Download A Superfamily of S Locus-Related Sequences in

The Plant Cell, Vol. 6, 1829-1843, December 1994 O 1994 American Society of Plant Physiologists
A Superfamily of S Locus-Related Sequences in
Arabidopsis: Diverse Structures and Expression Patterns
Kathleen G. Dwyer,' Muthugapatti K. Kandasamylb Dusty I. Mahosky,' J o a n n Acciailb Bela I. Kudish,'
Janet E. Miller,' Mikhail E. Nasrallahlb and June B. Nasrallahbi'
a
Biology Department, University of Scranton, Scranton, Pennsylvania 18510
Section of Plant Biology, Division of Biological Sciences, Cornell University, Ithaca, New York 14853
Six sequences that are closely related to the S gene family of the largely seltincompatible Brassica species have been
identified in self-fertilizing Arabidopsis. The sequences define four genomic regions that map to chromosomes 1 and
3. Of the four functional genes identified, only the previously reported Arabidopsis AtS7 gene was expressed specifically
in papillar cells and may function i n pollination. The remaining three genes, including two nove1genes designated ARKP
and ARK3, encode putative receptor-like serinehhreonine protein kinases that are expressed predominantly in vegetative
tissues. ARKP promoter activity was detected exclusively i n above-ground tissues, specifically in cotyledons, leaves,
and sepals, i n correlation with the maturation of these structures. ARK3 promoter activity was detected in roots as well
as above-ground tissues but was limited to small groups of cells i n the root-hypocotyl transition zone and at the base
of lateral roots, axillary buds, and pedicels. The nonoverlapping patterns of expression of the ARK genes and the divergente of their sequences, particularly i n their predicted extracellular domains, suggest that these genes perform
nonredundant functions in specific aspects of development or growth of the plant body.
INTRODUCTION
The S superfamily of genes is composed of genes that
share sequence similarity with genes derived from the selfincompatibility (S) locus of Brassica. The S locus genes include
the S Locus Glycoprotein (SLG) gene (Nasrallah et al., 1987)
and the S locus Receptor Kinase (SRK) gene, which encodes
a transmembrane protein with an extracellular domain that
shares a high degree of sequence similarity with SLG (Stein
et al., 1991) and a cytoplasmic domain that exhibits serinehhreonine kinase activity (Goringand Rothstein, 1992; Stein
and Nasrallah, 1993). This family of sequences appears to
be ubiquitous in plants, and S gene family members that encode secreted glycoproteins and transmembrane receptor
protein kinases have been identified in monocots as well as
dicots (reviewed in Nasrallah and Nasrallah, 1993).
In crucifers, several S family members have been reported
in addition to the S locus genes of Brassica. These include
the Brassica S Locus-Related genes SLR7 (Lalonde et al.,
1989; Trick and Flavell, 1989; lsogai et al., 1991) and SLRP
(Boyes et al., 1991) and the Arabidopsis AtS7 gene (Dwyer et
al., 1992); these genes encode secreted glycoproteinsthat are
expressed specifically in reproductive tissues. Also reported
are the Arabidopsis Receptor Kinase gene ARK7 (Tobias e:
al., 1992) and the Receptor-Like Kinase genes RLK7 and RLK4
To whom correspondence should be addressed.
(Walker, 1993), which encode putative receptor protein kinases
that are expressed predominantly in vegetative structures. Except for the latter two sequences, which were isolated as cDNAs
by hybridization to a probe derived from the kinase domain
of maize ZmPK7 (Walker and Zhang, 1990), all of these additional members share at least 60°/o sequence identity with the
Brassica S locus genes. AI1 family members share an "S domain" that comprises the coding region of each of the secreted
glycoprotein-encoding genes and the extracellular domains
of each of the receptor protein kinase-encoding genes. Furthermore, where investigated, the details of gene structure are
conserved (Dwyer et al., 1992; Tobias et al., 1992).
With the exception of the SLG and SRK genes of Brassica,
which have a role in cell-cell signaling between pollen and
stigma and are required for the operation of the selfincompatibility system, the biological function of the various
family members is not known. However, in view of similarities
in primary sequence and gene structure, it is possible that
these genes also function in cell-cell signaling at some as yet
unknown stage of the plant life cycle. To understand the organization and evolution of the S gene family and eventually
define the biological function of individual members, it is important first to define the composition of the gene family in
a particular plant species and to describe the structure and
expression of its members. We have focused on the S gene
family of Arabidopsis for several reasons. First, Arabidopsis
has well-known advantages as a model system for molecular
1830
The Plant Cell
and genetic studies. Second, Arabidopsis and Brassica are
both members of the Brassicaceae, and the family members
that are most closely related to the Brassica S locus genes
are therefore easily identified by Brassica-derived probes.
Third, unlike Brassica species, which are generally selfincompatible, Arabidopsis lacks a self-incompatibility system;
it is therefore of interest to determine whether, in this self-fertile
plant, an S locus complex has been maintained and whether
pollen-stigma interactions are likely to be mediatedby receptorlike protein kinases. The analysis of the S gene family in
Arabidopsis thus provides the opportunity not only to investigate the evolutionary relationships of cell-cell recognition
phenomena that operate during plant reproduction to those
that operate in vegetative tissues, but also to understand the
evolution of breeding behavior in a plant family.
In this study, we present the gene structure, sequence, and
expression pattern of several members of the Arabidopsis S
gene family. We show that the cloned sequences define four
regions in the Arabidopsis genome. Of a total of six sequences
identified by Brassica probes, four sequences have not been
previously described and include two pseudogenes and two
putative transmembrane protein kinase genes, designated
ARK2 and ARK3. These two nove1 protein kinase genes are
expressed vegetatively and are therefore likely to have a function very different from that of AtS7, the only cloned member
of the family that we show in this report to be expressed specifically in the papillar cells of the stigma.
protein kinase genes; their protein coding regions are separated by only 848 bp. Of these two genes, the ARKl gene has
been described by Tobias et al. (1992), and we have designated the second, previously unreported gene as ARK2.
Genomic region 3, a 19.2-kb region defined by several overlapping clones, spans four regions that contain S-related
sequences, which we designated SY7 and SY2a, SY2D, and
’ SY2y, respectively, because, as shown below, they comprise
nonfunctional pseudogenes.
DNA gel blot analysis using probes derived from the S-related
sequences within these genomic regions of Arabidopsis
demonstrated intense cross-hybridizationbetween the region
1 and region 3 S-related sequences on the one hand and between the two S-related genes of region 2 on the other. In
contrast, under the hybridization conditions used, the S-related
sequences in regions 1 and 3 hybridized only weakly with those
in region 2. To identify possible additional S-relatedsequences
that might have been missed by the Brassica-derived probes,
we screened another Arabidopsis genomic library with the
1.6-kb EcoRI-Sstl fragment containing the AtS7 gene (probe
A in Figure 1; representative of all of the S-related sequences
in regions 1 and 3) and with the 4.2-kb Pstl fragment containing ARKgene sequences (probe B in Figure 1; representative
of both of the S-related sequences in region 2). Of 20 recombinant clones isolated, one clone defined a fourth distinct
Arabidopsis genomic region containing S-related sequences
(Figure 1). A 9.0-kb EcoRl fragment from this genomic region
(region 4) was found to contain a third putative S-related receptor protein kinase, which we designated ARK3.
RESULTS
lsolation of Arabidopsis Sequences with Homology
with the Brassica S Gene Family
The Arabidopsis genome contains several genes related to
the Brassica S locus genes, as revealed by DNA gel blot
analysis (Nasrallah et al., 1988; Dwyer et al., 1992). As a consequence, the initial screening of an Arabidopsis genomic
library with Brassica SLG and SLR7 gene probes that had led
to the identification of theAtS7 (Dwyer et al., 1992) and ARKl
(Tobias et al., 1992) genes had resulted in the isolation of a
total of 18 positive recombinant clones, many of which had
remained uncharacterized. Each of these positive clones contained sequences that are related to SLGISLR7 and that will
be referred to as S-relatedsequences or genes. Seven of these
clones also hybridized to a 0.5-kb Accl fragment derived from
the kinase region of the Brassica SRK, gene, suggesting that
they contained transmembrane protein kinase genes. Further
analysis revealed that these recombinant clones spanned three
distinct genomic regions containing several S-related sequences (Figure 1). Genomic region 1, diagrammed as a 12-kb
Sal1 fragment in Figure 1, contains the previously reported
Arabidopsis AtS7 gene (Dwyer et al., 1992). Genomic region
2, a 20.4-kb region defined by several overlapping clones, contains two tandemly repeated putative SRK-related receptor
Genomic Organization of Arabidopsis S-Related
Sequences
Only sequences most closely related to the Brassica S gene
family members were expected to be identified by the probes
used in this study. Thus, the Arabidopsis S-related putative
receptor protein kinase genes RLK7 and RLK4 (Walker, 1993),
which share only 37 and 38% sequence identity, respectively,
with SRK would not have been detected by the hybridization
conditions used in our screening of genomic and cDNA
libraries. To determine whether the cloned genes represented
the full complement of the “Brassica-like”S gene family members in Arabidopsis, we performed gel blot analyses of
Arabidopsis (ecotype Columbia) genomic DNA using as probes
the 1.6-kb EcoRI-Sstl fragment, containing AtS7 gene sequences (probe A in Figure l), and the 0.7-kb SallXbal
fragment, containingARKl S domain sequences (probe C in
Figure 1). Figure 2 shows that in EcoRI-digestedDNA, theAfS7
sequence probe hybridized with varying degrees of intensity
to six restriction fragments of 8.8, 7.2, 6.0, 2.8, 2.0, and 1.8 kb.
This probe hybridized to S pseudogene sequences as well as
to the AtS7 gene. As predicted from the physical maps of
genomic regions 1 and 3 in Figure 1, this probe is expected
to hybridize with genomic EcoRl fragments of 7.1 (SY7), 5.8
(AtS7), 2.8 (SY2y), 2.0 (SY2a), and 1.8 (SY2p) kb in length.
Arabidopsis S Locus-Related Genes
1831
REGION ONE
3
5
Sa P R H R
R R
H
K B
S
-
HR P H R S
Sa
AtS1
S
probe A
REGION TWO
pKD421
pBL225
3
PKH H RH
I11
I
0
R
S R
1
I I
H
HR
H5SP
HH
-
Sa
3
5
RRSP
HS
R
RH H
HR
Sa
ombe B
probe C
REGION THREE
pKD411
pKD419
5'
H
C
P
S
I
P
~
3
R
L
VI
middle
5
H SR
KH S
V=I
II I
I
wza
Sa
pJA414
@A413
Sa
RKH
II
A
WZP
3
R R
I I~
I
Sa
SR
d
wzu
HR
U
REGION FOUR
3
S
R B
P
Sa
K
I
PR
I 1
ARKB
.
I
pmbe D
Figure 1. Partia1 Restriction Map of the Four Genomic Regions of Arabidopsis Containing S-Related Sequences.
The open reading frames and exons of the functional S genes in regions 1, 2, and 4 are depicted by black boxes and introns by open boxes.
The nonfunctional S pseudogene and promoter (p) sequences of region 3 are also shown by black boxes. The orientations of the S-relatedgenes
are indicated. The lines above the maps indicate the positions of subcloned DNA fragments that were used to sequence the ARK genes and
S pseudogenes. The IineS below the restriction maps delineate the location of various DNA probes used in DNA gel blot analysis and/or to screen
Arabidopsis genomic libraries. The regions are drawn to scale, with probe A representing 1.6 kb. B, BamHI; R, EcoRI; H, Hindlll; K, Kpnl; P,
Pstl; Sa, Sall; S,Sstl.
1832
The Plant Cell
The expected results agree well with the actual results except
for the 8.8-kb EcoRI fragment, which is unaccounted for in our
collection of clones. Our screens of genomic libraries failed
to identify additional S-related genes that might correspond
to this EcoRI fragment. Because the genomic DMA prepared
for the blot analysis and the genomic libraries was derived from
different Arabidopsis strains, this unique EcoRI fragment may
be due to a restriction fragment length polymorphism (RFLP)
found between the different Arabidopsis strains used.
The ARK1S domain probe hybridized with varying degrees
of intensity to three restriction fragments of 10, 6.2, and 3.9
kb (Figure 2). This probe has been shown to recognize the
S domain sequences of all three ARK genes. As predicted from
the restriction maps of genomic regions 2 and 4 in Figure 1,
this probe is expected to hybridize with EcoRI fragments of
9.0 (ARK3), 5.3 (ARK1), and 3.4 (ARK2) kb. The expected and
actual results were in approximate agreement. Note that the
6.2-kb fragment ascribed to the ARK1 gene was recognized
most intensely by the ARK1-der\ved probe. The blot shown in
Figure 2 was reprobed with sequences specific to the ARK3
gene and derived from its 3' untranslated region (probe 0 in
23 —|
9.56.75.14.3'
2.
1.6 —
B
Figure 2 DNA Gel Blot Analysis of the Arabidopsis S Gene Family.
(A) Genomic DNA (2 ug) was digested with EcoRI. The DNA gel blot
was probed with probe A (Figure 1, genomic region 1), which consists
of AtSl sequences and hybridizes to genomic fragments containing
both AtSl and S pseudogene sequences.
(B) The same DNA blot was reprobed with probe C (Figure 1, genomic
region 2), which consists of ARK1 S domain sequences and hybridizes to genomic fragments containing ARK1, ARK2, and ARKS S domain
sequences. Molecular length standards are indicated at left in kilobases.
Figure 1), and only the 10-kb EcoRI fragment was detected
(data not shown).
RFLP mapping in recombinant inbred lines (see Methods)
indicated that genomic regions 2 and 3 mapped to chromosome 1, separated by a distance of >2 centimorgans, whereas
genomic regions 1 and 4 were within 1 centimorgan of each
other on chromosome 3.
Sequence Analysis of Newly Identified Members
of the Arabidopsis S Gene Family
The Expressed Genes
The DNA sequence and gene structure of the AtS1 and ARK1
genes were reported previously (Dwyer et al., 1992; Tobias et
al., 1992). To determine the nucleotide sequence of the ARK2
gene, restriction fragments derived from genomic region 2 were
cloned into plasmid vectors to generate the subclones shown
in Figure 1. Subclone pBL225 contains a 4.2-kb Pstl fragment
that spans most of the ARK1 gene, the spacer sequences between the ARK1 and ARK2 genes, and the 5' region of the ARK2
gene; subclone pKD421 contains a 6.3-kb Sall-EcoRI fragment
that spans most of the ARK2 gene and its downstream flanking sequences. Similarly, for sequence analysis of the ARK3
gene in genomic region 4, we generated subclone pDM2 that
contains the 5.5-kb BamHI-Pstl fragment that spans the entire
ARK3 gene and its flanking regions.
Alignment of the ARK2 and ARK3 sequences with the ARK1
sequence revealed a conserved gene structure consisting of
seven exons separated by six introns. Interestingly, the
exon-intron boundaries are conserved among all three
Arabidopsis ARK genes and the Brassica SRK6 and SflK2
genes as well (data not shown). Thus, in all these receptorlike genes, the first exon encodes the entire S domain, the second exon encodes the transmembrane domain, and exons 3
to 7 encode the kinase domain. The ARK2 gene, from the
predicted translation initiation codon to the predicted termination codon, is 3358 bp in length, with introns 1 through 6
spanning 369, 93, 76, 85, 103, and 88 bp, respectively. The
sequence predicts a spliced transcript of 2544 bp encoding
a protein product of 847 amino acids with a molecular mass
of 95,957 D. The ARKS gene is 3871 bp in length, with introns
1 through 6 spanning 881, 89, 77, 91, 96, and 84 bp, respectively. The 2553-bp spliced transcript predicted from the ARKS
sequence would encode a protein product of 850 amino acids
with a molecular mass of 96,456 D.
The amino acid sequences of the predicted ARK2 and ARKS
proteins are presented in alignment with the sequences of the
predicted ARK1 and AtS1 proteins in Figure 3. The S domain
is the only region of shared sequence similarity between AtSl
on the one hand and ARK1, ARK2, and ARKS on the other.
As has been noted previously for AtSl and ARK1, the ARK2
and ARKS S domains have conserved features first found associated with the Brassica SLG, SLR1, and SRK genes. At their
N terminus lies a stretch of hydrophobic amino acids that may
function as a signal sequence. Cleavage of this signal peptide
Arabidopsis S Locus-Related Genes
1833
65
65
65
69
160
165
164
167
ARKZ
ARK3
AtSl
DT:SSE:NLF
*
*
* *
* *
257
262
261
261
356
360
360
366
ARKl YSPKDLCDNYKVCGNFGYCDSNSLPNCY
ARKZ
ARK3
AtSl
1
2
ARKl i l A F A N A D I R N G G S G S V I W T R E I L D M R N Y A K G G Q D L Y V R L - E L E b K R ~ ~ E K ~ I ~ S S ~ G V S ~ L L L L ~ F V I F ~ ~ W K R K Q K.QVRSQDSL
R S I ~ ~ Q ~ ~ N4~5 5
459
ARKZ
460
ARK3
408
AtSl
ARKl
ARKZ
ARK3
555
559
560
ARKl
ARKZ
ARK3
655
659
660
ARKl
ARKZ
ARK3
755
759
759
ARKl
ARK2
ARK3
Figure 3. Amino Acid Sequence Alignment of the Predicted ARKl, ARKP, ARW, and AtSl Proteins.
ldentical sequences are indicated by colons and deleted amino acids by dots. Vertical lines mark the sites of the six exonlintron boundaries
for the ARK genes. The underlined residues represent hydrophobic regions thought to function as signal peptide and transmembrane domains.
The numbers to the right refer to the positions of amino acid residues, with the first residue following the putative signal sequence designated
as +I. Within the Sdomains (encoded byexon 1 of the ARKgenes and the entireAtS1 gene), open boxes enclose potential N-linked glycosylation
sites, and asterisks indicate the positions of the 12 conserved cysteine residues. Within the kinase domains (encoded by exons 3 through 7 of
the ARKgenes), the 15 amino acid residues that are invariant in protein kinases are marked by asterisks, and the consensus sequences DLKASN
and GTYGYMSP that predict all three ARK genes to have serindthreonine protein kinase specificity are shown in boxes.
would yield mature protein products of 92,751 and 93,035 D
for ARK2 and ARK3, respectively. In addition, the proteins exhibit the 12 invariant cysteines that also occur within the
C-terminal third of AtSl, ARK1, and all Brassica S domains
analyzed to date. Finally, the ARK2 and ARK3 S domains exhibit severa1 potential N-linked glycosylation sites with the
consensus N-X-Sn, three of which are conserved in all four
Arabidopsis genes and in the Brassica SRh, SLR1, and
SLG6 S domains as well. Interestingly,as was first described
for the Brassica SRKs gene, all three Arabidopsis ARK genes
have an in-frame TAG stop codon within the first intron 2 bp
downstream of the first splice junction. There is evidence
(Tobias et al., 1992; C.M. Tobias and J.B. Nasrallah, manuscript
in preparation)that these ARKgenes produce alternativetranscripts predicted to encode a truncated protein product
consisting entirely of the S domain and presumably secreted
into the extracellular matrix.
Hydrophobicity plot analysis of the predicted ARK2 and ARK3
proteins reveals a second concentration of 22 hydrophobic
amino acids followed by a stretch of eight,amino acids, six of
which are basic. These sequences, which are encoded by the
second exon in the three genes, are similar to the membranespanning and juxtamembrane domains of other transmembrane proteins (Weinstein et al., 1982). In each of the ARK
proteins, the putative transmembrane domain is followed by
the protein kinase catalytic domain. The amino acid sequences
of the kinase domains contain the 11 subdomains characteristic of the catalytic core for all protein kinases (Hanks et al.,
1988), including the 15 invariant residues that are essential
for nucleotide binding and for the phosphate transfer reaction
(Figure 3). Furthermore, the DLKASN sequence in subdomain
VI and the GTYGYMSP in subdomain Vlll are suggestive of
serinehhreonine rathe: than tyrosine kinase activity for all three
Arabidopsis ARK proteins.
Pairwise sequence comparisons of the Arabidopsis and Brassica S-related genes indicate that the ARKl and ARK2 proteins
are the most closely related and exhibit an overall sequence
identity of 85.7%. The ARK3 protein exhibits approximately
1834
The Plant Cell
equal overall sequence similarity with ARKl (75.3%) and ARK2
(i'6%). As expected for interspecific sequence comparisons,
the Brassica SRKs gene is more distantly related to the
Arabidopsis ARKgenes, sharing 65.5,64.9, and 63.9% overall
amino acid sequence identity with theARK3, ARK7, and ARK2
genes, respectively. In Tables 1 and 2, the sequence relationships are broken down between the various S (Table 1) and
kinase (Table 2) domains. The same pattern of relatednessobserved overall betweenthe receptor protein kinase sequences
holds true for their S and kinase domains when considered
separately. Interestingly, however, the kinase domains are consistently more conserved than the S domains. This difference
is especially apparent in the relative drift between the ARKl
and ARK2 S and kinase domains, which exhibit 21.4 and 7%
amino acid divergence, respectively.
Some interesting features emerge from the comparison of
S domain sequences in the predicted Arabidopsis and Brassica proteins (Table 1). Of the three ARK proteins, the S domain
of ARK3 is most similar to that of AtSl. Interestingly,the S domains of the three Arabidopsis ARK proteins share somewhat
more sequence identity with the Brassica SRK6 protein than
with Arabidopsis AtS1. In addition, the ARK proteins are slightly
more similar to Brassica SLG6than to SLR1, which is consistent with the fact that the Brassica SLG and SRK genes isolated
from one haplotype show >90% sequence identity.
The S Pseudogenes
To determine the nucleotide sequence of the S-related sequences in genomic region 3, subclones pKD419, pKD411,
pJA413, and pJA414 (shown in Figure 1) were used. All four
S-related sequences within this region were found to represent nonfunctional pseudogenes.This conclusion is based on
our inability to detect the corresponding transcripts in floral
bud or leaf tissue by RNA polymerase chain reaction (PCR)
with primers specific for each sequence and on the sequence
analysis summarized in the following discussion.
The alignment of the four S-related sequences of genomic
region 3 relative to AfS7 is shown diagrammatically in Figure
4. The SY7 sequence exhibited 92.2% nucleotide identity over
the length of the AfS7 coding region, but it contained many
Table 1. Percent Amino Acid ldentity between the S Domains of
the Following Arabidopsis and Brassica Genes
ARKl
ARKl
A RK2
ARK3
AtSl
SRKe
SLRl
SLGs
RLKl
RLK4
1O0
78.6
70.4
57.1
61.2
52.3
59.2
28.2
34.2
I%)
ARK2
78.6
1O0
70.9
57.0
59.0
55.8
55.7
27.9
35.4
(010)
ARK3 (Vo)
AtSl (Vo)
70.4
70.9
1 O0
60.5
63.9
57.6
62.3
24.2
36.4
57.1
57.0
60.5
1O0
58.7
63.2
58.5
26.2
34.1
Table 2. Percent Amino Acid ldentity between the Kinase
Domains of the Following Arabidopsis and Brassica Genes
ARKl
A RK2
A RK3
SRKs
RLKl
RLK4
ARKl (Vo)
ARK2 (Yo)
ARK3 (%)
1 O0
93.0
80.3
68.7
33.0
33.4
93.0
1 O0
81.3
68.9
34.1
35.4
80.3
81.3
1 O0
65.0
34.0
30.2
insertions and deletions. Most notable was a 132-bp insertion
at a nucleotide position corresponding to position 94 in the
AfS7 gene. This insertion introduced two stop codons and interrupted the reading frame such that the SY7 sequence could
encode only a truncated protein of 38 amino acids. Examination of the sequences flanking the SY7 pseudogene also
revealed extensive sequence similarity with the corresponding regions of AfS7. The SY7 and AfS7 3' flanking regions
exhibited 87.9% nucleotide identity for at least 600 bp after
the stop codon used in AfS7. The S'flanking region of the SY7
pseudogene shared sequence similarity with the corresponding AfS7 5'region until just 16 bp upstream of the putativeTATA
box (located at position -54 relative to the start of translation
in AfS7). An additional 270 bp of promoter sequence exhibiting 94.3% identity with AS7 promoter sequences immediately
5'of the TATA box (-55 to -315 bp in AfS7) were found 1.3
kb farther upstream of SY7.
SY2a, SY2p, and SY2y were found to be truncated S-related
sequences. The SY2a sequence exhibited 91% nucleotide
identity with the first 400 bp of the AtS7 coding region. No sequence similarity was detected between SY2a and AfS7 in
regions flanking this 400-bp sequence. A potential TATA box
was located at position -34 relative to the ATG initiating codon.
However, the location of this TATA box was aberrant relative
to theAfS7 gene, in which the TATA box is located at -54 relative to the start of translation. In addition, the SY2a sequence
predicted a truncated 154-amino acid protein terminating in
a stop codon located .u70 bp 3'0f the AfS7-homologous400-bp
region.
The SY2p sequence exhibited 91.9% nucleotide sequence
identity with the AfS7 gene from nucleotide positions 268 to
711 of the AfS7 coding region. As a result, the 5' end of the
SY2p sequence overlapped over 141 bp with the 3'sequence
of SY2a. A 1-bp deletion ata position correspondingto nucleotide position 468 in AS7 led to a frame shift and generated
a stop codon 50 bp farther downstream. The SY2y sequence
exhibited 91.3% nucleotide identity with the 3' region of the
AfS7 coding sequence, beginning at AS7 nucleotide position
705 and continuing for 19 bp after the stop codon. The SY2b
and SY2y sequences thus overlapped by 6 bp. A 2-bp deletion
occurred 108 bp into the S-related sequence of SY2y (corresponding to nucleotide positions 813 and 814 in AW), shifting
the reading frame, which then terminated in a stop codon 20 bp
downstream. Interestingly, sequences 89.5% identical to the
Arabidopsis S Locus-Related Genes
3' flanking region of the AtS1 gene over a few hundred base
pairs were found again almost 300 bp after the Sf2y stop
codon.
The Sf 7 and the SV2a, Sf2/3, and Sf2r sequences considered together thus represent two duplicate genes that exhibit
~90°/o sequence identity with each other and >90°/o identity
with the AtS1 gene. Interestingly, the Sf 1 sequence on the
one hand and the Sf2a, Sf2/J, and Sf2y sequences on the
other hand share 35 point mutations and two deletions relative to the AtS1 gene and therefore appear to be more closely
related evolutionary to each other than to AtS1.
1
2
1835
3
9766-
o
; oo
45Expression of the Arabidopsis AtS1, ARK2, and ARKS
Genes
31-
The AtS1 Gene
We had previously shown that the AtS1 gene exhibits a floral
bud-specific expression pattern by RNA gel blot analysis of
floral bud and seedling tissues and by RNA PCR using genespecific primers (Dwyer et al., 1992). More recently, we isolated several AtS1 cDNA clones from an Arabidopsis floral bud
poly(A)+ RNA. Based on the similarity of the floral bud-specific expression pattern of AtS1 with that of the Brass/'ca SLR1
gene and on the observation that the AtS1 and SLR1 genes
AtSl
(-1320
-S3
+ 132
92.2%
200 bp
91.0%
S V2 p
+375
91.9%
91.3%
Figure 4. Schematic Representation of the ST7, Sf2cr, Sf2/3, and
Sf 2r Pseudogene Structures Relative to the AtSl Gene.
The pseudogenes are positioned below the diagram of the AtSl gene
and its flanking sequences and are in alignment with their regions
of shared nucleotide sequence identity. The percent nucleotide sequence identity shared by the AtS1 gene and each S pseudogene region
is indicated below each pseudogene. The numbers above the diagrams
indicate the lengths, in base pairs, of the longer insertions (positive
numbers) and deletions (negative number) found in the pseudogenes
relative to the AtSl gene.
I
Figure 5. Immunoblot Analysis of Total Protein Extracts from Pistils
of Arabidopsis and Brass/ca.
Lane 1 contains protein extracts from Arabidopsis strain C24; lane 2,
protein extracts from Arabidopsis strain RLD; lane 3, protein extracts
from B. napus. The blot was treated with polyclonal antibodies produced against the AtS1 fusion protein. The AtS1 glycoforms are
indicated by small circles and the SLR1 glycoforms by large circles.
Molecular mass standards are shown at left in kilodaltons.
share more sequence identity with each other than with other
members of the S gene family (Dwyer et al., 1992; Table 1),
we had suggested that AtS1 is a good candidate for the functional homolog of the Brass/ca SLR1 gene (Dwyer et al., 1992).
The relationship between the AtS1 and SLR1 genes was investigated further by comparative immunochemical analyses
aimed at assessing the antigenic relatedness of the AtS1 and
SLR1 proteins. In addition, reporter gene analyses were performed with AtS1 and SLRl promoter sequences to compare
the site of expression of the two genes in floral tissues. Figure
5 shows that, when used to probe pistil extracts of Arabidopsis strain C24 (lane 1) and strain RLD (lane 2), antibodies
produced against a glutathionine S-transferase (GST)-AtS1
fusion protein (see Methods) identified a cluster of bands of
51 to 53 kD; we believe that these are the products of the AtSl
gene. Molecular mass heterogeneity is a characteristic of glycoproteins in the S gene family and has been shown to be
due to differential N-glycosylation of a single primary translational product (Umbach et al., 1990). Thus, AtS1 proteins exist
as glycoforms that, interestingly, can exhibit strain-to-strain
polymorphism, as shown by the molecular mass differences
observed in the C24 and RLD strains (Figure 5). The anti-AtS1
antibodies also cross-reacted with stigma extracts of B. napus
(lane 3), in which they bound to a series of protein bands similar in molecular weight to AtS1 and previously identified as
SLR1 glycoforms (Umbach et al., 1990). Conversely, the Arabidopsis AtS1 proteins reacted with antibodies produced against
1836
The Plant Cell
Brassica SLRl protein (Umbach et al., 1990)(data not shown),
further underscoring the relatedness of these two proteins.
The similarity between AfS7 and SLRl was also supported
by a comparison of AfS7 and SLRl 5'flanking sequences. The
alignment in Figure 6 shows that the promoters share extensive sequence identity. In particular, severa1 DNA elements
previously shown to be conserved in the promoters of the SLRl
and SLG genes (Dzelzkalns et al., 1993)are also found in the
AfS7 promoter. To determinewhether theAfS7 and SLRl genes
are indeed expressed in the same cell types, we constructed
a chimeric gene, AfS7::uidA, consisting of a 350-bp sequence
derived from the promoter region of AfS7 fused to the Escherichia coliuidA gene that encodes P-glucuronidase(GUS). For
comparative purposes, we also constructeda second chimeric
gene, SLRtuidA, which consists of 1.5 kb of 5'sequence from
a B. oleracea SLRl gene (Lalonde et al., 1989)fused to M A .
The two constructs were introduced into Arabidopsis plants
by Agrobacterium-mediated transformation. Twenty and 12
transgenic plants were recovered for the AtS7::uidA and
SLR7::uidA transformations, respectively. Of these, 15
AtS7::uidA and nine SLR7::uidA transformants exhibited GUS
activity. Figure 7 shows that GUS activity was detected specifically in the papillar cells of the stigma in the AfS7::uidA
(Figure 7A) as well as the SLR7::uidA (Figure 76) transformants.
No GUS activity was detected in any other cells of Arabidopsis transformants or in untransformed plants (Figure 7D). In
papillar cells, the intensity of blue staining increased during
the development of floral buds, and maximal activity levels were
correlated with flower opening (Figure 7C). The intensity of
staining subsequently decreased in older flowers, probably due
to the postpollination autolysis of papillar cells. Interestingly,
the AtSl and SLRl promoters were not detectably active in
transgenic Arabidopsis anthers, unlike the Brassica SLG promoter, which was reported to be active in the anther tapetum
(Toriyama et al., 1991).This result differs from the result obtained in transgenic tobacco, in which the SLR7 promoter was
found to direct GUS activity in pollen (Hackett et al., 1992;6.A.
Lalonde and J.B. Nasrallah, unpublished observations). This
difference in SLRl promoter activity may reflect different distributions of the relevant transcription factors in tobacco and
Arabidopsis pollen.
lhe ARK Genes
lnitial studies suggested that theARK7, ARK2, andARK3genes
were expressed in the same organ systems. cDNA clones derived from all three ARK genes were isolated from libraries
derived from Arabidopsis floral bud or seedling poly(A)+ RNA.
However, RNA PCR using primers specific forARK2 and ARK3
suggested that the two genes did not have precisely overlapping spatial expression patterns (data not shown): ARK2
transcripts could be amplified from above-ground tissues but
not from roots, whereas ARK3 transcripts could be amplified
from above-ground tissues as well as from roots.
Here, we report on the activity of the ARK2 and ARK3
promoters in transgenic Arabidopsis plants. A similar experiment performed with the ARK7 gene together with a
biochemical characterization of the ARKl kinase will be described elsewhere (C.M. Tobias and J.B. Nasrallah,manuscript
in preparation).To prepare the appropriate reporter gene constructs, PCR-generated fragments of 718 and 1600 bp
containing 5' upstream sequences were derived from the ARK2
and ARK3 genes, respectively, and fused to the uidA gene (see
Methods). Arabidopsis plants transformed with these constructs were analyzed histochemically for GUS activity in the
TI and T2 generations throughout the course of plant
development.
The patterns of GUS activity for each promoter are illustrated
in Figures 8 and 9. Transformation with the ARK2 promoter::uidA construct produced 25 kanamycin-resistant
primary transformants, all of which exhibited strong and consistent GUS activity. The pattern of ARK2 promoter activity was
analyzed in detail in eight independent T2 transgenic families.
This promoter was inactive in germinating seed and P-dayold seedlings (Figure 8A), and it became active only in 4-dayold seedlings (Figure 86). GUS activity was first detected in
a group of cells located at the dista1 tip of the cotyledon and
subsequently spread in a basipetal direction to encompass
all cells of the cotyledonary blade (Figures 8 6 to 8E).In older
seedlings,ARK2 promoter activity was also detected in leaves
(Figures 8F and 8G). Here again, a basipetally directed wave
of promoter activity was associated with leaf maturation: only
the tips of newly emerged leaves were visibly stained, whereas
box i
box 11
TGTTCAACAACATATGTTATGTTGCACGAGCMATTAATTTCACATGGTGACGTTATC~ACTAATGACAGT~GTTTG?ITGAAG
Atsi
-250
SLRl
-308
Atsi
SLRl
-167
AtSl
SLR1
-84 CAAATTTGAAAACCAACATGTGAAGAAATCTATAAATATATAGGTTTT~GA~CAAAGAAGAGCA~~GAAATAGAAAG~CGTG~G
-142 T::GACAT:::C:ATGC:M:T::A:TCAAACC:TCCTC:TTAGGTTT:C::ATCTA:TA:AG:C:TA::GTCC:TAT::A:CA
GTCCA::A:CACA::::::C::..::T::.-....C..-::...G::'
..
. . . . . . . . ... .:A:G::::C
box 111
box IV
box V
. . . . :A:]:: : : : : :A: :A
~GAATCAATGAGGTA~TGAAGTCATAGAL~CGTGGAATGAGTTTTG
: : : C : : : " . '
-225 I:::G:T::::I::TGG:[::G:::::::::::(:T:::::::TM:19:A::T:::::::::::~::::GT::ATA:TATCTACAAT
Figure 6. Nucleotide Sequence and Alignment of the Promoter Regions of the Arabidopsis A S 7 and Brassica SLR7 Genes.
The five regions that are conserved among Brassica SLR7 and SLG promoters (Dzelzkalns et al., 1993) are indicated by boxes. The sequences
are numbered from the translation initiation codon of each gene.
Arabidopsis S Locus-Related Genes
1837
Figure 7. Reporter Gene Analysis of AtSl and Brassica SLR1 Promoter Activity in Transgenic Arabidopsis.
(A) Histochemical localization of GUS activity in flowers of a transformant expressing the AtS1 promoter::u/d/4 fusion. Bar = 0.2 mm.
(B) Histochemical localization of GUS activity in flowers of a transformant expressing the SLR1 promoter.-.uidA fusion. Bar = 0.2 mm.
(C) AtSI promoter activity in stigmas at different stages of flower development. Bar = 0.5 mm.
(D) Histochemical staining of a flower from an untransformed plant. Bar = 0.2 mm.
all cells of the leaf blade stained Intensely at leaf maturity. In
inflorescences, intense blue staining was observed in the
sepals of floral buds and flowers (Figure 8H). In addition, light
blue staining was detected in the styles of mature flowers (Figure 81). No GUS activity was evident in other cells of the flower
and inflorescence or in petioles, stems, and roots at any stage
of development.
The ARK3 promoter exhibited low and somewhat variable
expression in transgenic plants. Of 20 kanamycin-resistant primary transformants generated with the ARK3::uidA construct,
seven had histochemically detectable GUS activity. Three families exhibited a highly specific pattern of GUS activity, as shown
in Figure 9. In the T2 progeny of these plants, GUS activity
was first detected 1 week after seed germination. Intense blue
staining was observed in the central core of the transition zone
between the root and hypocotyl (Figure 9A), a zone from which
adventitious roots originate at later stages of plant development. GUS activity was also observed in a small group of cells
at the base of emerging lateral roots (Figures 98 to 9D) as well
as at the base of lateral shoots and flower pedicels (Figures
1838
The Plant Cell
Figure 8. Histochemical Localization of GUS Activity in Transgenic Arabidopsis Expressing the ARK2 Promoterr.uidA Fusion.
(A) A vernalized seed and two 2-day-old seedlings. There is no detectable GUS activity. Bar = 0.5 mm.
(B) and (C) Four-day-old seedlings. Note the blue staining in the tip of the cotyledons in (B) and the basipetal progression of staining in (C).
Bars = 1 mm.
(D) Five-day-old seedling. The entire cotyledonary blade stained blue. Bar = 1 mm.
(E) Seven-day-old seedling. Blue staining is visible in the tips of the first pair of leaves. Bar = 1 mm.
(F) and (G) Two- and four-week-old seedlings. Intense blue staining is visible only in the leaf blades of mature leaves. Bars = 1 mm.
(H) Inflorescence. Intense blue staining is restricted to the sepals of floral buds and flowers. Bar = 0.5 mm.
(I) Mature flower. In addition to strong staining in the sepals, weak blue staining is visible in the style (arrow). Bar = 0.5 mm.
9E and 9F). In addition, six of the seven transgenic families
exhibited very low levels of GUS activity in leaves (data not
shown).
DISCUSSION
We have shown that the Arabidopsis genome contains six
genes that exhibit sequence similarity with members of the
Brassica S gene family. Of the four functional genes contained
in these regions, only the AtSI gene was found to exhibit floralspecific expression. The observation that the AtS1 promoter
is active specifically in papillar cells together with the immunological relatedness of AtS1 to Brassica SLR1 supports the
hypothesis that the AtS1 and SLR1 genes are functional homologs and strongly suggests that their respective protein
products perform a pollination-related function common to selfincompatible and self-fertile crucifers.
In contrast to AtS1, the ARK2 and ARK3 genes are expressed
predominantly in vegetative tissues. We found that the activities of VneARK2 and ARK3 promoters differed both qualitatively
Arabidopsis S Locus-Related Genes
1839
Figure 9. Histochemical Localization of GUS Activity in Transgenic Arabidopsis Expressing the ARK3 Promoter::u/d/\ Fusion.
(A) Eight-day-old seedling. Blue staining is visible in the central core of the transition zone (arrow) between the root and hypocotyl. No staining
is evident in the aerial parts of the seedling. Bar = 0.5 mm.
(B) and (C) Enlarged view of GUS staining in the root-hypocotyl transition zone (B) and at the base of lateral root initials (arrows in [B] and
(C)). Bars = 1 mm.
(D), (E), and (F) Five-week-old plant. In (D), roots were stained blue at the base of emerging lateral roots. In (E), a nodal region was stained
at the site of origin of an axillary bud. In (F), a portion of an inflorescence showed staining at the base of axillary buds and flower pedicels (arrow).
Bars in (E) and (F) = 1 mm; the bar in (D) = 0.3 mm.
1840
The Plant Cell
and quantitatively. The ARK2 promoter was found to direct consistent and relatively high expression in the leaf blade as well
as in sepals, paralleling the maturation of these structures.
No expression from this promoter was detected in anthers, petals, pedicels, petioles, stems, or roots. The ARK3 promoter
was also active in leaves but at much lower levels than the
ARK2 promoter, as revealed by the faint and variable blue staining observed in leaves of different transgenic plants. No overlap
between the sites of ARK2 and ARK3 expressionwas observed
in other organ systemsof the plant. Thus, in roots and inflorescences, ARK3 promoter activity was limited to a small subset
of cells at the root-hypocotyl transition and at the base of lateral
roots, lateral shoots, and flower pedicels. Significantly, except
for the low leve1of ARK2 promoter activity observed in the styles
of mature flowers, the ARK2 and ARK3 promoters as well as
the ARKl promoter (C.M. Tobias and J.B. Nasrallah, manuscript in preparation) were not active in reproductive organs.
In particular, the observation that the ARK promoters are not
active in stigmatic papillar cells argues against a functional
association between ARK and A S 7 gene products and suggests that, unlike Brassica SLG, AtSl does not function in
conjunction with a receptor-likeprotein kinase, at least not one
with which it would share a substantial degree of sequence
identity. More generally, the absence of ARK promoter activity in stigmas, ovaries, anthers, and pollen grains argues
against a pollination-or fertilization-related function for these
receptor-like protein kinases in Arabidopsis.
Rather, the data presented in this study are consistent with
the notion that theARK2and ARK3 genes function during development of the Arabidopsis sporophyte, perhaps in processes
relatedto organ maturation andlor the establishment of growth
pattern transitions. Based on DNA sequence analysis, the
ARK2 and ARK3 proteins are predictedto be transmembrane
proteins, with extracellular S domains that are proposed to function in the binding of a specific ligand, thereby initiating signal
transduction and eliciting the appropriate cellular response.
Biochemical evidence will be required to determine whether
the ARK2 and ARK3 proteins do in fact exhibit intrinsic kinase
activity. Nevertheless, based on the presence of the DLKASN
and GTYGYMSPconsensus sequences in their kinase domains,
these proteins are predicted to have serinelthreonine rather
than tyrosine kinase specificity. Indeed, the Brassica SRK
proteins were shown to exhibit intrinsic serinehhreonineprotein
kinase activity (Goring and Rothstein, 1992; Stein and Nasrallah,
1993), and a similar substrate specificity was shown for the
Arabidopsis ARKl protein (C.M. Tobias and J.B. Nasrallah,
manuscript in preparation).
The relatively high degree of sequence conservation observed between the ARK kinase domains suggests that they
may phosphorylatethe same or related cytoplasmic substrates.
In contrast, we found that the S domains of the ARK genes
exhibit a higher degree of sequence divergence than their kinase domains (Tables 1 and 2). This was especially apparent
in the comparison of the tandemly repeated ARKl and ARK2
genes, for which the divergences in amino acid sequence identity for the S and kinase domains were 21.4 versus 7 % ,
respectively. This divergence of the S domains among the various ARK receptor protein kinases suggests that they may be
activated by different ligands. Taken together with the nonoverlapping expression patterns of the ARKgenes, the data suggest
that the putative receptor protein kinases encoded by these
genes have distinct functions.
The Arabidopsis S-related sequences define four genomic
regions that occur as two genetically linked clusters on two
distinct chromosomes. In Brassica, it has been shown that gene
duplication events have occurred repeatedly during the evolution of the Sgene family. In particular, a duplication apparently
led to the generation of the S locus gene pair SLG and SRK
(Tantikanjanaet al., 1993). Duplicationevents appear to have
occurred in the Arabidopsis genome as well. A relatively recent gene duplication event is suggested by the arrangement
of the highly similar ARKl and ARK2 genes as a tandem repeat. Gene duplications are also likely to have been involved
in generating the S pseudogenes of region 3. These pseudogenes show >90% identity with the A S 7 gene. The SY7
gene also shows >87.9% identity in its flanking sequences relative to the correspondingflanking sequences of AtS7. When
the S pseudogene sequences are compared with each other,
35 point mutations and two deletions relative to theAfS7 gene
are found common to both SY7 and SY2a, SY2p, and SY2y.
This observation suggests that two duplication events may have
occurred to generate the S pseudogenes: an initial duplication of theAfS7 gene to an unlinked chromosomal site would
have generated SY7 and related flanking regions; a second
duplication of SY7 to a linked site followed by a series of insertions of extraneous DNA would have subsequently generated
thesplit SY2a, SY2p, and SY2y pseudogenes. It is interesting
to note that neither SY7 nor SY2y contains the 1-bp insertion
that occurs in AtS7 at nucleotide position 1252, which shifts
the reading frame of the AfS7 gene relative to the Brassica
SLR7 gene (Dwyer et al., 1992). This mutation must have occurred in theAfS7 gene after the initial duplication event that
generated the S pseudogenes.
Interestingly, when S pseudogene sequences are compared
with the Brassica SLRl and SLGsgenes, all consistently show
more nucleotide identity with SLRl (high 70%) than with SLGs
(low 70%). Furthermore, no kinase-homologous sequences
occur in the vicinity of the pseudogenes, as determined by
pulse field gel electrophoresis (data not shown). These two
observations support the hypothesis that the S pseudogenes
are derived from the AtS7 gene, as suggested previously, and
intimate that these pseudogenes are not the remnants of an
Arabidopsis equivalent of the Brassica S locus SLG and SRK
genes. In fact, we found no evidence, based on either nucleotide sequence or expression pattern, for the existence of an
SLGISRK-like gene pair in the Arabidopsis genome that might
correspond to the Brassica S locus or that might function in
pollination. In particular, the AtS7 and ARK3 genes, which exhibit tight genetic linkage, share only 60% sequence identity,
are expressed in different cell types, and are therefore functionally unrelated. Thus, if an ancestral S locus equivalent ever
existed in the Arabidopsis lineage, it has apparently been
Arabidopsis S Locus-Related Genes
deleted during the evolution of this self-fertile genus. It is interesting to note in this context that deletion of BrassicaS locus
gene sequences has been reported to result in the breakdown
of self-incompatibility (Nasrallah et al., 1994) and is therefore
an important factor in shaping breeding behavior in the largely
self-incompatible Brassica species.
In any event, the observation that the papillar cells of
Arabidopsis apparently do not express an S-related receptor
protein kinase suggests that pollination responses in this species, although perhaps requiring a secreted glycoprotein such
as AtS1, are not likely to be mediated by signaling receptors
closely related to the Brassica S locus gene products. This
conclusion is consistent with the results of previously reported
transgenic studies in which papillar cells were specifically ablated in Arabidopsis plants transformed with a gene fusion
between the promoter of the Brassica SLG promoter and
subunit A of diphtheria toxin (Thorsness et al., 1993). These
ablated papillar cells, although biochemically inactive, still allowed, albeit at reduced efficiency, the development of pollen
grains in crosses to the wild type, indicating that successful
pollen tube development in Arabidopsis does not require signaling by papillar cells. Thus, the comparative analysis of
Arabidopsis and Brassica provides no evidence for the evolution of the Brassica self-incompatibility system from a signaling
system operative in compatible pollination. However, the sequence and expression data presented here strongly suggest
that the Brassica SLG/SRK gene pair operative in the highly
specific discrimination between self- and cross-pollen was
recruited from vegetatively expressed genes that have a function unrelated to pollination.
METHODS
Plant Material
Arabidopsis thaliana strain C24 was obtained from M. Jacobs (Vrije
Universiteit, Brussels, Belgium) and strain RLD from C. Somerville
(Carnegie lnstitution of Washington, Stanford,CA). For restrictionfragment lengthpolymorphism(RFLP) mapping, the recombinantinbred
lines developed by C. Lister and C. Dean (John lnnes Institute, Norwick, U.K.) were obtained from the Arabidopsis Biological Resource
Center at Ohio State University (Columbus, OH).
lsolation of Arabidopsis S-Related Sequences and Nucleotide
Sequence Analysis
An Arabidopsis Columbia genomic library consisting of parlially
digestedMbol DNA fragments and constructed in the vector EMBL3
was obtained from Clonetech (Palo Alto, CA) and used for lhe first
screeningwith cDNA probes derived from the Brassica SLG (S Locus
Glycoprotein) and SLR7 (S Locus-Related 1) genes. An Arabidopsis
Columbia genomic library consisting of partially digested Sau3Al DNA
fragmentsand constructed in the bacteriophageh vector EMBL4was
used for the second screening with ArabidopsisAtSl and Arabidopsis Receptor Kinase ( A R 4 gene probes. The AtS7 and ARK cDNA
1841
probes were obtained from a cDNA library derived from Arabidopsis
floral bud poly(A)+ RNA and constructed in the A. vector Uni-ZAPXR
(Stratagene). The librarieswere screened as described by Sambrook
e1 al. (1989). DNA probes were labeled with phosphorous-32 by the
method of Feinberg and Vogelstein (1983) using the random primer
labelingsystem of Boehringer Mannheim. Positivelyhybridizingphage
from the genomic libraries were purified and their DNA isolated according to the methcdof Thomas and Davis (1975). Positively hybridizing
phage from the cDNA library were purified and their DNA isolated as
pBluescriptphagemidsaccording to protocols supplied by the manufaclurer (Stratagene).The regions that hybridizedto S domain and kinase
probes found on the genomic clones were delinealed by DNAgel blot
analysis (Southern, 1975) and subcloned either into pUC118/pUC119
(Vieira and Messing, 1987)or pBluescript SK+ and KS+ (Stralagene)
plasmidvectors. Nested deletions spaced at -200-b~ intervals were
generated by Exolll digestion using the Erase-A-Base system
(Promega). Nucleotide sequence was determined by the dideoxynucleotide chain termination melhod (Sanger et al., 1977) modified
for double-strandedDNA sequencing(Chen and Seeburg, 1985)and
using the Sequenase V2 kit (U.S. Biochemical Corp.). For lhe DNA
blot analysis used to correlate the cloned S-related regions with the
organization of the S gene family in the Arabidopsis genome, genomic
DNA from the Columbia ecotype was obtained from Clonetech. The
method used in this and DNA gel blot analyses performed to determine the chromosomal location of the S-related regions by RFLP
mapping was as described by Dwyer et al. (1992).
Detection of Gene Expression by RNA Polymerase Chain
Reaction Amplification
Poly(A)+ RNA was isolated from the indicated Arabidopsis tissues
using the MicroFast Track kit (Invitrogen, San Diego, CA). For amplification by polymerase chain reaction (PCR), poly(A)+RNA was treated
with RNase-freeDNasel(BoehringerMannheim),as suggested by Grillo
and Margolis (1990). The resulting DNA-free poly(A)+RNA was amplifiedwith the GeneAmp RNA PCR kit (PerkinElmer Cetus, Norwalk,
CT) using gene-specificsynthetic oligonucleotides(Midland Co., Midland, TX). PCR-generatedfragments were detected by electrophoresis
of one-lenthto one-fifthof lhe PCRs in 1 to 1.2% (wh) agarose gels.
Protein lmmunoblot Analysis
To produce an AtSl fusion protein, we generated a 982-bp 89111fragment containing AtS7 coding region sequences from position +314
through +1291 bp and subcloned this fragment into the BamHl site
of expression vector pGEX-3X (Pharmacia). The resulting clone, pKDX9,
determinedto havethe correclorientation of theAtS7 insert by Hindlll
and Sstl digestion, contained the glutathionine S-transferase coding
region fused to that of AtS7 commencing 106 codons downstream of
the start codon and ending at codon 430. The pKDX9 fusion protein
was expressed in Escherichiacoli JM109 afler inductionwilh 0.1 mM
isopropylP-o-thiogalactopyranosidefor 4 hr at 3OOC. Cells were lysed
by sonication in phosphate-bufferedsaline, pH 7.4, containing 1% (vh)
Triton X-100, and the bacterial extracts were subjected to SDS-PAGE
on 10% (wh) polyacrylamidepreparative gels and detected by Coomassie Brilliant Blue R 250 staining. The fusion protein was isolated by
electroelution according to the procedure of Hunkapillar et al. (1983)
and was usedto immunize a rabbit at the Cornell UniversityPolyclonal
Anlibody Production Facility.
1842
The Plant Cell
For immunoblot analysis, Arabidopsis stigmas were ground at liquid nitrogen temperature in an Eppendorf tube with a fitted pestle.
Proteins were extracted either in 10 mM Tris-HCI buffer, pH 7.2, or in
a sample extraction solution containing 80 mM Tris-HCI, pH 6.8, 1%
(w/v) SDS, 1.5% (w/v) dithiothreitol, and 10% (v/v) glycerol. Routinely,
three stigmas were extracted in 25 pL of buffer, and the entire extract
was loaded in one gel lane for electrophoresis. Stigmas of Brassica
napus were processed in the same manner, except that proteins from
two stigmas were extracted in 50 pL of buffer and one-tenth of the
final volume was loaded per lane. SDS-PAGE, electrophoretic transfer to nitrocellulosemembrane, and treatment with primary antibody
followed by treatment with alkaline phosphatase-conjugated anti-rabbit
IgG secondary antibody were performedas describedearlier (Umbach
et al., 1990).
Construction of Reporter Gene Fusions, Plant Transformation,
and Histochemical Analysis of b-Glucuronidase Activity
DNA fragmentscontaining5' upstreamsequences of the AfSI, ARK2,
and ARW genes were generated by PCR amplification using the
GeneAmp PCR kit and the appropriate promoter-specific primers (Midland Co.). To facilitatecloning, a BamHlrestrictionsite was incorporated
into the synthetic primers. All of the antisense primer sequenceswere
chosen to locate the ATG start codon of the P-glucuronidase(GUS)
reporter gene at the same relative position as the ATG start codon
of the corresponding S gene. The DNA fragments thus made were
cloned into the pCRll vector using the TACloning kit (Invitrogen). Each
of the promoter inserts was excised from this vector by BamHl digestion and cloned into the BamHlsite of the GUSexpressionvector pBllOl
vector 5' of the uidA gene encoding the GUS protein followed by a
polyadenylation site (Jefferson et al., 1987). The correct orientation
of the promoter relative to the GUS coding sequences was verified
by restriction enzyme digestion, by PCR amplificationwith appropriate primers, and by DNA sequencing.
The resulting chimeric ConStructswere introduced into Agmbac@rium
rumefaciens pCIB542/A136 (derived from helper plasmid pEHA101;
Hood et al.; 1986). Transformation of Arabidopsis C24 was performed
by the method of Valvekens et al. (1988), and transgenic plants were
selected on the basis of kanamycin resistance. Stable integration of
the transgene was confirmed by DNA gel blot analysis.
GUS assays were performed histochemicallywith the chromogenic
substrate 5-bromo-4-chloro-3-indoylglucuronide (X-gluc; Jeffersonet
al., 1987)as detailed by Toriyama et al. (1991). To monitor GUS activity
at early stages of plant development, T2seeds generated by the selfing of primary transformantswere sterilized, sown on Murashigeand
Skoog plates (Murashigeand Skoog, 1962),and vernalized for 3 days
at 4OC. The plates were then transferred to a 25OC growth chamber
for germinationand subsequent growth. Staining for GUS activity was
performed on developing seedlings starting 1 day after transferring
the plates to 25OC. GUS activity at later stages of development was
assayed in growth chamber- or greenhouse-grown plants.
ACKNOWLEDGMENTS
REFERENCES
Boyes, D.C, Chen, C-H., Tantikanjama, T., Esch, J.J., and Nasrallah,
J.B. (1991). lsolationof a second S locus related cDNA from B. oleracea: Genetic relationshipbetweenthe S locus and two relatedloci.
Genetics 127, 221-228.
Chen, C.H., and Seeburg, P.H. (1985). Supercoil sequencing: A fast
and simple method for sequencing plasmid DNA. DNA 4, 165-170.
Dwyer, K.D., Lalonde, B.A., Nasrallah, J.B., and Nasrallah, M.E.
(1992). Structure and expression of AtS7. an Arabidopsis fhaliana
gene homologous to the S locus related genes of Brassica. MOI.
Gen. Genet. 231, 442-448.
Dzelzkalns, V.A., Thorsness, M.K., Dwyer, K.D., Baxter, J.S., Belent,
M.A., Nasrallah, M.E., and Nasrallah, J.B. (1993). Distinctcis-acting
elements direct pistil-specificand pollen-specificactivity of the Brassica S locus glycoprotein gene promoter. Plant Cell 5, 855-863.
kinberg, A.P., and Vogelstein, B. (1983).A technique for radiolabeling
DNA restriction endonuclease fragments to high specific activity.
Anal. Biochem. 132, 6-13.
Goring, D.R., and Rothstein, S.J. (1992). The S-locus receptor kinase gene in the self-incompatible Brassica napus line encodes a
functional serinekhreonine kinase. Plant Cell 4, 1273-1281.
Grillo, M., and Margolls, F.L. (1990). Use of reversetranscriptase polymerase chain reaction to monitor expression of intronless genes.
Biotechniques 9, 263-268.
Hackett, R.M., Lawrence, M.J., and Franklin, F.C.H. (1992). A Brassica S locus related gene promoter directs expression in both pollen
and pistil of tobacco. Plant J. 2, 613-617.
Hanks, S.K., Quinn, A.M., and Hunter, T. (1988). The protein kinase
family: Conservedfeatures and deduced phylogenyof the catalytic
domains. Science 241, 42-52.
Hood, E.E.,Helmer, G.L., Fraley, R.T., and Chilton, M.D. (1986).The
hypervirulence of Agrobacterium tumefaciens A281 is encoded in
a regionof pTiBo542outside of T-DNA. J. Bacteriol. 168,1291-1301.
Hunkapillar, M.W., Lojan, E., Ostrander, F., and Hood, L.E. (1983).
lsolation of microgram quantities of proteins'from polyacrylamide
gels for amino acid sequence analysis. Methods Enzymol. 91,
227-236.
Isogai, A,, Yamakawa, S., Shiozawa, H., Takayama, S.,Tanaka, H.,
Kono, T., Watanabe, M., Hinata, K., and Suzuki, A. (1991). The
cDNA sequence of NS1 glycoprotein of Brassica campestris and
its homology to S locus related glycoproteins of B. oleracea. Plant
MOI. Biol. 17, 269-271.
Jefferson, R.A., Kavanaugh, T.A., and Bevan, M.W. (1987). GUS
fusions: 6-Glucuronidaseas a sensitiva and versatile gene fusion
marker in higher plants. EMBO J. 6, 3901-3907.
Lalonde, B.A., Nasrallah, M.E., Dwyer, K.G., Chen, C.-H., Barlow,
B., and Nasrallah, J.B. (1989). A highly conserved Brassica gene
with homology to the S-locus-specific glycoprotein structural gene.
Plant Cell 1, 249-258.
This work was supported by the NationalScience Foundation through
RUI(Researchat an UndergraduateInstitution)Grant No. IBN-9108232
to K.G.D. and Grant No. IBN-9220401 to M.E.N. and by a grant from
the U.S. Department of Agriculture to J.B.N.
Murashige, T., and Skoog, F. (1962). A revised medium for rapid growth
and bioassays with tobacco tissue cultures. Physiol. Plant. 15,
473-497.
Received August 22, 1994; accepted October 18, 1994.
Nasrallah, J.B., and Nasrallah, M.E. (1993). Pollen-stigma signaling in the sporophytic self-incompatibility response. Plant Cell 5,
1325-1335.
Arabidopsis S Locus-Related Genes
Nasrallah, J.B., Kao, T.H., Chen, C.-H., Goldberg, M.L., and
Nasrallah, M.E. (1987). Amino-acidsequence of glycoproteinsencoded by three alleles of the S-locus of Brassica oleracea. Nature
326, 617-619.
Nasrallah, J.B., Yu, S.M., and Nasrallah, M.E. (1988). Selfincompatibility genes of Brassica oleracea: Expression isolation
and structure. Proc. Natl. Acad. Sci. USA 85, 5551-5555.
Nasrallah, J.B., Rundle, S.J., and Nasrallah, M.E. (1994). Genetic
evidence for the requirement of the Brassica S locus receptor kinase gene in the self-incompatibilityresponse. Plant J. 5,373-384.
Sambmok, J., Frltsch, E.F., and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd ed. (Cold Spring Harbor, NY: Cold
Spring Harbor Laboratory Press).
Sanger, F., Nlcklen, S., and Coulson, A.R. (1977). DNAsequencing
with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA 74,
5463-5467.
Stein, J.C., and Nasrallah, J.B. (1993). A plant receptor-likegene, the
S locus receptor kinase of Brassica oleracea, encodes a functional
serine/threonine kinase. Plant Physiol. 101, 1103-1106.
Steln, J.C., Howlett, B., Boyes, D.C., Nasrallah, M.E., and Nasrallah,
J.B. (1991). Molecular cloning of a putative receptor kinase gene
encoded at the self-incompatibilitylocus of Brassicaoleracea. Proc.
Natl. Acad. Sci. USA 88, 8816-8820.
Southern, E.M. (1975). Detectionof specificsequences among DNA
fragments separated by gel electrophoresis. J. MOI.Biol. 98,503-517.
Tantlkanjana, T., Nasrallah, M.E., Stein, J.C., Chen, C.-H., and
Nasrallah, J.B. (1993). An alternative transcript of the S locus glycoprotein gene in a class II pollen-recessive self-incompatibility
haplotype of Brassica oleracea encodes a membrane-anchoredprotein. Plant Cell 5, 657-666.
Thomas, M., and Davis, R.W. (1975). Studies on the cleavage of bacteriophage X DNA with EcoRl restrictionendonuclease. J. MOI.Biol.
91, 315-328.
1843
Thorsness, M.K., Kandasamy, M.K., Nasrallah, M.E., and Nasrallah,
J.B. (1993). Genetic ablation of floral cells in Arabidopsis. Plant Cell
5, 253-261.
Tobias, C.M., Howlett, B., and Nasrallah, J.B. (1992). An Arabidopsis thaliana gene with sequence similarity to the S locus receptor
kinase of Brassicaoleracea: Sequence and expression. Plant Physiol.
99, 284-290.
Torlyama, K., Thorsness, M.K., Nasrallah, M.E., and Nasrallah, J.B.
(1991). A Brassica S locus gene promoter directs sporophytic expressionin the anther tapetum of transgenic Arabidopsis. Dev. Biol.
143, 427-431.
Trick, M., and Flavell, R.B. (1989). A homozygousS genotype of Brassica oleracea expresses two S-like genes. MOI.Gen. Genet. 218,
112-117.
Umbach, A.L., Lalonde, B.A., Kandasamy, M.K., Nasrallah, J.B.,
and Nasrallah, M.E. (1990). lmmunodetectionand post-translation
modification of two products encoded by two independent genes
of the self-incompatibility multigene family of Brassica. Plant Physiol. 93, 739-747.
Valvekens, D., Van Montagu, M., and Van Lijsebettens, M. (1988).
Agrobacterium tumefaciens-mediated transformation of Arabidopsis thaliana root explants by using kanamycin selection. Proc. Natl.
Acad. Sci. USA 85, 5536-5540.
Vieira, J., and Messlng, J. (1987). Productionof single-strandedplasmid DNA. Methods Enzymol. 153, 3-11.
Walker, J. (1993). Receptor-likeprotein kinase genes of Arabidopsis
thaliana. Plant J. 3, 451-456.
Walker, J.C., and Zhang, R. (1990). Relationship of a putative receptor protein kinase from maize to S locus glycoproteinsof Brassica.
Nature 345, 743-746.
Weinstein, J.N., Blumenthal, R., van Renswoude, J., Kempf, C.,
and Klausner, R.D. (1982). Charge clusters and the orientation of
membrane proteins. J. Membr. Biol. 66, 203-212.
A superfamily of S locus-related sequences in Arabidopsis: diverse structures and expression
patterns.
K G Dwyer, M K Kandasamy, D I Mahosky, J Acciai, B I Kudish, J E Miller, M E Nasrallah and J B
Nasrallah
Plant Cell 1994;6;1829-1843
DOI 10.1105/tpc.6.12.1829
This information is current as of August 3, 2017
Permissions
https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532
298X
eTOCs
Sign up for eTOCs at:
http://www.plantcell.org/cgi/alerts/ctmain
CiteTrack Alerts
Sign up for CiteTrack Alerts at:
http://www.plantcell.org/cgi/alerts/ctmain
Subscription Information
Subscription Information for The Plant Cell and Plant Physiology is available at:
http://www.aspb.org/publications/subscriptions.cfm
© American Society of Plant Biologists
ADVANCING THE SCIENCE OF PLANT BIOLOGY