Download Doug Juvinall December 8, 2009 Bradley University Bio 464 Lab

Doug Juvinall
December 8, 2009
Bradley University
Bio 464 Lab
Abstract: Cyclins play an important role in the life of a cell. An RTPCR gel can be used to
determine their activity at different time points in the cell cycle. The activity of the cyclin
TTHERM 00192000 was measured during conjugation of the ciliate Tetrahymena. TTHERM
00192000 was named CYC5. RNA was collected from Tetrahymena at different time points of
conjugation. Primers were made for the TTHERM 00192000 gene which was then used for the
RTPCR. The intensities of the gel were determined which corresponds to the amount of gene
activation at specific time points. This shows the times during conjugation where the cyclin is
supposed to be active. The times of expression from this gel did not correspond to that of the
Tetrahymena Gene Expression Database. This suggests there was error in either or both of the
data.
Introduction: Cyclins are proteins that are expressed at different times of the cell cycle. They
allow certain events to occur which permit the cell to continue the process of cell division or
conjugation as in the case of Tetrahymena. Cyclins work by binding to a cyclin dependent
kinases (CDKs) which activates it. Then the cyclin-CDK complex can phosphorylate target
proteins around the cell to allow the cell to continue its cell cycle/conjugation (Lodish et al,
2008). When ciliates are stressed, they will undergo sexual reproduction to try and produce
individuals that are able to adapt to the stress. The conjugation process can be over 14 hours
long and it has many steps that involve multiple nuclear divisions (Miao , 2009)
Figure 1. Events in the Tetrahymena thermophila conjugation cycle. Taken from Miao, et al.,
PLoS ONE. 2009; 4(2): e4429
Figure 2. Expression data for TTHERM 00192000 in T. thermophila. This is the microarray
expression profiles the gene from TGED. L = vegetative log phase growth; S = hours under
starved conditions; C = conjugation (hours post-mixing).
The TGED data suggests that the cyclin TTHERM 00192000 appears to have peak expression at
around 5 to 5.5 hours into conjugation. TTHERM 00192000 was named CYC5. 5 hours into
conjugation is the selection of one of the four meiotic products. The 5.5 hour time point is
haploid mitosis and the 5.75 time point is the exchange of pronuclei. It is likely that the cyclin
sets the cell up for either of these processes. Because haploid mitosis is occurring around the
peak activity of this cyclin, it is possible that it is involved in initiating any of the mitosis steps of
this haploid mitosis. However, the cyclin activity does not drop off immediately but instead is
gradually decreases until around the 12 hour time point which includes exconjugation, loss of
Old MAC, and 1 MIC genome rearrangement. The conjugation changes around the 5.75 hour
time point which is the exchange of the pronuclei. This means the cells create openings to
allow the exchange. The cyclin could be involved in the creation of the openings or the
persistence of it. When the cell closes the opening after the pronuclei have been exchanged, it
may change the nature of the conjugation. Since the cyclin gradually decreases after the 5.5
hour time point all the way until the 12 hour point, it is not unreasonable to assume that the
cyclin could also be involved maintaining the binding of the two Tetrahymena cells after the
exchange of pronuclei. Because of the gradual decrease in activity, this seems to be the most
likely process the cyclin is involved in.
>TTHERM_00192000 (Gene)
ATGGCTCAAAAAATTTAAGAGTTAGAAGAATAGTTTTAATAATTTGAATAATCAATTGGAATTAACGATTAAAATTTTGCTAATAAATTCATCTTTT
AGTAATTGAGGGAGAATTTGATTAAGGCTTCCGCAGAATCGAATGATAAATTGCAGAAATTTTTAGATTAGGCTCATACAAATTTGTACTTGGAAAT
TAGTTCAAAGATTTAAGCCGATTTAGATGGATTCACTAGAGAAGAATAAAACATGCTTCATTTTTATGGCGCATCAATAATTTCTGATGCATGCTAA
TATCTTTAGCTTCCAATTACAACTTGTATATCAGCCTAAACTATTTTCCACAGATTTTATACCAAGTAATTTATTTTATTTTGAATGCATTAGAAAT
ATTTTTTAATTGATTCAAAACATTAAAAATAATAAATAATTTTTTTTTTTTCTATAAAAAGGTGCTCTTTCTTGAAGCATGATATCAGGGATGTAGC
AATGGGATCAGTTTTTATAGCTGGTAAGGCTTAAGAAACAATTAAAAAGCCAAGAGATTTAGCCTATGTCTTTGATCAAATTTTTAAAGTAAATTAT
CAGTTTATATTAGATTGCTATCAGCAAAGGAGATTCCTTCAAGAATCAAATCAACCCTCCTAAATCAAACTTTTCAATAATTTTTTTAAAAAAACTT
TGAAGGAAAAAAATTAGATCTTAGCTTATTTGCTTTATCTTATGAAAATAATTATTTTAATCATTTGAACTAATTAATAATATAATTATAGGGTAAA
TTTATTTTTATGATCTATCATCATCTTCATCATCTTGCTAAATTGAAAGTATTAATATATTAAACACCTTCCCTAAACACTTTCAATGAAAATGTGG
CTGGTGTTAGTTAATAAGATTGAATTAAAGATTAATTTGTTCATCAAAATACACAAACACTACCAATTATCATTATCACTATCAACCAACAACATCA
ACGAAATAATCTATTTTGTTTGATTCCCTAGTTCCTAAAATTATATGAAAACTTCTTACTGAAGTGATAATAACAATAGATGAATTAAAATCCTTAA
TCTTATTTTTAAATACAATTATGTTAGGAATTTTTTAATTTCTCTTATTCAAAGCACAGGCCAATAAATGCTATTTTTAAGCAGAAATAGTAAGTTA
ATTCAGTTTTAGAGAAGCAAGAAAAGCTATGAAAATAATTGAATAAAAAAAGTCTTCCAAAAACAAAAATAAAATTATTTATTTCCTTCAAATAAAA
GATTTTTAATTAATTTTTAAAAAAAGCGCCCTTTTTAAATTTACTGAAAAACAAACTGTCTCTATTCATGATAGCAAATCGATATAATTTAAAAAGT
AAATTTCATGCTTTTTATTTTAAAAAATAGATTGAAGATGGTATACAACGTCCAGTTCCAATTTTAGATGATAAATCATTTAAATTTAATCATTTAA
AATAAGTGGTTTAAGACATGGAAAGAGAGATTTTAAAAGAATTAGGCTTTGAGTTATATCAAATTACATGGAATGAACAACCTCATAGATTAATGTA
CTTCTATATTAATTTATTTAAACCAAATACCAGTAATTAATCGAGTTCCTTTTAGAATTTGACTAGAACAGCATTCAACTATTTGAATGATAGTTAC
AAGACAAACATCTGTATTTTCTTCCCTTTCTAGATGATAGTAGCAAGCTGCATTTACCTAGCCTTTAGAAAGACAGGTACTGAAATGCCAAGAATTG
CTTGGTGGACAATTATGGAAACTTCTCTGAACAATCTTAAGCTAGGAGCGGGTAAAATCTAATATATTTATAATCAATTTAAATAACTTCCTAAATA
TGAGGACTGCTTCGAAATTCTTAATAAACTTGCAAAACAAAAGGAAATAGAGTTGAAAATCACTCTTAAATATCATGAATTTACAGATAGATTAAAC
CAAAGTTCTGCATCTTAGAATCCTATGTTAGCTGTCCAAGAAGCTATCGCCAAATCAAAATTAAGGGGATAAAATGGATTGGCTGCAGGAGCATCAT
CATCAGACAAGTTGTTATCATCAGATTAGCTTGAAAAAAAAGAAAATTAAGATGAAACTGCAGGAGTTACTAGTTTAAGAGATGTTACCAGTACTAA
AAATGATAAGCATAGCAAATTTTCTACGGCTGGTAGATCAGCATCAAGAGAAAGAGATAGACGTAAAAGGTCCAGAAGCAATTCCCACAAAAAATCC
CATAAAAGAAGATCAAGTCGTAGTAGAAGTCGTAATCGTAATAGAGATCGTAAGGATAAAGATAAAAAGCATTCTTCTCGTCACAGTCGCAGCAGAG
ATCGTCGTGATAGAAGTAATTCCCATAAAGATAAAAAAAAAAGAAGTAAAAGTCGTGAACGTGAACGCGAACGTAGAAAAGAAAAGTAAGAAGTCCA
AAAGCCTACAAGTGCTGAGCGTTAATAAAACGATTAATAAAAGTCTTAAGAGGAATAAAAAACCAACGGTAATGGTGCATCATCAAGTATAAAAACT
ACTTCTGAAACACCAGATATTAAGTAAGATAAAACTTCACCTTTAAATTCTAAAAAAGATAAGAATTAAAGAGATCGTGAATCTGCATCAACAGTAA
GGGATGTAAGAGAAGGTAGGGAAAAGGAAAAGGACAGAAAAGAAAGAAAGAAGAGTAGAAGCCGTAGTAGAAGTCATCATAAAAAATCTAAAAAGTA
TTATAACTCTCCTGATGATAGGGATAGTAAGAGAAAGCGCAGTAAAGATAGAAAAAAAGACTATAAAAAATCAAGGAGCAACAGCAGAGAAAAATAG
TCTAAATTTTCAGTTCCTACTTCATCTACTCAATAGATGGAATCAATTGCAAAAATTACACCTTCTCCTCCCTTGAAATAAGATAAATTTACTACAG
TTCTAAATGAAAAAAGTAATGATTTTTCATCTGTATAAAATAAAATACTTCCTTCTGATAATAAAAATATTCATTAAGAAAATCAAATAAATGGCAA
TCCAAGTATTATTGAAACAGCTGCTCCTGCTCCCAACTAAAAATTTATTTAAAAGTAAGATTTGTTTCATAATTTATAAAATAATAGCAATTTAACT
CTAATTAATAACATCAAATTACTAATAATAAAAAGAACTGATTAAATTAAGCCTCAAGAATAAAATTCTTTATTAGATGGAAAGAAAACACTTGACA
TTATCTAATAAATAAAATCTAAAATTTAATCAAAGGCTACTAATGAGGAAAGTTCGAATTAAAAAATATCAAGTTCTAATGTCACTTAAGAAACTAA
CCTAACATAGAAGGCTCAGACAAACCCAACCAAACCAACTTTAGATTTAAGCGCTAAATTGAGTGAAAAGTTTAAATAGTACGATAACAAACTGCCC
TCTTCATCATCATCAACAACAACATCAACTACAACATCAACTACAACAGCAACAAAATTAGTAGCAGGAGCCAGTTAGCCATAGTTGTCTAAGTAAT
TGTCAAAAGAAAGTATGACTTCAAACGATGATGAAAATAATGACAACGATGACTATCTGATGAGATTGAAAATGCTTCGTAAATAATTTTTACATAT
TGTTTAGATAAAATAGTGATAAAATTTAACTGTCTAAAAATTAGGTGAACAAAATAAATAAAAGGCTCAACAAGGAAACTAATGA
Figure 3. Genomic sequence of TTHERM_00192000. Red letters correspond to introns. Yellow
letters correspond to the primer sequences. Sequence from Tetrahymena Genome Database
(www.ciliate.org)
Materials and Methods: Cyclin genes were identified at the Tetrahymena Genome Database
(www.ciliate.org) by searching for proteins with the keyword “cyclin”. A BLAST search with a
cyclin protein sequence ensured that all cyclin genes were identified using this method.
Microarray data during conjugation (Miao, et al., PLoS ONE. 2009; 4(2): e4429) were collected
for each gene from the Tetrahymena Gene Expression Database (TGED; http://tged.ihb.ac.cn).
PCR primers flanking an intron were generated for each gene using Primer3 (Steve Rozen and
Helen J. Skaletsky 2000) and ordered from Integrated DNA Technology (Coralville, IA). Oligo-dTprimed M-MLV reverse transcription (RT; Ambion) was performed on RNA collected from
control cells and from cells at various stages of conjugation using the Trizol reagent (Invitrogen)
according to the manufacturer’s protocol. 1 mL of cells (2.1 x 103 cells/mL) was collected at
each time point, pelleted at 6k rpm, supernatant discarded, and cells resuspended in 1 mL of
Trizol. 180 ng of each template RNA was used per reverse transcription reaction. cDNA was
diluted 1:5 and used as a template for PCR (How much RNA for RT? ) PCR was performed in 25
uL reactions using GOTaq (Fisher, Hampton, NH) with 1 uL of each primer (10 uM). 15 uL of
completed PCR reaction products were separated on a 2% agarose gel. DNA bands were
visualized using ethidium bromide and photographed with a Kodak EDAS290 imaging system.
Band intensities were determined using ImageJ (Abramoff, M.D., Magelhaes, P.J., Ram, S.J.
"Image Processing with ImageJ". Biophotonics International, volume 11, issue 7, pp. 36-42,
2004).
Results: The RTPCR data for TTHERM 00192000 is vastly different from the TGED. This data
appears to have more activity at hours 1, 7, 9, 11, 14, and 16. There does not seem to be
anything at these time points that are similar. This means the experiment failed and should be
repeated. However, the gene appears to be expressed in vegetative, starved, and conjugating
cells based on the appearance of bands in the RTPCR. The primers do appear to be working
correctly because bands do show up on the gel. This means that future work could use the
same primers. There was a more pronounced experimental error on time points for hours 4,
17, and 18 of conjugation.
M G V V S S
0 1 2 3 4 5 6 7
M 8 9 10 11 12 13 14 15 16 17 18
Figure 4. RT-PCR analyses. Lane 1 = DNA MW Marker. Lane 2 = CU428 genomic DNA template
(contains intron). Lanes 3,4 = CU427 and CU428 vegetative. Lanes 5,6 = CU427 and CU428
starved 24 hours. Lanes 7-25 = conjugating (0-18 hours post-mixing). RNA concentrations were
standardized using Nanodrop prior to RT-PCR.
Figure 5. Expression
data for TTHERM
00192000 in T.
thermophila. This is
the from the RTPCR
gel. Band Intensities
were determined by
ImageJ software.
Discussion: The results from the gel and the TGED data do not compare well. It seems more
likely that the TGED data for TTHERM 00192000 is closer to being true because it shows an
obvious increase in expression at a certain time in conjugation while the RTPCR data appears to
have expression at many time points of conjugation that have little or no relation in the cellular
activities. Similar experiments using RTPCR of Tetrahymena genes predicted the expression
charts from TGED. Because those experiments have reinforced TGED results, then it is likely
that this RTPCR experiment has failed and needs to be repeated.
References:
Abramoff, M.D., Magelhaes, P.J., Ram, S.J. "Image Processing with ImageJ". Biophotonics
International, volume 11, issue 7, pp. 36-42, 2004
Lodish et al. Molecular Cell Biology. 6th Edition. W.H. Freeman Publishing. 2008
Miao, et al., PLoS ONE. 2009; 4(2): e4429