Download Gene expression profiling during conjugation of the Tetrahymena

Gene expression profiling during conjugation of the Tetrahymena thermophila cyclin
TTHERM_00698650 (CYC14)
Jenny Van Kirk
Department of Biology, BIO464 Lab 2009, Bradley University
Submitted December 8, 2009
Abstract:
TTHERM_00698650, named CYC14, is a cyclin gene found in the ciliate
Tetrahymena thermophila. Cyclins are known to be heavily involved in the ciliate sexual
life cycle, conjugation, which follows a distinctive sequence including meiosis, nuclear
fissions and fusions, postzygotic divisions, and cytoplasmic determination of nuclear fate.
In order to uncover additional information regarding the function of CYC14 in
Tetrahymena, RT-PCR gene expression profiling was used to reveal its level of
expression at different periods in the life cycle of Tetrahymena, specifically during
vegetative states, starved states, and at various time points after conjugation. This data
was complemented with expression data from public databases. By incorporating
expression pattern data from this study with studies regarding the events of conjugation
in Tetrahymena, our results indicate that TTHERM_00698650 is potentially involved in
DNA synthesis and macronuclear development.
Introduction:
Tetrahymena thermophila is a ciliate commonly used in laboratory studies due to
its unique events during conjugation. The cell contains both a macronucleus and a
micronucleus, which have unique roles throughout conjugation, becoming duplicated,
differentiated, and degraded. To begin the process, two starved cells of different mating
types pair, go through meiosis, and exchange haploid nuclei. After postzygotic divisions
and other developmental events, the cell is left with one micronucleus (MIC) and one
macronucleus (MAC) (Miao et al., 2009). Much research has been devoted to this
process, and there is evidence that a cyclin, or many cyclins, is involved in the
Tetrahymena commitment to division (Asai and Forney, 2000). Cyclins function by
binding and activating cyclin-dependent kinases (CDKs) and subsequently instructing the
CDKs to phosphorylate certain cell cycle proteins to activate or inactivate them. Once
the cell has completed the necessary step(s), that cyclin is destroyed and the next cyclin is
expressed to continue directing the cell through the cell cycle. Despite the general
knowledge available regarding the functions of cyclins, the exact functions of individual
cyclins throughout the cellular division process in Tetrahymena have not yet been
determined.
With this knowledge, we performed a search of the Tetrahymena Genome
Database (TGD) for cyclins, in order to perform further studies and attempt to elucidate
their functions. CYC14 was identified as a cyclin through BLAST searches. Because of
this homology with other cyclins and cyclin associated genes, we believe that it is
involved in the cell cycle. Thus, conjugating cells were studied and analyzed to reveal
the expression pattern and function of TTHERM_00698650.
In this study, RT-PCR was used for gene expression profiling of the CYC14 gene.
TTHERM_00698650 was found to be expressed at low levels at hours 8 and 11-14 after
conjugation, and at higher levels at hours 9 and 10 of conjugation. This may suggest that
TTHERM_00698650 is important for processes that occur at these time points, such as
DNA synthesis and macronuclear development.
Materials and Methods
Cyclin genes were identified at the Tetrahymena Genome Database (Stover et al.,
2006) by searching for proteins with the keyword “cyclin”. A BLAST search with a
cyclin protein sequence ensured that all cyclin genes were identified using this method.
Microarray data during conjugation (Miao et al., 2009) were collected for each gene from
the Tetrahymena Gene Expression Database (TGED; Miao et al., 2009). PCR primers
flanking an intron were generated for each gene using Primer3 (Rozen and Skaletsky
2000) and ordered from Integrated DNA Technology (Coralville, IA). Oligo-dT-primed
M-MLV reverse transcription (RT; Ambion) was performed on RNA collected from
control cells and from cells at various stages of conjugation using the Trizol reagent
(Invitrogen) according to the manufacturer’s protocol. 1 mL of cells (2.1 x 103 cell/mL)
was collected at each time point, pelleted at 6k rpm, supernatant discarded, and cells
resuspended in 1mL of Trizol. 180 ng of each template RNA was used per reverse
transcription reaction. cDNA was diluted 1:5 and used as a template for PCR. PCR was
performed in 25 µL reactions using GOTaq (Fisher, Hampton, NH) with 1µL of each
primer (10 µM). 15µL of completed PCR reaction products were separated on a 2%
agarose gel. DNA bands were visualized using ethidium bromide and photographed with
a Kodak EDAS290 imaging system. Band intensities were determined using ImageJ
(Abramoff et al., 2004).
Results
Gene Expression Profile
The Tetrahymena Gene Expression Database provides an expression profile
TTHERM_00698650 indicating that the protein is expressed most highly at hours 0, 6,
and 11 after conjugation (Figure 1). Additionally, lower levels of expression appear to
exist during hours 10 through 13 of conjugation.
QuickTime™ and a
TIFF (Uncompressed) decompressor
are needed to see this picture.
Figure 1: Tetrahymena Gene Expression Database expression profile. For
growing cells, L-l, L-m and L-h correspond respectively to ~1105 cells/ml,
~3.5105 cells/ml and ~1106 cells/ml. For starvation, ~2105 cells/ml were collected
at 0, 3, 6, 9, 12, 15 and 24 hours（referred to as S-0, S-3, S-6, S-9, S-12, S-15 and S24). For conjugation, equal volumes of B2086 and CU428 cells were mixed, and
samples were collected at 0, 2, 4, 6, 8, 10, 12, 14, 16 and 18 hours after mixing
(referred to as C-0, C-2, C-4, C-6, C-8, C-10, C-12, C-14, C-16 and C-18) (Miao et
al., 2009).
Gel electrophoresis was performed on samples from RT-PCR with the designed
primers (Figure 2) in order to reveal the periods of the life cycle of Tetrahymena in which
the CYC14 gene is expressed.
>TTHERM_00698650(gene)
ATGGCTCAAATATTAAAGGGAAGGATGAAACTTCTGACTAAGGAAAGTTGGGAGTATAATCCGAACACTAAAGCAAATATAGAT
TTAAAAAAGGAAGCTCAACTGCGTAAAGAATCAATTAAATTTATGATGAGTTTAGGAGTTGAATCTCTCCATTTGCCTTTAAGC
ACTGTAAATATTAATAATAATAAAAATTTTACTTTGTGCAAATGAATATTGCTGAGATTTTGAAGCAATTTTTTATTTTAATTT
GTTTGATCCTTAGCATTTATTTTCATTTATTAGTTAAAAGCTTTTTTTAAATGTTTATTTTATTGATAAAGGTATAAAAGGCCA
TAGTTATTTTCTAAAGATTCTGCTAAAATGTTTCTTTCAAGAATTTTGATAGATTTTTGTATGGAACTGTTAGCATTTTATTAA
TGGCTAAGGACGATTACCATTAAAGAAGATTGGAAGATACAATAAAATCTTTTCTAATTGTAGCATAAAAAATGAGACTTTAAT
AATTCAATAAGTATGTAGATCCAAACCGCCTTGAAACCAAAGAATAATAGGAAGCTTATTTACAAAAGCTTGGTCCAAAGGCAA
TCACAATGCATCATGAAAACTTTTAAACTGCAGAAATAGAAATATTATAAATGTCAGGTAATTAATTACAAAATTTATATTAAT
TGGGTTCAAAATTTTTCAAAAAAAGATGCAAATCGAATTAAAATTTAGTTTTTTTGACATCATATAAATAGACACTTACTTGAA
TTTATTTATTTAGCTTAGTATCTATATTCAATTAATAGTTTGCTGATAAGTAGATTTATCATTTAAAATTGTAAAATTAATAGG
ATATGACTTGGTTGTTGAAGTAACTAGTAAGTACTTAGATATATTTAAAAAGAAATATAACGGCATTACAGATAAAATTGTCTT
TTAAGACTTAATCTAGCTTGCAGAAGAAAATACCAATACAATTTATATGAGTAATTTGTGTTTGTACTTCCATCCTATGATCCT
AACCATAGTTGCAATCCAAGCTGCTGCTGAAAAATTAAATTGTAATTTACCAAACATCCAAATAGAGTCTAATGAATAAAAACA
AGAAGATGATGATTTTGGCGATATTGACATCCCTGCTTAGTAAGTAGAGTGGTGGTAAATGTTTTCCAAAAGAATACAAAAAGA
AGATATAAATGACTGTATGTAATACTATCAAGATTTTATAAAACTTTTAAATTGAATGTTAATTTATTTATTTATTTACTCTGT
TGAAGAAATTGTCAATTTCTTTTTAAAAATAAATTTAAAAATTCTACTTTTTTAATCATATTTATAATTTCAAAAAACAGCATT
TATTACTGATAAAAATAAATGCAATTTAATAACTTTTGATATAAAGTTTTTATTTTACTATATTTTAAAGTAAAATAATTTATG
TTCAATAAGTAAAATTTATTTTTAATTTTCTAATTCGTATTTATTATTTCCAAAAAATCAGGATAAAAAGAAATACAATTTAAT
AAATTTTGATAAAAAGTATTCAAGATTTATTATTAATAAAAATAAATTCAATTTAATAACTTTTAATCTAAAAAATTTCATTAA
AATGATTTTGATATTTTAAAGTAAAATAGTTAATATTGAATGGATAAAATTAATTTTAATTTTCTAATAATTATTTATTATTTC
TAAAAACTATGAATATATTTTTATTGATTTAAAACCTAATATTATTACTAAAAAAAAAATATATCACACTTTAATAATAAAATA
TTACTTGATTAGAATTTTTATTAAAAATTTTAAAAGAACAAAATAAAATTATTAATTATTTTTAAATTTAAGAATAAATTTGGA
TTCTAAGTAGAAATTATAGTAAATATTTAATAACACACTATTTATTGTTTTCAAAGAAAAATAGTGTTTGAGTAATTAATAATA
GGTAATCCAGAACTACTTACTCCTGAAATGAATAAGTAGTTCAATAAAGCTTCTTTTTTATAATCATAATTATTTATTTGATTA
ATCCATTTAATCTCTTATGATGGTATTCTTTCTCATTTTTTTCTTAGTATTTATCAATCTAAACTAATTTTATTTTTGGTCATT
AAGTTTTTTTGCATATAAAGTATCATTTAAGATAATCGATATCTTACATGAGTTTTTAAAAAATTTGATTATTTTAGAATTTAG
AAGTTTAAAGTTTATATTAATTTATTGATTAATTATTCAATTGATTGATTGAGATAGAGAATCAAATTAATTGATATTTTTAGA
AAAGAAGAATATTATTTGATTTTTAATTAATATTTTTGTAGAAATATGGATAAAGAGTAGCAGCAGAATTATTTGTAAAATCAT
TAACAAGGAAGTAATTAGATGAATTAACAACAATAGGCTGCTTAAGGATAGATGACTGGAGGGATGTGGCTTTTAACAAAGGAA
GATTGGGTGCTCATTAGGCCAGATAAAAGCAAGAAACAGTCAATAGAAGATGTGAAACAAGCAAATTCAGTAGCAAAATTTATA
AAAATGTTTGCAGAGGAATTCGAGTATTATTTCAGCGATATGTTGAAGCTAGGGACACAA
Figure 2: TTHERM_00698650 gene sequence. The introns are highlighted in red
and the primers designed and used in PCR are highlighted in yellow. Note that the
size of the expected PCR product is 355 base pairs.
By correlating the levels of expression with the processes occurring in conjugation at
specific time points, the processes in which the protein is involved can be ascertained.
The gel provides a qualitative display of our results. It appears that expression of
TTHERM_00698650 begins at hour 8 after conjugation and continues to be expressed
through hour 14 after conjugation (Figure 3). The highest levels of expression occur at
hours 9 and 10. Primers used for RT-PCR amplification were expected to yield a product
of 355 bp of DNA, which is confirmed by the results of the gel. In comparing the 500 bp
band of genomic DNA with the 1 kb DNA ladder, we find that this is approximately the
size of the PCR product.
M G v7 v8 s7 s8 0 1 2 3 4 5 6 7
M 8 9 10 11 12 13 14 15 16 17 18
Figure 3 – Gel electrophoresis of cDNA (RT-PCR product) at all hours of
conjugation and different time points in the Tetrahymena life cycle. RT-PCR with
designed primers (Figure 2) indicated that TTHERM_00698650 is transcribed
during hours 8-14 after conjugation. It seems to be transcribed at the highest levels
8 and 9 hours after conjugation. v, vegetatively growing; s, starved; numbers
indicate hours into conjugation. V and S with subscripts indicate the different
strains used, 427 and 428, respectively. Lanes labeled M are DNA markers, for
which a Fisher full scale 1 KB ladder was used. Band size is 500 bp from the
genomic template, G (gDNA), and 355 bp from cDNA .
The intensity of the bands in the gel quantifies the levels of expression. The more
mRNA present at a given time point, the more cDNA that will be produced and amplified
in RT-PCR. Results indicate that TTHERM_00698650 is not expressed until eight hours
after conjugation. At eight hours post-conjugation, TTHERM_00698650 is expressed at
low levels, and it is subsequently expressed at higher levels during hours nine and ten, as
indicated by the large areas displayed in the intensity graph (Figure 4). Low levels of
expression continue through hour fourteen post-conjugation, at which point
TTHERM_00698650 expression is stopped.
1200
Arbitrary Units of Intensity
1000
800
600
400
200
0
427V428V427S 428S C0
C1
C2
C3
C4
C5
C6
C7
C8
C9 C10 C11 C12 C13 C14 C15 C16 C17 C18
RNA Collection Time Points
Figure 4: Intensity graph of bands in agarose gel (Figure 3). The arbitrary units
indicate the intensity of the respective band on the electrophoresis gel. X-axis values
C8-C14, corresponding to hours 8 through 14 after conjugation show the highest
band intensities, indicating high levels of protein expression during those time
points of the Tetrahymena life cycle.
Discussion
By considering what is occurring in the cells during hours eight through fourteen
post-conjugation, it is possible to identify possible processes in which the product of the
CYC14 gene is involved. The Tetrahymena Gene Expression Database shows an
expression pattern for TTHERM_00698650 in which the highest levels of expression are
during hours 0, 6, and 11 of conjugation. This seems to suggest that
TTHERM_00698650 has a role in DNA synthesis. At hour 0 of conjugation, the cell is
just beginning S phase. Thus, DNA replication is necessary at this time, and is necessary
again at 6 hours after mixing, as the cell has to begin mitosis once more. A role in DNA
replication is supported by the BLAST results that this cyclin may be a cyclin H subunit,
as cyclin H is annotated as being involved in cell division, chromosome partitioning, and
DNA replication.
After running RT-PCR of the gene and analyzing the results on an agarose gel,
different results were obtained. This experiment provided data that suggested the cyclin
portion of the gene is only expressed between hours 8 and 14 of conjugation. At C-8,
eight hours after mixing, macronuclear development is continuing in the cell. From
hours 10 to 14, the loss of the old macronucleus and one micronucleus occurs. This data
supports a theory that TTHERM_00698650 is involved in stopping the amplification of
the new macronucleus and signaling the cell to proceed with the destruction of the old
macronucleus. This would be the function of the cyclin portion of the gene. Perhaps the
other part of the gene encodes a protein that is coincidentally active during hours 0 and 6
of conjugation, but has no specific role in conjugation.
Despite the two possible functions suggested by the TGED and RT-PCR results,
the homologs discovered as the result of a BLAST search suggest a third, different
function. CYC14 is a homolog of Cyclin K in many organisms, such as
Strongylocentrotus purpuratus and Aedes aegypti. Cyclin K and cyclin H are both
involved in the regulation of RNA polymerase II. Thus, TTHERM_00698650 could have
a role in transcriptional regulation. Additionally, cyclin K has a proposed role of
integrating cell growth with cell cycle progression in metazoans. Therefore, it would be
reasonable to consider this a possible role for TTHERM_00698650 as well.
The combination of the three pieces of evidence detailed above leads to a
reasonable putative function of the gene: the cyclin turns on to allow RNA polymerase
into the developing macronucleus. Localization of the protein is the next step in this
experiment. Data from this project will be utilized to update TGC annotations, and will
also be submitted to the Ciliate Genomics Consortium website at the Claremont colleges.
References
Abramoff, M.D., Magelhaes, P.J., Ram, S.J. "Image Processing with ImageJ".
Biophotonics International, volume 11, issue 7, pp. 36-42, 2004.
Asai, D.J. and Forney, J.D. 2000. Methods in Cell Biology. Volume 62: 78-79.
Miao, W., Xiong, J., Bowen, J., Wang, W., Liu, Y., Braguinets, O., Grigull, J., Pearlman,
R.E., Orias, E., Gorovsky, M.A. 2009. Microarray analyses of gene expression
during the Tetrahymena thermophila life cycle. PLoS ONE 4(2):e4429.
Rozen, S. and Skaletsky, H.J. .2000. Primer3 on the WWW for general users and for
biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods
and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp
365-386.
Stover, N.A., Krieger, C.J., Binkley, G., Dong, Q., Fisk, D.G., et al. Tetrahymena
Genome Database (TGD): a new genomic resource for Tetrahymena research.
Nucleic Acids Res. 2006; 34:D500-503.