOH IN CHILDHOOD ALL
2. Brown L, Cheng J-T, Chen Q, Siciliano MJ, Crist W, Buchanan
G, Baer R: Site-specific recombination of the tal-l gene is a common
occurrence in human T cell leukemia. EMBO J 9:3343, 1990
1
Not available
3. Begley C, Aplan P, Davey M, Nakahar K, Tchorz K,Kurtzberg
2
46,XY
J, Hershfield M, Haynes B, Cohen D, Waldmann T, Kirsch I: Chro3
56,XX,+1,+5,+6,+6,+8,+10,+11,+12,-14,+15,+17,+18,
mosomal translocation in a human leukemic stem cell line disrupts
-19,+21,+22,+mar,+X
the T-cell antigen receptor &chain diversity region and results in a
46,XY
previously unreported fusion transcript. Proc Natl Acad Sci USA
56,XX,+4,+6,+10,+14,+17,+18,+21,+21,+21
86:2031, 1989
46,XY
4. Finger L, Kagan J, Chistopher G, Kurtzberg J, Hershfield M,
46,XY
Nowell P, Croce C: Involvement of the Tc15 gene on human chromo47,XX,-13,+16,-21,de1~2)(q23q33),add~12p~,+mar,+mar
some 1 in T-cell leukemia and melanoma. Proc Natl Acad Sci USA
46,XX
865039, 1989
5 . McGuire E, Hockett R, Pollock K, Bartholdi M, O'Brien S,
No evaluable metaphases were obtained from patient 1.
Korsmeyer S: The t(l1; 14)(p15;ql1) in a T-cell acute lymphoblastic
leukemia cell line activates multiple transcripts, including Ttg-l, a
gene encoding a potential zinc finger protein. Mol Cell Biol 9:2124,
patients whether loss of TEL function alone is oncogenic,
1989
6. Clark S, McLaughlin J, Timmons M, Pendergast A, Ben-Neor whether deletion of the other allele serves to potentiate
riah Y, Dow L, Crist W, Rovera G , Smith S , Witte 0: Expression
the activity of dominant fusion proteins involving TEL.
of a distinctive bcr/abl oncogene in Phl-positive acute lymphocytic
TEL is a new member of the ETS family of transcription
leukemia (ALL). Science 239:775, 1988
factors, joining FLI-1 and ERG as ETS proteins associated
7. Ben-Neriah Y, Daley G, Mes-Masson A, Witte 0, Baltimore
with human ~ a n c e r . ~ 'However,
.~~
to date there is no direct
D: The chronic myelogenous leukemia-specific p210 protein is the
evidence implicating ETS proteins as tumor suppressors. Inproduct of the bcr/abl hybrid gene. Science 233:212, 1986
terestingly, of all the ETS family members, TEL is most
8. Konopka JB, Watanabe SM, Witte ON: An alteration of the
homologous to the Drosophila ETS protein yan, a transcriphumanc-ab1 protein in K562 leukemia cells unmasks associated
tional repressor.32s33
Whether TEL is also a transcriptional
tyrosine kinase activity. Cell 37:1035, 1984
9. Daley GQ, Van Etten RA, Baltimore D: Induction of chronic
repressor has yet to be determined.
myelogenous leukemia in mice by the P210L""ab'gene of the PhiladelKIPl, the gene encoding p27, also maps within the critiphia chromosome. Science 247:824, 1990
cally deleted region of 12p identified in this study. p27 is
10. Kamps M, Look A, Baltimore D: The human t(1; 19) transloan inhibitor of the cyclin D-cdk4 and cyclin E-cdk2 comcation
in pre-B ALL produces multiple nuclear E2A-PBX1 fusion
plexes and thereby participates in regulation of the GUS
proteins with differing transforming potentials. Genes Dev 5:358,
transition of the cell c y ~ l e . * ~Therefore,
**~
p27 is an excellent
1991
candidate for a tumor suppressor, particularly because loss
11. Kamps M, Murre C, Sun X, Baltimore D: A new homeobox
of function of other regulators of G1 progression, such as
gene contributes the DNA binding domain of the t( 1; 19) translocaRB and
has been identified in human t ~ ~ m o r s . ~ ~ - ~tion
* protein in pre-B ALL. Cell 60547, 1990
If either TEL or KIPl is indeed a tumor suppressor gene,
12. Nourse J, Mellentin J, N. G, Wilkinson J, Stanbridge E, Smith
then mutations affecting the structure or expression of the
S, Cleary M: Chromosomal translocation [(l; 19) results in synthesis
of a homeobox fusion mRNA that codes for a potential chimeric
residual allele should be identifiable in tumors with LOH at
transcription factor. Cell 60535, 1990
this locus. Sequence analysis of TEL will be greatly facili13. Dedera D, Waller E, LeBrun D, Sen-Majumdar A, Stevens M,
tated by the elucidation of the TEL genomic structure, which
Barsh G, Cleary M: Chimeric homeobox gene E2A-PBX1 induces
is currently not known. To date, no mutations in the KIPl
proliferation, apoptosis, and malignant lymphomas in transgenic
gene have been reported in human tumors, but extensive
mice. Cell 74:833, 1993
mutational analysis has not yet been p e r f ~ r r n e d .It~ is
~ *also
~
14. Thirman MJ, Gill HJ, Bumett RC, Mbangkollo D, McCabe
possible that an as-yet-unidentified tumor suppressor gene
NR, Kobayashi H, Ziemin-van der Poel S, Kaneko Y, Morgan R,
is located within the critically deleted region. Further reSandberg AA, Chaganti RSK, Larson RA, Le Beau MM, Diaz MO,
finement of the physical map in this region will be required
Rowley JD: Rearrangement of the MLL gene in acute lymphoblastic
to identify additional candidate genes. The finding of freand acute myeloid leukemias with llq23 chromosomal translocations. N Engl J Med 329:909, 1993
quent LOH at the TEL locus in childhood ALL suggests that
15. Golub T, Barker G, Bohlander S, Hiebert S, Ward D, Braythe identification of the 12p tumor suppressor gene may
Ward P, Morgan E, Raimondi S , Rowley J, Gilliland D: Fusion of
provide insight into the genetic basis of ALL, the most cornthe TEL gene on 1 2 ~ 1 3to the AMLI gene on 21q22 in acute
mon malignancy of ~hildhood.~'
lymphoblastic leukemia. Proc Natl Acad Sci USA (in press)
16. Miyoshi H, Shimizu K, Kozu T, Maseki N, Kaneko Y, Ohki
ACKNOWLEDGMENT
M: t(8;21) breakpoints on chromosome 21 in acute myeloid leukeWe thank G. Dalton for help with data analysis, M. Herrera for
mia are clustered within a limited region of a single gene, AMLI.
help with sample acquisition, L. Lum and A.Koff for the KIPl
Proc Natl Acad Sci USA 88:10431, 1991
primers, and M. Gallagher for technical assistance.
17. Golub TR, Barker GF, Lovett M, Gilliland DG: Fusion of
PDGF receptor beta to a novel ets-like gene, tel, in chronic myeloREFERENCES
monocytic leukemia with t(5; 12) chromosomal translocation. Cell
1. Croce C, Nowell P: Molecular basis of human B cell neoplasia.
77:307, 1994
Blood 65:1, 1985
18. Golub T, Barker G, Bohlander S, Stegmaier K, Bray-Ward
Table 3. BM Karyotypes of Patients With
E L LOH
44
P, Ward D, Sat0 Y, Suto Y, Rowley J, Gilliland D: Evidence implicating the TEL gene at 1 2 ~ 1 3
in multiple mechanisms of leukemogenesis. Blood 84:229a, 1994 (abstr, suppl l )
19. Raimondi SC: Current status of cytogenetic research in childhood acute lymphoblastic leukemia. Blood 81:2237, 1993
20. Raimondi SC, Williams DL, Callihan T, Peiper S, Rivera
GK, Murphy SB: Nonrandom involvement of the 1 2 ~ 1 breakpoint
2
in chromosome abnormalities of childhood acute lymphoblastic leukemia. Blood 68:69, 1986
21. Kohayashi H, Montgomery KT, Bohlander SK, AdraCN,
Lim BL, Kucherlapati RS, Donis-Keller H, Holt MS, Le Beau MM,
Rowley JD: Fluorescence in situhybridization mapping of translocations and deletions involving the short arm of human chromosome
12 in malignant hematologic diseases. Blood 84:3473, 1994
22. Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning (ed
2). Cold Spring Harbor, NY, Cold Spring Harbor Laboratory, 1989
23. Bell GI, Karam JH, Rutter WJ: Polymorphic DNA region
adjacent to S’ end of the human insulin gene. Proc Natl Acad Sci
USA 785759, 1981
24. Gilliland DG, Blanchard KL, Levy J, Perrin S, Bunn, HF:
Clonality in myeloproliferative disorders: Analysis by means of the
polymerase chain reaction. Proc Natl Acad Sci USA 88:6848, 1991
25. Gyapay G, Morissette J, Vignal A, Dib C, Fizames C, Millasseau P, Marc S, Bemardi G, Lathrop M, Weissenbach J: The 19931994 Genethon human genetic linkage map. Nature Genet 7:246,
1994
26. Toyoshima H, Hunter T: p27, a novel inhibitor of G 1 cyclincdk protein kinase activity, is related to p21. Cell 78:67, 1994
27. Polyak K, Lee M, Erdjument-Bromage H, KoffA, Roberts
J, Tempst P, Massague J: Cloning of ~ 2 7 ~ ’a ~cyclin-dependent
’,
kinase inhibitor and a potential mediator of extracellular antimitogenic signals. Cell 7859, 1994
28. Sato Y , Suto Y, Pietenpol J, Golub TR, Gilliland DG, Davis
EM, LeBeau MM, Roberts JM, Vogelstein B, Rowley JD, Bohlander
SK: TEL. and KIP1 define the smallest region of deletions on 1 2 ~ 1 3
in hematopoietic malignancies. Blood (in press)
29. Mehta CR, Patel NR: A network algorithm for the exact
treatment of Fisher’s exact test in RxC contingency tables. J Am
Stat Assn 382:427, 1983
30. Shimizu K, Ichikawa H, Tojo A, Kaneko Y, Maseki N, Hayashi Y, Ohira M, Asano S, Ohki M: An ets-related gene, ERG, is
rearranged in human myeloid leukemia with t(16;21) chromosomal
translocation. Proc Natl Acad Sci USA 90: 10280, 1993
STEGMAIERET
AL
31. Delattre 0, Zucman J, Plougastel B, Desmaze C, Melot T,
Peter M, Kovar H, Joubert I, de Jong P, Rouleau G, Aurias A,
Thomas G: Gene fusion with an ETS DNA-binding domain caused
by chromosome translocation in human tumours. Nature 359:162.
I992
32. O’Neill E, Rebay I, Tjian R, Rubin G: The activities of two
Ets-related transcription factors required for Drosophila eye development are modulated by the RasMAPK pathway. Cell 78:137, 1994
33. Lai Z, Rubin G : Negative control of photoreceptor development in Drosophila by the product of the yan gene, an ETS domain
protein. Cell 70509, 1992
34. Nobori T, Miura K, Wu D, Lois A, Takabayashi K, Carson D:
Deletions of the cyclin-dependent kinase-4 inhibitor gene in multiple
human cancers. Nature 368:753, 1994
35. Kamb A, Gruis N, Weaver-Feldhaus J , Liu q, Harshman K,
Tavtigian S, Stockert E, DayR, Johnson B, Skolnick M: A cell
cycle regulator potentially involved in genesis of many tumor types.
Science 264:436, 1994
36. Hebert J, Cayuela J, Berkeley J, Sigaux F: Candidate tumorsuppressor genes MTSl ( ~ 1 6 ’ and
~ ~MTS2
~ ~ ) (p151NK4’)display
frequent homozygous deletions inprimary cells from T- butnot
from B-cell lineage acute lymphoblastic leukemias. Blood 84:4038,
1994
37. Friend SH, Bernards R, Jogelj S, Weinberg RA, Rapaport
JM, Albert DM, Dryja TP: A human DNA segment with properties
ofthe gene that predisposes to retinoblastoma and osteosarcoma.
Nature 323:643, 1986
38. Friend SH, Horowitz JM, Gerber MR, Wang XF, Bogenmann
E, Li FP, Weinberg RA: Deletions of a DNA sequence in retinoblastomas and mesenchymal tumors: Organization of the sequence and
its encoded protein. Proc Natl Acad Sci USA 84:9059, 1987
39. Pietenpol JA, Bohlander SK, Sato Y, Papadopoulos N,Liu
B, Friedman C, Transk BJ, Roberts JM, Kinzler KW, Rowley JD,
Vogelstein B: Assignment of the human ~ 2 7 ~ ‘gene
” ’ to 1 2 ~ 1 3and
its analysis in leukemias. Cancer Res 55:1206, 1995
40. Ponce-Castaneda MV, Lee M-H, Latres E, Polyak K, Lacomhe L, Montgomery K, Mathew S, Krauter K, Sheinfeld J, Massague, Cordon-Cardo C: ~ 2 7 ~ ‘ ”Chromosomal
’:
mapping to 1 2 ~ 1 2 12~13.1and absence of mutations in human tumors. Cancer Res
55:1211, 1995
4 I . Young J, Ries L, Silverberg E: Cancer incidence, survival,
and mortality for children younger than age 15 years. Cancer 58:598,
I986