Download Tricia Windgassen 12/8/09 BIO464 Lab 2009 Bradley University

Tricia Windgassen
12/8/09
BIO464 Lab 2009 Bradley University
Tetrahymena thermophilia cyclin gene, TTHERM_00780580, expression during conjugation
Abstract:
Many different cyclins respond to and control the movement of the cell through the
different phases of the cell cycle. This study looked at the expression of the Tetrahymena
thermophilia cyclin gene, TTHERM_00780580, during conjugation, the ciliate sexual cycle, to
determine if this cyclin, and cyclins in general, are involved in the regulation of conjugation
steps. This study named this cyclin gene CYC16. Observing when this cyclin is expressed may
lead to hypotheses about what specific event this cyclin regulates. Reverse Transcription PCR
(RT PCR) was run on mRNA extracted from Tetrahymena thermophilia cells that were in each
hour of the 18 hour conjugation. An expression profile of the cyclin gene during conjugation
was constructed using the RT PCR gel electrophoresis results. Expression increased and
decreased many times during conjugation but the largest peak was at conjugation hour 5,
suggesting that this cyclin may be involved in selecting the 1 haploid nucleus (of 4 pronuclei
from meiosis) that is exchanged with another cell before fertilization. This study’s conjugation
cyclin gene expression profile did not closely agree with the Tetrahymena Gene Expression
Database’s (TGED) expression profile for this cyclin, which peaked significantly at conjugation
hour 0.
1
Introduction:
Cyclins are proteins that regulate the activity of cyclin-dependent kinases (CDKs), which
control the events of cell cycle phases and movement into the next phases. Cyclins bind to the
free, inactive CDKs, activating the CDKs (Zhang et al. 1999). These active CDKs can then
phosphorylate proteins that control events of the cell cycle such as DNA replication,
chromosome condensation, spindle formation, and cytokinesis. For each part of the cell cycle,
specific cyclins promote the events of that phase of the cell cycle and keep the cell in that phase.
A cyclin builds up in the cell, pushing the cell into that cyclin’s phase of the cell cycle by
activating CDKs that promote the events of that phase. When that phase is complete, the cyclin
disappears and the next cyclin is expressed, moving the cell into the next stage of the cell cycle.
A search on the Tetrahymena Gene Expression Database (TGED) found the Tetrahymena
thermophilia gene, CYC16 (TTHERM_00780580), to be a cyclin. As a cyclin, this gene is likely
involved in a part of the cell cycle.
Tetrahymena thermophilia are free-living freshwater ciliate protozoans that have two
nuclei, the macronucleus and the micronucleus. The micronucleus is diploid, divides mitotically,
and is transcriptionally silent. The macronucleus is polyploidy and its genome is expressed
during vegetative growth, determining the cell’s phenotype. The macronucleus divides
amitotically by randomly separating the chromosomes into the daughter nuclei (Miao et al.
2009). Two Tetrahymena thermophilia cell types of the seven mating types will undergo
conjugation if they are mixed together after being stressed, such as being starved. Conjugation
in Tetrahymena involves a series of meiotic and mitotic nuclear divisions, exchange of haploid
nuclei between two cells, nuclear fusions, DNA elimination, DNA amplification, nuclear
2
destructions, and nuclear development. Miao et al. showed the steps of conjugation in their
paper (figure 1).
Figure 1. Conjugation steps in Tetrahymena (Miao et al. 2009).
As a cyclin, the Tetrahymena thermophilia gene, TTHERM_00780580, should be
involved in the cell cycle. The expression profile for this gene at TGED showed that this gene
was expressed during vegetative growth, starvation, and conjugation in Tetrahymena
(http://tged.ihb.ac.cn). This study observed when TTHERM_00780580 was expressed during
conjugation in Tetrahymena thermophilia to determine possible events this cyclin controls.
3
Methods:
The cyclin gene was identified at the Tetrahymena Genome Database (www.ciliate.org)
by searching for proteins with the keyword “cyclin”. A BLAST search with a cyclin protein
sequence ensured that all cyclin genes were identified using this method. Microarray data during
conjugation (Miao et al. 2009) were collected for the gene from the Tetrahymena Gene
Expression Database (TGED; http://tged.ihb.ac.cn). PCR primers were generated for the gene
using Primer3 (Steve Rozen and Helen J. Skaletsky 2000) and ordered from Integrated DNA
Technology (Coralville, IA). Oligo-dT-primed M-MLV reverse transcription (RT; Ambion) was
performed on RNA collected from control cells and from cells at various stages of conjugation
using the Trizol reagent (Invitrogen) according to the manufacturer’s protocol. 1 mL of cells
(2.1 x 103 cells/mL) was collected at each time point, pelleted at 6k rpm, supernatant discarded,
and cells resuspended in 1 mL of Trizol. 180 ng of template RNA was used per reverse
transcription reaction. cDNA was diluted 1:5 and used as a template for PCR. PCR was
performed in 25 uL reactions using GOTaq (Fisher, Hampton, NH) with 1 uL of each primer (10
uM). 15 uL of completed PCR reaction products were separated on a 2% agarose gel. DNA
bands were visualized using ethidium bromide and photographed with a Kodak EDAS290
imaging system. Band intensities were determined using ImageJ (Abramoff et al. 2004).
Results:
The Tetrahymena Genome Database provided the TTHERM_00780580 genetic sequence
in Figure 2. Because this gene does not contain introns, the sequence in figure 2 is the genetic
sequence and the coding sequence. This sequence was used to make the primers (in yellow) for
reverse transcription PCR (RT PCR).
4
>TTHERM_00780580(gene)
ATGCAAAAAGCTCCATAATAGCAAAAGTTTAGTACTTCAAATACTTTGTTTATCCGT
CATACGATTTCATCTCCAAATGTGAAATCTATTATTTAGGCAGTAGCTACTATTCTTC
ACTCTTAAATGCACGAAGATTTCTAATCAGGAAAAGAAGTTCCTAAAGGTTCTGACC
TTCATTTCTTCTCTGAAGAAAAATATATTGAAGAAAAACCAGAAGAGTTCGATGAAG
CTCGTCGTGCCTTGCTTCGTGAAACTCCATCTGTAGATAACATTTATGAATTTATGAA
AGCTCTTTATGAATGTGCCAAATTCTCTCCTGAATGCTGCATTATCTGTTTAGTTTAC
ATTAATAGATTGATTGCATTCACAGGTTTGCCTCTTTATCCAACAAACTGGCGTCCTC
TTATCCTTTGCTCTTTATTAGTAGCACAAAAAGTATGGGATGACAAGTACTTATCAA
ATGCTGACTTTGCTTTCATCTATCCTTTCTTCGTTACTGAAGAAATCAATGCTTTAGA
ACAAAAGTTCCTTGAATTACTCTAATACAATGTCACTGTAAAAAGTGCTCTTTATGC
TAAATACTACTTTGAATTAAGAGCCCTCTTTAAAAACGAATCTGAATTCCCCTTAAC
CCCTCTTGATGTTGATCAAGAAAAGGAACTCGAATCAAGATCTTAATAAATGTAAAA
CAAAGAAAAAGAAAAAGCATAAAAGAATTCTCTCACTTATAACGAGAAGCAAACCA
AAAGACCTAATGCCTCTCTTAATGTATGA
Figure 2. TTHERM_00780580 genomic DNA sequence from Tetrahymena Genome Database,
with primer regions highlighted in yellow. This gene has no introns. (www.ciliate.org)
The Tetrahymena Gene Expression Database’s (TGED) expression profile for
TTHERM_00780580 (figure 3) showed expression during vegetative growth, starvation, and
conjugation. Expression of this cyclin peaked at its highest point at conjugation hour 0 (C0) and
immediately decreased until C3. From C3 to C18 expression increased with slight humps at C6
and C10.
5
Figure 3. Microarray expression profile for TTHERM_00780580 from TGED, where L=
vegetative log phase growth. S= hours under starved conditions. C= conjugation hours after
mixing equal volumes of B2086 and CU428 cells (http://tged.ihb.ac.cn).
Gel Electrophoresis of the RT PCR products (figure 4), showed expression of
TTHERM_00780580 increased and decreased many times over the 18 hours of conjugation.
This gene was expressed at all the time points except for conjugation hour 4 (C4), due to
experimental error. The brightest band during conjugation is at C5, with increases in decreased
in brightness throughout the conjugation hours.
Fig. 4. RTPCR gel electrophoresis of TTHERM_00780580. Well 1: Fisher Full Scale 1kb DNA
ladder. Well 2: RTPCR product of CU428 genomic DNA template containing introns. Well 3,4:
RTPCR product from CU427 and CU428 in vegetative growth hours. Well 5,6: RTPCR product
from CU427 and CU428 starved hours. Well 7-14: RTPCR product from Tetrahymena in
conjugation hours 0-7. Well 15: Fisher Full Scale 1kb DNA ladder. Well 16-26: RTPCR product
from Tetrahymena in conjugation hours 8-18.
6
The expression profile for TTHERM_00780580 (figure 5), constructed from the
intensities of the bands in the RTPCR electrophoresis gel, showed many increases and decreases
in expression. After a small peak at C0, expression increased sharply from C1 to the highest
point at C5 and decreased sharply from C5 to C8 with a hump at C7. Expression increased at
C9-C11 and C15.
fig. 5. Expression profile for TTHERM_00780580. Intensities of the bands in the gel
electrophoresis for the two vegatative growth hours (V), two starvation hours (S), and
conjugation hours (C0-C18, excluding C4).
Discussion:
Reverse Transcriptase PCR from RNA extracted from Tetrahymena thermophila cells
over 18 hours of conjugation showed that expression of CYC16 (TTHERM_00780580) increased
7
and decreased multiple times but the greatest amount of expression occurs at C5. Expression of
the cyclin increases from C1 up to its highest peak at C5 and decreases after from C5 to C8. At
C5 in Tetrahymena conjugation, 1 of the 4 meiotic products is selected to later undergo haploid
mitosis and exchange nuclei with another cell. This cyclin may activate cyclin-dependent
kinases that activate the association of microtubules with 1 pronucleus and the movement of the
pronuclei, allowing for the selection of this fourth pronucleus from the other 3 nuclei. The fourth
nucleus is position selected for from the other nuclei by association through microtubules with
the conjugal transfer junction (Gaertig and Fleury 1992). This network of microtubules at the
transfer junction later enables the exchange of pronuclei between mating cells at conjugation
hour 5.75, when this cyclin is still highly expressed. This cyclin may be involved in activating
the binding of kinesin and dynein (motor protein that move along microtubules) to the
pronucleus and signaling these motor proteins to transport the pronucleus to the conjugal transfer
junction. If Cyc16p (the TTHERM_00780580 protein) is involved in signaling microtubular
motor protein binding and movement or microtubular polymerization, then this may explain the
continued expression of this cyclin during vegetative growth, starved, and conjugational
conditions. This would explain this continued expression because microtubular polymerization
and motor protein movement occur often in the cell and in many phases of the cell cycle. The 3
haploid nuclei that are not selected for exchange are degraded around C5 also. Santos et al.
(2000) found that the 3 haploid nuclei may be degraded by a mechanism similar to the one that
degrades the macronucleus. Thus, TTHERM_00780580 cyclin may not be involved in the
programmed degradation of the 3 haploid nuclei since there is not a peak in expression later,
during degradation of the macronucleus, similar to the peak at C5. The decrease in the cyclin
after C5 may allow the selected nuclei to proceed into haploid mitosis.
8
This study’s conjugation cyclin gene expression profile did not agree with the
Tetrahymena Gene Expression Database’s (TGED) expression profile for TTHERM_00780580.
TGED’s expression profile for this cyclin showed the largest peak at C0, sharp decrease to the
lowest points from C2 to C4, and a slow increase in expression until C18 with increased
expression bumps at C6 and C10 (http://tged.ihb.ac.cn). Expression at C0 may be due to the
cyclin helping prepare the cell for mating and cell pairing. Decreasing expression after C0
would allow the cell to proceed through meiosis. The small increase at C6 may correspond to
this study’s peak at C5, since expression profiles for other cyclins, acquired by the same method
as this study, appeared to be an hour off from TGED’s expression profiles for those cyclins. In
this study, a small increase in expression occurred at C0 but the largest amount of expression
was not at C0, as it was in the TGED microarray profile.
By determining when cyclins are expressed, we get closer to comprehending what cyclins
control. This helps us better understand how the cell cycle is controlled and this may lead to
ways we could control the cell cycle. Research on cyclins may lead to possible treatments for
cancer cells (cells that progress through the cell cycle unregulated). Overexpression of Cyclin D
was found in a type of breast cancer, Ductal carcinoma in situ, leading to research on decreasing
cyclin expression in order to help prevent proliferation of tumor cells (Steeg and Zhou 1998).
9
References:
Abramoff, M.D., Magelhaes, P.J., Ram, S.J. (2004). Image Processing with ImageJ.
Biophotonics International. 11 (7): 36-42.
Gaertig, J. and A. Fleury. (1992). Spatiotemporal reorganization of intracytoplasmic
microtubules is associated with nuclear selection and differentiation during
developmental process in the ciliate Tetrahymena thermophila. Protoplasma. 167:74–87.
Miao, W., Xiong, J., Bowen, J, Wang, W., Liu, Y., Braguinets, O., Grigull, J., Pearlman, R.E.,
Orias, E., Gorovsky, M.A. (2009). Microarray Analyses of Gene Expression during the
Tetrahymena thermophila Life Cycle. PLoS ONE. 4(2)
Santos, M.L., Lu, E., Wolfe, J. (2000). Nuclear Death in living Tetrahymena: The case of the
haploid nuclei. The Journal of Eukaryotic Microbiology. 47 (5): 493-498.
Steeg, P.S. and Zhou, Q. (1998). Cyclins and Breast Cancer. Breast Cancer Research and
Treatment. 52: 17-28.
Tetrahymena Gene Expression Database (TGED). <http://tged.ihb.ac.cn> (Accessed 11/20/09).
Tetrahymena Genome Database. <www.ciliate.org> (Accessed 11/20/09).
Zhang, H., Adl, S.M., Berger, J.D. (1999). Two Distinct Classes of Mitotic Cyclin Homologues,
Cyc1 and Cyc2, Are Involved in Cell Cycle Regulation in the Ciliate Paramecium
tetraurelia. Journal Eukaryote Microbiology. 46 (6): 585-596.
10