Download Decreased Expression of the p16/MTS1 Gene without

Jpn J Clin Oncol 1997;27:22–25
Decreased Expression of the p16/MTS1 Gene without Mutation is
Frequent in Human Urinary Bladder Carcinomas
, , , 1Chemotherapy
Division, National Cancer Center Research Institute, Tokyo, 2Department of Urology, Nagoya City
University Medical School, Nagoya and 3First Department of Pathology, Nagoya City University Medical School,
Nagoya, Japan
The p16 (CDKN2,MTS1) gene is located at 9p21 and its product, p16, inhibits the cyclin
D/CDK4 complex. Loss of heterozygosity on chromosome 9p is very common in human
bladder carcinomas and has been found in all stages of lesions, suggesting that it occurs
early in bladder tumor progression. Several studies have revealed frequent homozygous
deletion of the p16 gene in cell lines, and that such deletions are also common in some
types of cancers. In addition, point mutations in the p16 gene have been identified in
several types of neoplasia. In the present examination of urinary bladder tumors, no p16
gene mutations were detected, but nine cases out of 23 (39%) showed decreased mRNA
expression, revealed by the reverse transcriptase polymerase chain reaction. There were
no histological differences apparent between those cases with normal and those with
decreased p16 expression. These results indicate that while p16 gene mutations may be
rare, changes in the level of the p16 transcripts could play a role in human bladder
carcinoma development.
Key words: p16 – point mutation – gene expression – human urinary bladder carcinomas
INTRODUCTION
Loss of heterozygosity (LOH) of chromosome 9p21 has been
found in several types of malignant tumors, including these
arising in the urinary bladder (1–5). This indicates that the
chromosomal region contains at least one tumor suppressor gene
which may play an important role in development or progression
of many types of tumors. In bladder carcinomas, LOH of
chromosome 9 is the most frequent genetic change, deletion
occurring in all grades and stages (6,7). Inactivation of a tumor
suppressor gene on chromosome 9 is, therefore, a possible
initiating event in bladder carcinogenesis.
Recently, a gene encoding a 16 kDa protein was cloned from
9p21 to 2 (8,9). This p16 protein is an inhibitor of the cyclin
dependent kinase which catalyzes the phosphorylation of retinoblastoma gene protein, releasing transcription factor E2F and
resulting in progression from the G1 phase to the S phase of the
cell cycle (10). Thus, the p16 protein can negatively regulate the
Received July 4, 1996; accepted September 12, 1996
For reprints and all correspondence: Makoto Asamoto, Chemotherapy
Division, National Cancer Center Research Institute, 1–1,Tsukiji 5-chome,
Chuo-ku, Tokyo 104, Japan
Abbreviations: LOH, Loss of heterozygosity; PCR, polymerase chain
reaction; SSCP, single strand conformation polymorphism; RT, reverse
transcriptase
cell cycle and is a candidate 9p21 tumor suppressor gene.
Homozygous deletions of the p16 gene have been observed
frequently in cancer-cell lines established from many types of
tissues, including the bladder (5,8), and germline mutations have
been identified in patients in families with a genetic predisposition for melanoma development (11,12). Furthermore, somatic
mutations have been found in primary esophageal (13), pancreatic
(14) and lung carcinomas (15).
To investigate the involvement of p16 gene alterations in
primary bladder carcinomas, we identified somatic mutations in
23 cases using the polymerase chain reaction (PCR) and single
strand conformation polymorphism (SSCP) method for all three
exons of the p16 gene in addition to determining mRNA
expression by the reverse transcriptase (RT) PCR technique.
MATERIALS AND METHODS
Twenty-three primary bladder carcinomas were obtained by
trans-urethral resection in the Department of Urology, Nagoya City
University Medical School. After removal of a biopsy, each
specimen was immediately frozen in liquid nitrogen and stored at
–80C. Total RNA and DNA samples were extracted simultaneously from frozen tissue using ISOGEN (Nippon Gene Co. Ltd.
Toyama, Japan) according to the manufacturers instructions.
Biopsies from each tumor were also processed for routine
histological examination. All tumors were diagnosed as transitional
cell carcinomas. ASPC-1 and T24 cell lines obtained from the
23
J Clin Oncol
Nucleic AcidsJpn
Research,
1994, 1997;
Vol. 22,27(1)
No. 1
ATCC and Japanese Cancer Research Resources Bank, respectively,
were used as positive and negative controls for the p16 gene
mutation analysis (14,16).
To screen for p16 gene somatic mutations, PCR-SSCP was
performed. First, exons 1 and 2 with flanking intronic sequences
were amplified by PCR using the following primers: for exon 1,
Ex1A
(CGGAGAGGGGGAGAACAG) and
Ex1B
(TCCCCTTTTTCCGGAGAATCG)
for exon 2,
Ex2A
(GCTCTACACAAGCTTCCTTTCC) and
Ex2B
(GGGCTGAACTTTCTGTGCTGG).
The PCR conditions were one cycle at 95C (5 min); four cycles
at 95C (30 s) with the annealing temperature (Tann) = 72C (30 s);
four cycles with Tann = 68C (30 s); four cycles with Tann = 66C
(30 s); four cycles with Tann = 64C (30 s); four cycles with Tann
= 62C (30 s) ; and 30 cycles with Tann = 60C . Dimethyl
sulfoxide was added to the reaction mixture at 5%. Secondary
PCR was carried out using 1 µl of the diluted (1:100) first
fragments with primers Ex1A and Ex1B for exon 1, or Ex2A and
Ex2B for exon 2 as templates, 2 pmol of each primer, 25 µM of
deoxynucleotide triphosphates, 2 µCi of α-32PdCTP (Amersham,
3000 µCi/mmol), 10 mM Tris (pH 8.3), 50 mM KCL, 1.5 mM
MgCl2 , 12% DMSO (dimethyl sulphoxide) and 0.125 of a unit
of Taq polymerase (Perkin-Elmer Cetus) in a final volume of 5 µl.
Primer sequences and annealing temperatures were taken from
published data (11).
For exon 1, primers
X1.31F
(GGGAGCAGCATGGAGCCG) and
X1.26R
(AGTCGCCCGCCATCCCCT) were used.
Exon 2 was divided into three parts and amplified with overlapping
sequences to increase the sensitivity of detection of mutations by
SSCP.
For exon 2a,
X2.62F
(AGCTTCCTTCCGTCATGC) and
286R
(GCAGCACCACCAGCGTG);
for exon 2b,
F200
(AGCCCAACTGCGCCGAC) and
346R
(CCAGGTCCACGGGCAGA);
and for exon 2c
305F
(TGGACGTGCGCGATGC) and
X2.42R
(GGAAGCTCTCAGGGTACAAATTC) were used
as primers.
To analyze exon 3, the same conditions as for the secondary PCR
for exons 1 and 2 were applied, except for application of genomic
DNA as the PCR template instead of the PCR products, using
primers
X3.90F
(CCGGTAGGGACGGCAAGAGA) and
530R
(CTGTAGGACCCTCGGTGACTGATGA).
Thirty cycles were performed of: 1 min at 94C, followed by 1
min at 63C for exon 1, at 55C for exon 2 and at 60C for exon
3, and finally 1.5 min at 72C. Forty-five µl of stop solution
[95% formamide, 20 mM EDTA (ethylenediaminetetra-acetic
acid), 0.05% bromophenol blue, 0.05% xylene cyanol] was then
added to the reaction mixture and after heating at 80C for 2 min,
1 µl aliquots of samples were loaded onto 5% polyacrylamide gels
(acrylamide:bis ratio, 49:1) with or without 5% glycerol. Gels
23
Figure 1. PCR-SSCP analysis of exons 1 and 2b (the middle part of exon 2) of
the p16 gene in human bladder carcinomas, as well as T24 and ASPC-1 cells.
Note the abnormal mobility shift in the bands for ASPC-1 indicating a point
mutation in exon 2, but its lack in the bladder carcinoma and T24 cases.
were run at 30 W with a water jacket at 25C for 3 h before drying
at 80C and performance of autoradiography for 1–2 h.
To investigate the mRNA expression, the RT-PCR method was
applied. Total RNA (1 µg) treated with RNase-free DNase was
incubated with oligo d (T)20 primers and AMV reverse transcriptase
at 60C for 30 min. The 363 bp cDNA stretch corresponding to
the first and second exons of p16 was amplified by primers
p16U
(GGGGTTCGGGTAGAGGAGGTG) and
p16D
(CATGGTTACTGCCTCTGGTG) with an RNA
PCR kit (TaKaRa Co. Ltd., Otsu, Japan). The PCR conditions
were the same as used for the exon 1 or 2 amplification. G3PDH
expression was also examined as an internal control for RT-PCR
with primers purchased from Clontech Laboratories, Inc. (Palo Alto,
California, USA). Thirty cycles were performed at 94C, 60C,
and 72C for 1, 1, and 1.5 min, respectively. Reaction products for
p16 and the corresponding G3PDH were placed into the same wells
and separated on 1% agarose gels before staining with ethidium
bromide for visualization.
RESULTS
We investigated somatic mutations in all three exons of the p16
gene in 23 primary bladder carcinomas and the T24 bladder
carcinoma cell line using the PCR-SSCP method. However, no
mutations were detected in any of the tumors or the T24 cells (16).
As a positive control, the pancreatic cell line ASPC-1 which has
a mutation in exon 2 of the p16 gene was used. The presence of
the mutation was confirmed (14). Representative photographs of
the results of SSCP analysis for exons 1 and 2b (the middle part
of exon 2) are shown in Fig. 1.
Decreased expression of the p16 gene relative to G3PDH was
noted in nine cases (39%) out of the 23 (Case nos
2,5,7,11,13,14,19,20 and 23) examined and also in the T24 cell
line by the RT-PCR method (Fig. 2).
24
p16 in urinary bladder carcinoma
by RT-PCR, the cycle number was minimized in the present study,
with only one round of PCR performed, and the level of p16 in
normal cells is known to be generally low (21–24). Therefore we
believe that the signals observed were indeed from carcinoma as
opposed to normal cells. The reasons for the decreased expression
remain to be elucidated, but it could be due to methylation of the
5i CpG island of the p16 gene (25) or homozygous deletions of
the gene (19,20). Whatever the reasons, the RT-PCR method
described here is useful in detecting p16 gene abnormalities of
any origin. Decreased expression of the p16 gene despite a lack
of point mutations has also been reported for nasopharyngeal
carcinomas (26) and high grade gliomas (27).
Loss of p16 function is very likely to cause deregulation of
G1/S phases in the cell cycle. This abnormality could be expected
to endow a growth advantage or stimulate more proliferation. We
have also conducted a preliminary study of cell proliferating
activity in bladder carcinomas with or without p16 expression by
PCNA staining (data not shown). However, we could not detect
any clear correlation between the two parameters, indicating that
a pathway independent of p16 may exist to regulate the cell cycle.
Figure 2. mRNA expression of p16 and G3PDH in human bladder carcinomas,
T24 and ASPC-1 cells revealed by RT-PCR. The upper bands correspond to
G3PDH, and the lower bands to p16. In nine cases out of 23 (39%), decreased
expression of p16 was observed relative to G3PDH (Case nos
2,5,7,11,13,14,19,20 and 23). M: DNA molecular weight markers, 123 bp
DNA ladder (GibcoGRL, Life Technologies, Inc., Gaithersburg, MD, USA)
There were no histological differences apparent between cases
with normal and decreased p16 expression.
DISCUSSION
Although the mechanisms underlying development of bladder
carcinogenesis remain unclear, several investigations have shown
frequent gene alterations in the short arm of chromosome 9 in
bladder carcinomas (1–4). The p16 gene in this location is in fact
a candidate putative tumor suppressor gene in many types of
tumors, including bladder carcinomas and their derived cell lines,
many carrying homozygous deletions (8, 9). However, somatic
mutations in the p16 gene may be rare except in hereditary
melanomas, and in esophageal, pancreatic, and lung carcinomas
(16,17). Our results are in agreement with the earlier reports of
very low incidences of somatic mutations in primary bladder
carcinomas (18,19). This is in clear contrast to the frequent
occurrence of homozygous deletions (19,20).
Primary epithelial tumors always contain contaminating normal
cells e.g. stromal cells, endothelial cells and lymphocytes, and
therefore it may be very difficult to find homozygous deletions
using a PCR based technique. In this study, we applied a nested
primed PCR method to detect mutations in order to increase
efficiency of the technique, and found that the p16 gene could be
amplified from all samples. This is not, however, conclusive proof
of lack of a homozygous deletion, given the possible generation of
a p16 gene product from contaminating normal cells.
With regard to the apparent decrease in expression of the p16
gene in nine out of the 23 primary bladder carcinomas observed
References
1. Knowles MA, Elder PA, Williamson M, Cairns JP, Shaw ME, Law MG.
Allelotype of human bladder cancer. Cancer Res 1994;54:531–8.
2. Orlow I, Lianes P, Lacombe L, Dalbagni G, Reuter VE, Cordon CC.
Chromosome 9 allelic losses and microsatellite alterations in human bladder
tumors. Cancer Res 1994;54:2848–51.
3. Cairns P, Shaw ME, Knowles MA. Preliminary mapping of the deleted region
of chromosome 9 in bladder cancer. Cancer Res 1993;53:1230–1232.
4. Miyao N, Tsai YC, Lerner SP, Olumi AF, Spruck C3, Gonzalez ZM et al. Role
of chromosome 9 in human bladder cancer. Cancer Res 1993;53:4066–70.
5. Cairns P, Tokino K, Eby Y, Sidransky D. Homozygous deletions of 9p21 in
primary human bladder tumors detected by comparative multiplex polymerase
chain reaction. Cancer Res 1994;54:1422–4.
6. Spruck C3, Ohneseit PF, Gonzalez ZM, Esrig D, Miyao N, Tsai YC et al. Two
molecular pathways to transitional cell carcinoma of the bladder. Cancer Res
1994;54:784–8.
7. Sidransky D, Frost P, Von Eschenbach A, Oyasu R, Preisinger AC, Vogelstein B.
Clonal origin of bladder cancer. N Eng J Med 1992;326:737–40.
8. Kamb A, Gruis NA, Weaver FJ, Liu Q, Harshman K, Tavtigian SV et al. A
cell cycle regulator potentially involved in genesis of many tumor types.
Science 1994;264:436–40.
9. Nobori T, Miura K, Wu DJ, Lois A, Takabayashi K, Carson DA. Deletions of
the cyclin-dependent kinase-4 inhibitor gene in multiple human cancers.
Nature 1994;368:753–6.
10. Serrano M, Hannon GJ, Beach D. A new regulatory motif in cell-cycle control
causing specific inhibition of cyclin D/CDK4. Nature 1993;366:704–7.
11. Hussussian CJ, Struewing JP, Goldstein AM, Higgins PA, Ally DS, Sheahan
MD et al. Germline p16 mutations in familial melanoma. Nat Genet 1994;8:
15–21.
12. Kamb A, Shattuck ED, Eeles R, Liu Q, Gruis NA, Ding W et al. Analysis of
the p16 gene (CDKN2) as a candidate for the chromosome 9p melanoma
susceptibility locus. Nat Genet 1994;8:23–6.
13. Mori T, Miura K, Aoki T, Nishihira T, Mori S, Nakamura Y. Frequent somatic
mutation of the MTS1/CDK4I (multiple tumor suppressor/cyclin-dependent
kinase 4 inhibitor) gene in esophageal squamous cell carcinoma. Cancer Res
1994;54:3396–7.
14. Caldas C, Hahn SA, da CL, Redston MS, Schutte M, Seymour AB et al.
Frequent somatic mutations and homozygous deletions of the p16 (MTS1)
gene in pancreatic adenocarcinoma. Nat Genet 1994;8:27–32.
15. Hayashi N, Sugimoto Y, Tsuchiya E, Ogawa M, Nakamura Y. Somatic
mutations of the MTS (multiple tumor suppressor) 1/CDK4l (cyclin-dependent
kinase-4 inhibitor) gene in human primary non-small cell lung carcinomas.
Biochem Biophys Res Com 1994;202:1426–30.
16. Spruck C, Gonzalez ZM, Shibata A, Simoneau AR, Lin MF, Gonzales F et al.
p16 gene in uncultured tumours. Nature 1994;370:183–4.
25
J Clin Oncol
Nucleic AcidsJpn
Research,
1994, 1997;
Vol. 22,27(1)
No. 1
17. Cairns P, Mao L, Merlo A, Lee DJ, Schwab D, Eby Y et al. Rates of p16
(MTS1) mutations in primary tumors with 9p loss. Science 1994;265:415–7.
18. Kai M, Arakawa H, Sugimoto Y, Murata Y, Ogawa M, Nakamura Y.
Infrequent somatic mutation of the MTS1 gene in primary bladder
carcinomas. Jpn J Cancer Res 1995;86:249–51.
19. Orlow I, Lacombe L, Hannon GJ, Serrano M, Pellicer I, Dalbagni G et al.
Deletion of the p16 and p15 genes in human bladder tumors. J Nat Cancer
Inst 1995;87:1524–9.
20. Cairns P, Polascik TJ, Eby Y, Tokino K, Califano J, Merlo A et al. Frequency
of homozygous deletion at p16/CDKN2 in primary human tumours. Nat
Genet 1995;11:210–2.
21. Jen J, Harper JW, Bigner SH, Bigner DD, Papadopoulos N, Markowitz S et al.
Deletion of p16 and p15 genes in brain tumors. Cancer Res 1994;54:6353–8.
22. Shapiro GI, Edwards CD, Kobzik L, Godleski J, Richards W, Sugarbaker DJ
et al. Reciprocal Rb inactivation and p16INK4 expression in primary lung
cancers and cell lines. Cancer Res 1995;55:505–9.
23. Tam SW, Shay JW, Pagano M. Differential expression and cell cycle
regulation of the cyclin-dependent kinase 4 inhibitor p16Ink4. Cancer Res
1994;54:5816–20.
25
24. Geradts J, Kratzke RA, Niehans GA, Lincoln CE. Immunohistochemical
detection of the cyclin-dependent kinase inhibitor 2/multiple tumor suppressor gene 1 (CDKN2/MTS1) product p16INK4A in archival human solid
tumors: correlation with retinoblastoma protein expression. Cancer Res
1995;55:6006–11.
25. Merlo A, Herman JG, Mao L, Lee DJ, Gabrielson E, Burger PC et al. 5’ CpG
island methylation is associated with transcriptional silencing of the tumour
suppressor p16/CDKN2/MTS1 in human cancers. Nat Medicine 1995;1:
686–92.
26. Sun Y, Hildesheim A, Lanier AE, Cao Y, Yao KT, Raab-Traub N et al. No
point mutation but decreased expression of the p16/MTS1 tumor suppressor
gene in nasopharyngeal carcinomas. Oncogene 1995;10:785–8.
27. Nishikawa R, Furnari FB, Lin H, Arap W, Berger MS, Cavenee WK et al.
Loss of p16INK4 expression is frequent in high grade glioma. Cancer Res
1995;55: 1941–5.