Download Cell Death Suppressor, Arabidopsis BI

Plant Physiology Preview. Published on December 1, 2006, as DOI:10.1104/pp.106.090878
Running head: BI-1 associated with ion homeostasis
5
Correspondence;
Dr. Maki Kawai-Yamada
Institute of Molecular and Cellular Biosciences
The University of Tokyo
10
1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, Japan
Tel & Fax: +81-3-5841-8466
E-mail: [email protected]
15
Research area: Cell Biology
1
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Copyright 2006 by the American Society of Plant Biologists
Title:
Cell death suppressor, Arabidopsis BI-1, is associated with calmodulin-binding and ion
homeostasis
20
Yuri Ihara-Ohori1, Minoru Nagano1, Shoshi Muto2, Hirofumi Uchimiya1,
Kawai-Yamada1, 4 *
25
1
Institute of Molecular and Cellular Biosciences, The University of Tokyo,
1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, Japan (Y.I-O., H.U., M.K-Y)
2
Nagoya University Bioscience Center, Nagoya University, Chikusa,
Nagoya 464-8601, Japan (S.M.)
30
3
Iwate Biotechnology Research Center, Kitakami, Iwate 024-0003, Japan (H.U)
4
Japan Science and Technology Agency (JST), CREST, 4-1-8 Honcho,
Kawaguchi, Saitama 332-0012, Japan (M.K-Y)
This paper is dedicated to the memory of the late Prof. Muto.
35
2
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
3
and Maki
Financial source:
This work was supported by a Grant-in-Aid for Scientific Research on Priority Arias (Grant No.
40
17051006) from the Ministry of Education, Culture, Sports, Science and Technology of Japan,
a grant from the Ministry of Agriculture, Forestry, and Fisheries of Japan, and from CREST,
JST (to M.K-Y).
45
Corresponding author
Dr. Maki Kawai-Yamada
Institute of Molecular and Cellular Biosciences
50
The University of Tokyo,
1-1-1 Yayoi, Bunkyo-ku, Tokyo 113-0032, Japan
Tel & Fax: +81-3-5841-8466
E-mail: [email protected]
55
3
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
ABSTRACT
Cell death suppressor Bax inhibitor-1 (BI-1), an endoplasmic reticulum (ER) membrane
protein, exists in a wide range of organisms. The split-ubiquitin system, overlay assay and the
bimolecular fluorescence complementation (BiFC) analysis demonstrated that Arabidopsis
60
BI-1 (AtBI-1) interacted with calmodulin (CaM) in yeast and in plant cells. Furthermore,
AtBI-1 failed to rescue yeast mutants lacking Ca2+-ATPase (Pmr1 or Spf1) from Bax-induced
cell death. Pmr1 and Spf1, p-type ATPases localized at inner membrane, are believed to be
involved in transmembrane movement of calcium ion in yeast. Thus, the presence of intact
Ca2+-ATPases was essential for AtBI-1-mediated cell death suppression in yeast. To
65
investigate the effect of AtBI-1 on calcium homeostasis, we evaluated sensitivity against
cyclopiazonic acid (CPA), an inhibitor of SERCA-type Ca2+ ATPases, in AtBI-1
overexpressing or knock-down transgenic Arabidopsis plants. These plants demonstrated
altered CPA or ion stress sensitivities. Furthermore, AtBI-1 overexpressing cells demonstrated
attenuated rise in cytosolic calcium following CPA- or H2O2- treatment, suggesting that AtBI-1
70
affects ion homeostasis in plant cell death regulation.
4
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
INTRODUCTION
In higher plants, programmed cell death (PCD) plays a vital role in proper biogenesis and
morphogenesis, similar to apoptosis in animal cells where some biotic or abiotic stimuli trigger
75
the death pathway resulting in mitochondrial dysfunction, generation of reactive oxygen
species (ROS) and activation of specific proteases. In apoptosis, Bax, a proapoptotic member
of the Bcl-2 family proteins, is activated by certain apoptotic stimuli, and then translocates into
the mitochondrial membrane, causing mitochondrial dysfunction (Wei et al., 2001). Some
features of plant PCD, including hypersensitive reaction (HR), resemble the apoptotic process.
80
Thus in plant PCD: (i) caspase-like protease activity is observed during tobacco-mosaic virus
(TMV)-induced HR (Chichkova et al., 2004), (ii) vacuolar processing enzyme (VPE) has
caspase-1 activity and mediates TMV-induced HR in tobacco (Hatsugai et al., 2004;
Hara-Nishimura et al., 2005). In addition, mammalian Bax is capable of inducing cell death in
yeast (Zha et al., 1996) and also plant cells (Lacomme and Cruz, 1999). Such evidences suggest
85
the existence of a common mechanism for animal and plant cell death pathways.
In animal cells, intracellular calcium level plays an important role in death pathways
triggered by apoptotic stimuli. Several studies suggested that the amount of calcium ion stored
in ER determines the sensitivity of the cells to apoptotic stress (Pinton et al., 2001; Scorrano et
al., 2003). It was also suggested that translocation of calcium ions from the ER to the
90
mitochondrion may be required to induce cell death by some apoptotic signals; alteration of
calcium level in ER could signal apoptotic cell death (Scorrano et al, 2003). On the other hand,
over-expression of Bcl-2 reduces ER calcium level (Foyouzi-Youssefi et al., 2000), suggesting
that the effect of anti-apoptotic proteins on the apoptosis may be mediated by regulation of
calcium flux.
95
Bax inhibitor-1 (BI-1) was first identified as a suppressor of Bax-induced cell death on
screening of human cDNA library in yeast cells (Xu and Reed, 1998). Although no homolog of
5
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
the Bcl-2 family proteins have been identified in plants and yeast, BI-1 is widely conserved in
organisms including Caenorhabditis elegans and Xenopus laevis (Hückelhoven 2004).
Overexpression of Arabidopsis BI-1 (AtBI-1) suppresses Bax-induced cell death in
100
Arabidopsis and yeast (Kawai et al., 1999; Sanchez et al., 2000; Kawai-Yamada et al., 2001;
Kawai-Yamada et al., 2004). Bax expression in plant cells causes ROS generation, organelle
disruption and ion leakage from cells (Baek et al., 2004; Yoshinaga et al., 2005). AtBI-1
prevents ion leakage but not ROS generation when overexpressed together with Bax in
Arabidopsis (Kawai-Yamada et al., 2004). In addition, H2O2-, SA-, elicitor-, heat- and
105
cold-induced cell death were suppressed in plant cells overexpressing AtBI-1 (Matsumura et
al., 2003; Chae et al., 2003; Kawai-Yamada et al., 2004). Moreover, tobacco BY-2 cells
became sensitive to sucrose starvation after overexpression of antisense BI-1 (Bolduc and
Brisson, 2002, Bolduc et al., 2003). It was recently reported that cells from BI-1-deficient mice
showed hypersensitivity toward agents that induce endoplasmic reticulum (ER) stress, such as
110
tunicamycin or thapsigargin (Chae et al., 2004). However, the mechanism of BI-1-mediated
suppression of cell death is still unclear.
The barley Mlo protein, a plant-specific plasma membrane protein, is known as a
modulator of cellular defense and cell death (Piffanelli et al., 2002). Recently, it was shown
that overexpression of barley BI-1 in mlo5 resistant cultivar restored Mlo function in
115
penetration by Blumeria graminis (Hückelhoven et al., 2003), suggesting that AtBI-1 and Mlo
may possess similar functions in cellular defense and cell death modulation. Moreover, it was
demonstrated that the barley Mlo protein binds to calmodulin (HvCaM3) and the interaction is
related to the control of its function (Kim et al., 2002). Calmodulins facilitate Ca2+ -dependent
responses through binding to their target proteins and modulate their activities. We were
120
inspired by these facts to study the interaction of BI-1 and calmodulin. Here we show that
6
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
AtBI-1 can also interact with calmodulin and the cell death suppression activities of AtBI-1 in
plant cells are mediated, at least in part, by modulation of ion homeostasis.
Results
125
AtBI-1 interacts with calmodulin
Overexpression of barley BI-1 in resistant mlo5 barley plant results in almost completely
reconstitution of susceptibility to penetration by Blumeria graminis (Hückelhoven et al., 2003),
suggesting that BI-1 and Mlo, CaM -binding protein, possess similar functions in plant defense
130
system. Thus, we tried to evaluate the interaction between CaM and BI-1 proteins. The plasmid
possessing barley calmodulin 3 protein (HvCaM3) was kindly provided by Dr. Ralph
Panstruga (Max-Planck Institute). The yeast split-ubiquitin system demonstrated that AtBI-1
interacted with HvCaM3 (Figure 1). As reported previously, AtBI-29, 30 and 32 are C-terminal
mutants of AtBI-1 (Kawai-Yamada et al., 2004). Although the AtBI-29 and 32 mutants
135
maintained inhibitory function toward Bax-induced cell death in yeast, the AtBI-30 lacked the
C-terminal coiled-coil structure and such function (Kawai-Yamada et al 2004) (Figure 1A). As
shown in Figure 1B, AtBI-29 and 32 maintained the interaction with HvCaM3, while AtBI-30
did not. These results suggest the possibility that such interaction may be necessary for the
suppressive action of AtBI-1 on Bax-induced cell death.
140
To further investigate the interaction between AtBI-1 and Arabidopsis calmodulin, in
vitro overlay assay was performed. HvCaM3 is almost identical to Arabidopsis CaM7
(AtCaM7; Zielinski, 2002) with only one amino acid substitution (A11
→S
11).
S- and His-
tagged AtCaM7 expressed in Escherichia coli was purified by Ni-NTA resin. MBP-tagged
C-terminal 14 amino acids of AtBI-1 (BI-C) or β-galactosidase (control; gal) purified by
145
amylose resin were used for the overlay assay. As shown Figure 2, purified BI-C and gal
7
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
proteins were immunoblotted with anti-MBP antibody. The membrane was re-probed with
recombinant AtCaM7 protein in the presence of 1 mM CaCl2 or 5 mM ethylene glycol bis
(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA). The AtCaM7 bound to the BI-C,
although this protein did not bind to the gal protein (control). EGTA inhibited such binding,
150
confirming the importance of calcium in the calmodulin-mediated binding.
To verify AtBI-1/CaM binding in planta, BiFC assay was performed in
Agrobacterium-infiltrated tobacco (Nicotiana benthamiana) leaves. As previously reported,
the GFP-tagged AtBI-1 protein (AtBI-GFP) localized to the perinuclear region, which is an
indicative of ER localization, in tobacco epidermal cells (Figure 3F). When the AtBI-1-fused to
155
the N-terminal YFP fragment and AtCaM7-fused with C-terminal YFP were coexpressed in
tobacco leaves, a strong BiFC signal was detected in the epidermal cells (Figure 3A, C, and E),
confirming the interaction of AtBI-1 and AtCaM7 in planta. Control experiments in which
pSPYNE-AtBI-1 and un-fused pSPYCE were coexpressed, did not show any fluorescence
(Figure 3B and D).
160
Involvement of calcium pump in BI-1 function
An increase in cytosolic Ca2+ has been implicated in the signal transduction pathway that
mediates apoptosis (Pinton et al., 2001). It is possible that members of Bcl-2 family affect the
apoptotic process by modulating ion fluxes in the cell (Lam et al., 1994). Based on the above
165
background, we then investigated the role of proteins involved in calcium transport on the
inhibitory function of AtBI-1 against Bax-induced cell death in yeast. As shown in Table 1, we
employed several mutants deficient in calcium homeostasis-related proteins. Mid1, Yvc1 and
Cch1 are Ca2+-channels located in ER and plasma membrane (PM), vacuole, and PM,
respectively (Bertl and Slayman 1990; Locke et al., 2000; Yoshimura et al., 2004). Spf1, Pmc1
170
and Pmr1 are Ca2+-ATPases localized in endomembranes (Cunningham and Fink 1994; Antebi
8
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
and Fink 1992; Cronin et al., 2002). Vcx1 is a vacuolar H+/Ca2+ antipoter, and Ccc1 localized
on vacuole is involved in iron, manganese and Ca2+-homeostasis in yeast (Cunninghan and
Fink 1994; Lapinskas et al., 1996). To evaluate the anti-apoptotic function of AtBI-1, wild type
(WT) yeast line and mutants possessing Yep51-Bax plasmid were transformed with
175
pYX112-AtBI, which were then subjected to spot assay. The growth curve of these yeast
strains expressing AtBI-1 were almost same, and sensitivities of these yeast strains against
Bax-induced cell death were also similar (data not shown). As shown in Figure 4A and B, WT
and most mutants expressing both Bax and AtBI-1 grew on galactose containing medium.
However, ∆pmr1 and ∆spf1 cells failed to grow by the expression of Bax even when AtBI-1
180
was overexpressed. RT-PCR demonstrated that deficiency in Pmr1 and Spf1 did not affect the
AtBI-1 expression (Figure 4C). Furthermore, microscopic analysis using green fluorescent
protein (GFP)-tagged AtBI-1 protein confirmed the perinuclear localization of AtBI-1 in
∆pmr1 and ∆spf1 cells as well as in WT cells (Figure 4D). We demonstrated previously that
AtBI-GFP fusion protein has cell death suppressing activity similar to AtBI-1 (Kawai-Yamada
185
et al., 2001). Pmr1 is a Ca2+-ATPase with sequence similarity to animal SERCA
(sarco/endoplasmic reticulum Ca2+-ATPase) and is located in the membranes of Golgi body
(Antebi and Fink, 1992). It is suggested that Pmr1 is involved in the regulation of calcium
concentration in ER (Strayle et al., 1999). On the other hand, Spf1 is a homologue of SERCA
localized at ER. Both Ca2+-ATPases are believed to be involved in transmembrane movement
190
of ions, calcium and manganese (Rudolph et al., 1989; Cronin et al., 2002). Other mutants
deficient in calcium transport in plasma membrane and vacuole did not influence the
anti-apoptotic function of AtBI-1 (Figure 4A).
9
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Enhanced resistance of AtBI-1 overexpressing plants to CPA
195
Pmr1 and Spf1 are members of SERCA family and plant homologs have also been identified
(Geisler et al., 2000). To understand the relationship between intracellular calcium
homeostasis and BI-1 in plant cells, we evaluated the effect of cyclopiazonic acid (CPA), a
specific inhibitor of SERCA, using transgenic Arabidopsis plants with AtBI-1 overexpression
or knock-down (Figure 5A). RT-PCR analysis demonstrated that AtBI-1 was overexpressed in
200
OX lines (OX1 and OX2) and reduced in knock-down lines (KD1 and KD2) (Figure 5B). To
evaluate the CPA sensitivity, each plant line was grown on the 0.5 x MS-medium with or
without 5 µM CPA. Although these transgenic plants showed no obvious phenotype under
general growing conditions, a slight growth retardation were observed in control and KD lines
on CPA-containing medium (data not shown). To examine the effect of CPA on leaves, we
205
measured chlorophyll contents using 3-5th leaves of 3 week-old plants (Figure 5C). Although
the chlorophyll contents measured in untreated plants were similar in all lines, KD and control
lines (WT and GFP) demonstrated reduced chlorophyll contents on the CPA containing
medium. In contrast, OX lines showed elevated chlorophyll contents with unknown
mechanism, suggesting that overexpression of AtBI-1 overcame the effect of SERCA
210
inhibition by CPA. We also investigated the effects of thapsigargin (TG), which is also a
well-known SERCA inhibitor in animals. However, no obvious phenotype was evident in TGtreated plants (20 µM) (data not shown). In fact, ECA1, an Arabidopsis homologue of SERCA,
is CPA-sensitive but TG-insensitive (Liang and Sze, 1998).
To gain more insight into the function of AtBI-1, we investigated ion stress sensitivities
215
of AtBI-1 transgenic plants. It is reported that Arabidopsis ECA1, an ER-localized
SERCA-type Ca2+-pump, plays a role in both Ca2+ and Mn2+ homeostasis, and is required to
support plant growth under conditions of Ca2+ deficiency or Mn2+ toxicity (Wu et al., 2002). To
evaluate the ion stress sensitivity in plants with altered AtBI-1 expression, AtBI-1 transgenic
10
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
plants were grown on Ca2+-deficient or Mn2+-rich (0.5 mM) plate. When plants were grown on
220
such plates for 3 weeks, KD lines showed severe growth defect and less chlorophyll contents
(Figure 6). In contrast, OX plants had elevated chlorophyll contents and less growth retardation
on both ion stress conditions, suggesting AtBI-1 affects ion homeostasis in plant cells.
Measurement of [Ca2+]cyt in AtBI-1 overexpressing plant cells
225
Alterations in cytosolic Ca2+ ([Ca2+]cyt) have been implicated in apoptosis control mechanisms.
The anti-apoptotic protein Bcl2 reduces Ca2+ efflux through the ER membrane (Lam et al.,
1994). A rapid increase in [Ca2+]cyt is a common response to pathogen challenge in plant cells
(Blume et al., 2000) and oxidative stress (Rentel and Knight 2004). We therefore explored the
effects of BI-1 overexpression on Ca2+ homeostasis. To investigate the role of AtBI-1 on the
230
calcium flux in plant cells, transgenic tobacco BY-2 cells were examined using
calcium-sensitive luminescent protein aequorin. In our previous work, BY-2 cells
overexpressing AtBI-1 showed resistance to H2O2 or SA- induced cell death (Kawai-Yamada
et al., 2004). The vectors, pBIG-AtBI-MBP (BI) and pBIG-MBP (VC) were introduced into
tobacco BY-2 cells expressing proaequorin protein (Takahashi et al., 1997). The transformed
235
cells were treated with H2O2 or CPA, and their viability were measured. It is known that H2O2
and CPA induces rapid [Ca2+]cyt elevation and cell death (Berridge 1993; Akaishi et al., 2004).
Although CPA- or H2O2- treatment caused massive cell death in the control BY-2 cell line
(VC), AtBI-1 overexpressed line (BI) repressed such effect (Figure 7A). Using the same cell
lines, we monitored [Ca2+]cyt after H2O2 or CPA treatment. As shown in Figure 7B and C, rapid
240
elevation in [Ca2+]cy appeared as a peak at 1-2 min after H2O2 or CPA treatment. The
luminescence traces showed individual properties between CPA and H2O2 treatments. The
duration and peak time were similar between cells expressing vector control and AtBI-1 (data
not shown). Treatment of AtBI-1-expressing cells with H2O2 resulted in slight decrease of
11
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
[Ca2+]cyt at peak point compared with the control cells. The CPA-released calcium
245
concentration in AtBI-1-overexpressing cells was reduced to 75 - 80% of the control at peak
point. The resting value of [Ca2+]cyt before treatment was around 100 nM in all transformed
strains (data not shown).
Discussion
250
BI-1 interacts with calmodulin
A rapid elevation in [Ca2+]cyt is a common response of organisms against various external
stresses. Evidences from previous studies suggest that such Ca2+ fluxes trigger various cellular
responses such as microtubule depolymerization, defense gene activation, and cell death
255
(Lecourieux et al., 2002). Using the yeast split-ubiquitin system, we demonstrated the
interaction of AtBI-1 with calmodulin protein. Furthermore, mutants of AtBI-1 lacking
function of cell death inhibition lost the ability to interact with calmodulin, suggesting that
interaction with calmodulin is essential in yeast for suppressing cell death by AtBI-1.
Furthermore, overlay assay indicated that C-terminal 14 amino acids of AtBI-1 interacted with
260
AtCaM7 protein. Our previous study demonstrated that the C-terminal 14 aa deleted mutant
protein failed to inhibit plant cell death caused by H2O2 or salicylic acid (Kawai-Yamada et al.,
2004), suggesting the C-terminal region is essential for the inhibition of cell death by AtBI-1.
Recent studies have demonstrated close interactions between calmodulin and several
enzymes involved in oxidative cell death responses. For instance, the calmodulin interacts with
265
and activates some plant catalases (Yang and Poovaiah 2002) and NAD kinase, which
generates NAD(P)H for NAD(P)H oxidase (Turner et al, 2004). In addition, the barley Mlo
protein, a plant-specific modulator of cellular defense and cell death, also binds to calmodulin
and the interaction was related to the control of pathogen defense (Kim et al., 2002). In the
12
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
present study, we showed that AtBI-1 also interacted with calmodulin, suggesting that
270
calmodulin may be one of key factors that regulate cell death or survival. The biochemical
function of CaM-binding BI-1 remains to be elucidated.
Anti-cell death function of AtBI-1 is associated with calcium flux
Several investigators point to a direct role of calcium in controlling life and death of plant cells
275
as well as mammalian cells (Sanders et al., 2002). The present study indicated that AtBI-1 did
not suppress Bax-induced cell death in yeast mutants lacking Pmr1 and Spf1. The two proteins
are homologues of animal SERCA pumps localized at Golgi and ER, respectively (Antebi et al.,
1992; Cronin et al., 2002), and are known to be involved in ER calcium homeostasis (Strayle et
al., 1999; Vashist et al., 2002). The inability of AtBI-1 to suppress cell death in ∆pmr1 and
280
∆spf1 suggests that an accurate calcium flux at Golgi or ER may be needed to the cell death
inhibitory function of AtBI-1 in yeast. Mutants deficient in other calcium transporters located
at the area, such as plasma membrane or vacuole, did not influence the anti-apoptotic function
of AtBI-1, supporting the conclusion that the cell death suppression by AtBI-1 involves ER or
Golgi calcium translocations.
285
To investigate the effect of AtBI-1 on calcium response to plant cell death stimuli, we
measured changes in [Ca2+]cyt in response to H2O2 and CPA using proaequorin
protein-expressing tobacco BY-2 cells. The finding that H2O2- treatment on tobacco plants
induced a transient increase in [Ca2+]cyt was previously reported (Price et al., 1994). In the
present study, a rise in [Ca2+]cyt was found at 1-2 min after H2O2 or CPA treatment, similar to
290
the result described by Price et al (1994). In contrast, Lecourieux et al (2002) showed biphasic
elevation caused by cryptogein of Phytophthora cryptogea and H2O2 in Nicotiana
plumbaginifolia cells. The [Ca2+]cyt elevation caused by various treatments might be different
13
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
in the magnitude, duration and frequency, leading to diverse cellular responses such as
adaptation to various stresses and cell death (Lecourieux et al., 2002).
295
Recently, Kadota et al (2005) demonstrated that the Ca2+ -permeable channel NtTPC1A/B
located at plasma membrane plays a role in H2O2-induced rise in [Ca2+]cyt in tobacco BY-2 cells.
Inhibition of SERCA by CPA treatment also leads to a rise in [Ca2+]cyt (Berridge 1993).
Because of leak of Ca2+ through an unidentified channel, inhibition of Ca2+-pump by CPA
induces an efflux of Ca2+ from the ER into the cytosol, producing an increase in cytosolic free
300
Ca2+ concentration (Zuppini et al., 2004; Sivaguru et al., 2005). In this study, CPA- and
H2O2-induced calcium elevation was reduced by AtBI-1-overexpression in tobacco cells. This
result is in agreement with those of previous studies demonstrating that human BI-1
overexpression led to decreased ER- releasable calcium concentration in human fibrosarcoma
cells as well as Bcl-2 overexpression in various animal cells (Chae et al., 2004,
305
Foyouzi-Youssefi et al., 2000). As mentioned above, inhibition of SERCA pump causes the
passive release of calcium from the ER and an increase in cytosolic calcium, which induces cell
death (Zhou et al., 1998). However, overexpression of SERCA can also result in induction of
cell death (Ma et al., 1999). These results indicate that accurate management of intracellular
calcium homeostasis is necessary for cell living/death regulation. We found that Arabidopsis
310
plants with overexpression or knocked-down of AtBI-1 demonstrated altered CPA or ion stress
tolerance, as reported in ECA1 transgenic plants (Wu et al., 2002), suggesting that AtBI-1 also
plays a role in regulation of calcium homeostasis. Whether AtBI-1 acts solely in modulating
ER-related [Ca2+]cyt flux or also regulates other steps remains to be determined.
Ca2+-pumps are widely distributed on membranes, including the plasma membrane,
315
vacuole, Golgi, and ER. The role of Ca2+ in cellular signaling pathway is well recognized in
mammalian cells, whereas the regulation of Ca2+ homeostasis in plant is still poorly understood.
CPA and TG are well known inhibitors of the SERCA causing an increase in [Ca2+]cyt
14
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
(Wuytack et al., 2003). In our experimental system, TG treatment did not cause effective Ca2+
efflux to the cytosol for unknown reason. The conflicts of such experimental results need to be
320
solved by isolation of target pumps.
Sze et al (2000) classified plant Ca2+-pumps in two different classes based on similarity to
animal proteins; type IIA, homologous to the SERCA class of Ca2+-ATPase located in ER, and
type IIB, homologous to the plasma membrane (PM)-type Ca2+-ATPase (PMCA). Interestingly,
Arabidopsis type IIA Ca2+-ATPase ECA1 can complement the yeast mutant defective in both
325
Golgi and vacuole Ca2+-pumps (pmr1 and pmc1, cnb1) (Liang et al., 1997; Sze et al., 2000).
Furthermore, the ECA1 is inhibited by CPA but not by TG (Liang and Sze 1998). In contrast,
the ACA2 of Arabidopsis encodes type IIB Ca2+-pump is unaffected by both CPA and TG
(Hwang et al., 2000). A pump showing mixed characteristics of both ECA and ACA pumps
was also identified in maize (Subbaiah and Sachs, 2000).
330
There is no experimental evidence for the regulation of plant type IIA Ca2+ pump activity.
The most closely related ER-type calcium pump in animal, SERCA, is highly regulated by
phosphorylation (East 2000). Since the plant type IIA pump is not directly regulated by
calmodulin (Liang and Sze, 1998), AtBI-1 may act as the mediator between calmodulin
signaling and Ca2+ pumps. Or, It is possible to speculate that the AtBI-1 may recruits/ or
335
remove calmodulin to/from the pump. Our data suggesting the involvement of Ca2+ -ATPases
localized at ER or Golgi for BI-1 function in yeast system are in good agreement with this
model. To elucidate the real function of AtBI-1 in plant cells, further analysis in
AtBI-1/AtCaM bindings, calcium flux measurement and target pumps in Arabidopsis are
needed.
340
It is demonstrated that the overexpression of BI-1 overcomes various stress-induced
defects. For example, H2O2-, SA-, elicitor-, heat- and cold-induced cell death were suppressed
in plant cells overexpressing AtBI-1 (Matsumura et al., 2003; Chae et al., 2003;
15
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Kawai-Yamada et al., 2004). The expression of plant BI-1 genes is rapidly up-regulated during
wounding, pathogen attack (Sanchez et al., 2000) and senescence (Coupe et al., 2004), but
345
down-regulated by elicitor treatment (Matsumura et al., 2003). These results suggest the
involvement of BI-1 in stress response and HR in plants. Furthermore, AtBI-1 overexpressing
and knock-down plants grew normally under general growth conditions. This suggests that
AtBI-1 is not essential for normal development and growth in Arabidopsis. Recently, two
Arabidopsis mutants with a T-DNA insertion in the AtBI-1 gene (atbi1-11 and atbi1-2) were
350
characterized by Watanabe and Lam (2006). Both mutants also showed no obvious phenotype
under general growth conditions. However, these mutants exhibited accelerated cell death upon
exposure to fungal toxin fumonisin B1. The BI-1 deficient mice also showed normal growth,
however increased susceptibility to ER-damage and oxidative stresses was reported (Chae et
al., 2004). In conclusion, the BI-1 is presumably not required for physiological regulation of
355
developmental plant PCD. Rather, BI-1 possesses evolutionarily conserved functions that
allow it to provide tolerance against stress-mediated cell death.
Materials and methods
Yeast split-ubiquitin two hybrid system
360
Protein interaction with AtBI-1 was analyzed using yeast split-ubiquitin system (Stagljar et al.,
1998; Kim et al., 2002). Plasmid vector (HvCaM3) and yeast cells were kindly provided by Dr.
Ralph Panstruga and Dr. IE Somssich (Max-Planck Institute). The C-terminal mutants of
AtBI-1 were constructed using PCR, as described previously (Kawai-Yamada et al., 2004).
The coding region of AtBI-1 and the C-terminal mutants (AtBI-29, 30, and 32) were cloned
365
into pMet-Cub-Ura3 vector to construct the bait plasmids. Yeast cells (JD53 strain) were
transformed with different combinations of bait (AtBI-1 and the mutants) and prey constructs,
and the His+Trp+Ura+ transformants were streaked on the minimum medium containing
16
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
5-fluoroorotic acid (5-FOA; 0.1%) and were incubated at 30°C for 4 days. Replacement of
Ile-13 of wild type Nubi by alanine (NuA) decreases the affinity to Cubi (Stagljar et al., 1998;
370
Kim et al., 2002). The low Cub-affinity NuA prey variant served as a negative control.
Plant materials
The transgenic plants expressing AtBI-1 and GFP (Arabidopsis thaliana ecotype Col-0) were
described previously in Kawai-Yamada et al (2001, 2004). To generate knock-down plants,
375
RNAi plasmid, pK7GWIWG2(II)-AtBI, was constructed. Briefly, the 3’-terminal fragment of
AtBI-1 cDNA (+291/+744; translation initiation is +1) was introduced into the RNAi plasmid,
pK7GWIWG2(II) (Karimi et al., 2002) by the Gateway system. The resulting plasmid was
transferred to Agrobacterium tumefaciens strain EHA105 (Hood et al., 1993) using the freeze
thaw method (An et al., 1998). Transformation of Arabidopsis plants was carried out by the
380
floral dip method (Bechtold and Pelletier 1998). Obtained plants were grown at 23°C under
continuous light conditions (60 µmol/m2/s).
Calmodulin overlay assay
We used an overlay assay to examine the ability of C-terminal region of AtBI-1 to bind with
385
Arabidopsis calmodulin 7 (AtCaM7) protein in vitro. The AtCaM7 cDNA was inserted into
pET32+ vector (Novagen, Madison, WI) to obtain His- and S-tagged AtCaM7 protein. The
resultant vector pET32-AtCaM7 was transformed into Escherichia coli BL21 strain and, the
recombinant His- and S-tagged CaM7 protein was purified according to the manufacture’s
instruction (Invitrogen).
390
The 14-amino acid C-terminal of AtBI-1 was ligated into pMAL vector (NEB, Beverly,
MA) to express MBP-tagged protein. The resultant vector was transformed into E. coli BL21
strain and MBP-tagged BI-C protein was purified according to the instructions provided by the
17
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
manufacturer (NEB, Beverly, MA). The empty pMAL vector possessing in-frame
β-galactosidase was used as a control (MAL-Gal). The purified BI-C and MAL-Gal proteins
395
were applied to SDS-PAGE, then blotted onto polyvinylidene difluoride (PVDF) membranes.
The membranes were immunoblotted with anti-MBP antibody (NEB) or overlay assayed with
recombinant AtCaM7 protein in the presence of 1 mM CaCl2 or 5 mM EGTA as described by
Kim et al (2002). To detect CaM7 binding, HRP conjugated-S-protein (Novagen) and ECL kit
(Amersham Biosciences, Little Chalfont, UK) were used because CaM7 protein was expressed
400
as S-tagged protein.
BiFC analysis
Plasmids for BiFC analysis were kindly provided from Dr. Klaus Harter (Univ. Köln,
Germany) and Dr. Hironori Kaminaka (Univ. Tottori, Japan) (Walter et al., 2004).
405
PCR-amplified coding regions of AtBI-1 and AtCaM7 were introduced into the XbaI/BamHI
site. The resultant plasmid, pSPYNE-AtBI-1 was fused with N-terminal (1-155 aa) region of
YEP, and pSPYCE-AtCaM7 was fused with C-terminal (156-239 aa) part of YFP. BiFC was
performed in 6-week-old Nicotiana benthamiana plants after Agrobacterium-mediated
transient transformation according to Walter et al (2004). For analysis of BiFC signal, a
410
fluorescence microscope (DMRD; Leica, Germany) was applied. For the control experiment,
pBin-AtBI-GFP (Kawai et al., 2001) was infiltrated to tobacco leaves and GFP fluorescence
was examined.
Yeast strain and cell death suppression assay
415
Saccharomyces cerevisiae disruption mutants were purchased from Euroscarf (Frankfurt,
Germany). Plasmids used here were described previously (Kawai et al., 1999; Kawai-Yamada
et al., 2001). Yeast disruption mutants and wild-type (BY4741) cells were transformed with
18
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
galactose-inducible Yep51 vector harboring Bax (Yep51-Bax), and pYX112 vector harboring
AtBI-1 (pYX112-AtBI-1). After culture of transformants in liquid medium containing
420
glucose for 1 day, the A600 of each culture was adjusted to 0.1 and serially diluted to 0.0001.
Each dilution (5 µl) was spotted on SD medium containing glucose or galactose and was
incubated at 30°C for 2 days (glucose) or 4 days (galactose).
Cytological analysis
425
GFP-tagged AtBI-1 (pYX112-AtBI-GFP) was transformed into yeast cells (Kawai-Yamada
et al., 2001). GFP fluorescence was examined with a fluorescence microscope (DMRD; Leica,
Germany). For measurement of cell viability, tobacco BY-2 cells were treated with the
indicated reagents for 16 hours and stained with 0.03% Evans blue. The numbers of stained
(dead) and unstained (live) cells were counted under microscopy.
430
RT-PCR
Arabidopsis and yeast total RNA was extracted using RNeasy Plant Mini Prep Kit (Qiagen,
Hilden, Germany), and 0.2 µg was used as a template for RT-PCR with specific primers for
AtBI-1 (5’- GGAATTCATGAGCATCCT TATCACTGCATT-3’ and
435
5’-GGTACCTCAGTTTCTCCT TTTCTTCTTC-3’) and Actin8 (5’TGAGCCAGATCTTCATCGTC -3’ and 5’- TCTCTTGCTCGTAGTCGACA -3’). The
conditions for direct amplification with Ready-To-Go RT-PCR Beads (Amersham Pharmacia)
were 1 cycle at 42°C for 20 min and at 95°C for 5 min; 28 cycle at 95°C for 30 sec, at 58°C
for 30 sec, and at 72°C for 1 min.
440
19
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Ion stress assay
Ion stress treatment was performed as described in Wu et al (2002). Briefly, surface sterilized
seeds were germinated on 0.8% agar plate with 0.5 x Murashige and Skoog (MS) medium
with 0.5 mM MnCl2 or calcium-free medium under constant illumination (60 µmol/m2/s). To
445
measure chlorophyll contents, leaves obtained from each seedling were homogenized with
80% acetone. The supernatant, collected after centrifugation, was examined at 663 and 645
nm, and the chlorophyll contents were calculated as described in Kawai-Yamada et al (2001).
Cytosolic calcium concentration
450
Tobacco BY-2 (Nicotiana tabacum L. cv bright yellow 2) suspension-culture cells expressing
proaequorin in the cytosol (Takahashi et al., 1997) were used for the measurement of [Ca2+]cyt.
The coding sequence of maltose-binding protein (MBP) was amplified from pMAL vector by
PCR and was cloned into pBIG vector containing the 35S promoter of Cauliflower mosaic
virus and nopaline synthase terminator to generate pBIG-MBP. In order to express
455
AtBI-MBP in BY-2 cells, PCR-amplified fragments of AtBI-1 was cloned into pBIG-MBP.
The resultant vectors, pBIG-AtBI-MBP and pBIG-MBP (control), were used for the
Agrobacterium-mediated transformation of tobacco BY-2 cells expressing proaequorin
protein (Takahashi et al., 1997).
The [Ca2+]cyt was measured by a method as described previously (Takahashi et al.,
460
1997: Kawano et al., 1998). The transformed BY-2 cells (3-day-old) were incubated with 1
µM coelenterazine in the culture medium in darkness for 8 hours to reconstitute the
calcium-sensitive luminescent protein aequorin. The cells were washed with and
re-suspended in fresh medium and used after 30 min of resting incubation. H2O2 or CPA was
added to the cells and [Ca2+]cyt-dependent aequorin luminescence was monitored with a
465
CHEM-GLOW Photometer (American Instrument Co., MD) equipped with a pen recorder
20
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
(Rikadenki Co., Tokyo, Japan), and expressed as relative peak height of aequorin
luminescence. After each experiment, all remaining aequorin was discharged with 1 M CaCl2
and 10% ethanol, and the resultant luminescence was measured to estimate the amount of
remaining aequorin. [Ca2+]cyt was calculated using the calibration equation: pCa =
470
0.332588(-logk) + 5.5593 where k represents luminescence counts per second divided by
total counts (Knight et al, 1996).
Acknowledgements
Plasmids and strains used for split-ubiquitin system were generously provided by Dr. Ralph
475
Panstruga (Max-Planck Institute, Saarbruecken, Germany) and Dr. Imre E. Somssich
(Max-Planck Institute). Plasmids used for the BiFC analysis were kindly provided by Dr.
Klaus Harter (Univ. Köln, Germany) and Dr. Hironori Kaminaka (Univ. Tottori, Japan).
Plasmids and strains used for cell death assay in yeast were kindly provided by Dr. John C.
Reed (The Burnham Institute, La Jolla, CA). We thank Ms. Y. Takahashi for her technical
480
help. This work was supported by a Grant-in-Aid for Scientific Research on Priority Arias
(Grant No. 17051006) from the Ministry of Education, Culture, Sports, Science and
Technology of Japan, a grant from the Ministry of Agriculture, Forestry, and Fisheries of
Japan, and from CREST, JST.
21
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Figure Legends
485
Figure 1. AtBI-1 interacts with calmodulin in yeast.
(A) Bait and prey vector constructs used for yeast split-ubiquitin two hybrid system. Nubi
and Cubi represent the N- and the C-terminus of ubiquitin protein, respectively (Stagljar et al.,
1998; Kim et al., 2002). The full-length of AtBI-1 was used as a bait protein and the
490
C-terminal 14 amino acids were replaced in mutants (AtBI-29, 32, 30) as presented. Replaced
amino acids are underlined. Amino acids with positive charge are indicated in red and those
with negative charge in blue. Calculated scores for coiled-coil structure and abilities for cell
death suppression are indicated (Kawai-Yamada et al., 2004). pCup: pCup promoter;
HvCaM3: barley calmodulin 3; tCYC: CYC1 terminator; pMet: pMet promoter; URA3:
495
reporter protein. (B) Yeast split-ubiquitin system was used to analyze the interaction between
AtBIs (AtBI-1, AtBI-29, 30 and 32) and HvCaM3. Yeast cells containing different
combinations of bait (AtBI-1, AtBI-29, 30 and 32) and prey (NuI-HvCaM3) constructs were
tested for their growth phenotype on the minimum medium containing 5-fluoroorotic acid
(5-FOA). For the negative control, yeast cells possessing NuA-HvCaM3 and AtBI-1 (BI-1 +
500
NuA) were also plated. The results show the growth of each line after 2 days (without
5-FOA) and 6 days (with 5-FOA) incubation at 30°C.
Figure 2. Overlay assay reveals that Arabidopsis calmodulin protein interacts with the
C-terminal region of AtBI-1.
505
To detect the interaction between AtCaM7 and the C-terminal region of AtBI-1, an overlay
assay was performed. The purified MBP tagged C-terminal 14 amino acid of AtBI-1 (BI-C)
and β-galactosidase (gal) proteins were run by a gel electrophoresis, and blotted on a
membrane as described in Materials and methods. CBB staining, western blotting with
22
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
anti-MBP antibody were performed as control of protein loading. The overlay assay was
510
performed by a S-tagged AtCaM7 protein with 1 mM CaCl2 or 5 mM EGTA-containing
solution.
Figure 3. BiFC analysis of AtBI-1/AtCaM7 interaction in plant cells.
(A) Schematic representation of BiFC plasmids. The coding region of AtBI-1 and AtCaM
515
genes were fused with N-terminal (YFP-N, 1-155 aa) and C-terminal (YFP-C, 156-239 aa)
region of YFP, respectively. (B-E) BiFC visualization in Agrobacterium-infiltrated tobacco
(Nicotiana benthamiana) leaves with pSPYNE-AtBI-1/pSPYCE (empty vector) (B and D)
and pSPYNE-AtBI-1/pSPYCE-AtCaM7 (C and E). (F) Visualization of AtBI-GFP. Arrows
indicate nuclei. Bars in B and C = 100 µm. Bars in D-F = 10 µm.
520
Figure 4. AtBI-1 does not suppress Bax-induced cell death in ∆pmr1 and ∆spf1.
(A) Spot assay of cell death suppression activity of AtBI-1 in various yeast deletion mutants.
Mutants used here are summarized in Table 1. Mutant cells transformed with plasmids
containing Bax and AtBI-1 were spotted on SD medium containing glucose (Glu) or
525
galactose (Gal). The results show the growth of each line after 2-day (Glu) and 4-day (Gal)
incubation at 30°C. BY4741 strain was wild-type used as a control. Red arrows indicate the
lines that failed to suppress cell death even when AtBI-1 was expressed. (B) Cell death
suppression activity of AtBI-1 in yeast mutants. Relative growth of yeast strains expressing
AtBI-1 (Glu), or both AtBI-1 and Bax (Gal) was compared. The spots appeared in third
530
dilution (A600=0.001) of (A) were densitometricaly analyzed and expressed as relatives
(Glu/Gal). Data shown are mean +S.E. of three experiments. (C) RT-PCR analysis of AtBI-1
expression in wild type (WT), ∆pmr1, and ∆spf1 yeast cells. Total RNA was prepared from
cells cultured for 16h in SD-Glu medium. Ethidium bromide staining of rRNAs was served as
23
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
a loading control. (D) Expression of GFP-tagged AtBI-1 protein in yeast cells. Fluorescence
535
of AtBI-GFP in wild-type cells, in ∆pmr1 cells and in ∆spf1 was observed with a
fluorescence microscope.
Figure 5. CPA resistance in Arabidopsis plants overexpressing AtBI-1.
(A) Schematic diagrams of the vectors used for production of OX and KD transgenic lines.
540
P35S, cauliflower mosaic virus (CaMV) 35S promoter; LB, left -DNA border: RB, right
T-DNA border; NosT, nopaline synthetase terminator; KanR, kanamycin resistance gene. (B)
RT-PCR analysis of AtBI-1 expression in wild type (WT), overexpressing (OX), knock-down
(KD) and GFP transgenic plants. Total RNA was prepared from 2 week-old seedlings. Actin8
(ACT8) was used as an internal control. Ethidium bromide staining of rRNA was served as a
545
loading control. (C) Chlorophyll contents in 3-5th leaves obtained from transgenic plants
grown on 0.5 x MS-medium (Control) or 0.5 x MS-medium with CPA for 3 weeks. n=4-6.
Data are mean + SE.
Figure 6. Phenotypes of transgenic plants associated with ion stress conditions.
550
(A) Phenotypes of transgenic plants grown on 0.5x MS-medium with 0.5 mM MnCl2 (+Mn)
or without Ca2+ (-Ca) for 3 weeks. (B) The third leaves obtained from transgenic plants gown
on the 0.5x MS-medium with 0.5 mM MnCl2 or without Ca2+ for 3 weeks. (C) Chlorophyll
contents in transgenic plants grown on the 0.5x MS-medium with 0.5 mM MnCl2 or without
Ca2+ for 3 weeks. Data are mean + SE. n=4-6. KD, knock down; OX, overexpression.
555
Figure 7. Measurement of [Ca2+]cyt following H2O2 or CPA treatment in
AtBI-1-overexpressing BY-2 cells.
24
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
(A) Inhibition of H2O2 - or CPA- induced cell death by AtBI-1. Viability of BY-2 cells
expressing empty vector (VC) or AtBI-MBP (BI) after 3 mM H2O2 treatment for 16 hours, or
560
after treatment with 1, 5 or 10 µM of CPA for 16 hours. Evans blue-negative (living) and
-positive (dead) cells were counted under a microscope. Each bar represents the mean ± SE
values of three independent experiments (n=10 - 18). (B) Typical aequorin luminescence
traces of cells expressing AtBI-1 treated with 3 mM H2O2 or 10 µM CPA. Arrows indicate
the time of CPA and H2O2 administration. AL, aequorin luminescence. (C) Measurement of a
565
peak [Ca2+]cyt after treatment with 3 mM H2O2 or 10 µM CPA. Each bar represents the mean
±SE values of three independent experiments. n=12-14. **, P < 0.01. *. P<0.05
25
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Table 1. Saccharomyces cerevisiae strains used in the present study.
Disrupted gene
YNL291c
Name, putative intracellular localization, and estimated
function of the mutated protein
Mid1, ER and PM, stretch-activated Ca2+-channel
Reference
Locke et al., (2000)
Yoshimura et al., (2004)
YLR220w
Ccc1, vacuole, involved in iron, Mn2+ and Ca2+ transport
Lapinskas et al., (1996)
YEL031w
Spf1, ER, P-type ATPase involved in Ca2+ homeostasis
Cronin et al., (2002)
YOR087w
Yvc1, vacuole, Ca2+-channel
Bertl and Slayman (1990)
YGR217w
Cch1, PM, voltage-gated Ca 2+-channel
Locke et al., (2000)
YGL006w
Pmc1, vacuole, Ca2+-ATPase
Cunningham and Fink (1994)
YDL128w
Vcx1, vacuole, H+/Ca 2+ antipoter
Cunningham and Fink (1996)
YGL167c
Pmr1, Golgi, Ca2+-ATPase
Antebi and Fink (1992)
570
ER, endoplasmic reticulum; PM, plasma membrane
26
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
REFERENCES
An G, Ebert RR, Mitra A, Ha SB (1998) Binary vectors. In Plant Molecular Biology
Manual, SB Gelvin and RA Schilperoort eds (Dordrecht, The Netherlands: Kluwer
575
Academic Publishers), pp 1-19
Antebi A, Fink GR (1992) The yeast Ca2+-ATPase homologue, PMR1, is required for
normal Golgi function and localizes in a novel Golgi-like distribution. Mol Biol Cell 3:
633-654
Akaishi T, Nakazawa K, Sato K, Saito H, Ohno Y, Ito Y (2004) Hydrogen peroxide
580
modulates whole cell Ca2+ currents through L-type channels in cultures rat dentate
granule cells. Neuro Lett 356: 25-28
Baek D, Nam J, Koo YD, Kim DH, Lee J, Jeong JC, Kwak SS, Chung WS, Lim CO,
Bahk JD, Hong JC, Lee SY, Kawai-Yamada M, Uchimiya H, Yun DJ (2004)
Bax-induced cell death of Arabidopsis is meditated through reactive oxygen-dependent
585
and -independent processes. Plant Mol Biol 56: 15-27
Bechtold N, Pelletier G (1998) In planta Agrobacterium-mediated trasnsformation of adult
Arabidopsis thaliana plants by vacuum infiltration. Methods Mol Biol 82: 259-266
Berridge MJ (1993) Inositol trisphosphate and calcium signaling. Nature 361: 315–325
Bertl A, Slayman CL (1990) Cation-selective channels in the vacuolar membrane of
590
Saccharomyces: dependence on calcium, redox state, and voltage. Proc Natl Acad Sci
USA 87: 7824-7828
Blume B, Nürnberger T, Nass N, Schell D (2000) Receptor-mediated increase in
cytoplasmic free calcium required for activation of pathogen defense un parsley. Plant
Cell 12: 1425-1440
595
Bolduc N, Brisson LF (2002) Antisense down regulation of NtBI-1 in tobacco BY-2 cells
induces accelerated cell death upon carbon starvation. FEBS Lett 532: 111-114
Bolduc N, Ouellet M, Pitre F, Brisson LF (2003) Molecular characterization of two plant
BI-1 homologues which suppress Bax-induced apoptosis in human 293 cells. Planta 216:
377-386
600
Chae HJ, Ke N, Kim HR, Chen S, Godzik A, Dickman M, Reed JC (2003) Evolutionarily
conserved cytoprotection provided by Bax Inhibitor-1 homologs from animals, plants,
and yeast. Gene 323: 101-113
Chae HJ, Kim HR, Xu C, Bailly-Maitre B, Krajewska M, Krajewski S, Banares S, Cui J,
Digicaylioglu M, Ke N, Kitada S, Monosov E, Thomas M, Kress CL, Babendure JR,
605
Tsien RY, Lipton SA, Reed JC (2004) BI-1 regulates an apoptosis pathway linked to
27
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
endoplasmic reticulum stress. Mol Cell 15: 355-366
Chichkova NV, Kim SH, Titova ES, Kalkum M, Morozov VS, Rubtsov YP, Kalinina NO,
Taliansky ME, Vartapetian AB (2004) A plant caspase-like protease activated during
the hypersensitive response. Plant Cell 16: 157-171
610
Coupe SA, Watson LM, Ryan DJ, Pinkney TT, Eason JR (2004) Molecular analysis of
programmed cell death during senescence in Arabidopsis thaliana and Brassica
oleracea: cloning broccoli LSD1, Bax inhibitor and serine palmitoyltransferase
homologues. J Exp Bot 55: 59-68
Cronin SR, Rao R, Hampton RY (2002) Cod1p/Spf1p is a P-type ATPase involved in ER
615
function and Ca2+ homeostasis. J Cell Biol 157: 1017-1028
Cunningham KW, Fink GR (1994)
Calcineurin-dependent growth
control in
Saccharomyces cerevisiae mutants lacking PMC1, a homolog of plasma membrane Ca2+
ATPases. J Cell Biol 124: 351-363
Cunningham KW, Fink GR (1996) Calcineurin inhibits VCX1-dependent H+/Ca2+
620
exchange and induces Ca2+ ATPases in Saccharomyces cerevisiae. Mol Cell Biol 16:
2226-2237
East JM (2000) Sarco(endo)plasmic reticulum calcium pumps: Recent advantages in our
understanding of structure/function and biology. Mol Membr Biol 17: 189-200
Foyouzi-Youssefi R, Arnaudeau S, Borner C, Kelley WL, Tschopp J, Lew DP, Demaurex
625
N, Krause KH (2000) Bcl-2 decreases the free Ca2+ concentration within the
endoplasmic reticulum. Proc Natl Acad Sci USA 97: 5723-5728
Geisler M, Axelsen KB, Harper JF, Palmgren MG (2000) Molecular aspects of higher
plant P-type Ca2+-ATPases. Biochim Biophys Acta 1465: 52-78
Hatsugai N, Kuroyanagi M, Yamada K, Meshi T, Tsuda S, Kondo M, Nishimura M,
630
Hara-Nishimura I (2004) A plant vacuolar protease, VPE, mediates virus-induced
hypersensitive cell death. Science 305: 855-858
Hara-Nishimura I, Hatsugai N, Nakaune S, Kuroyanagi M, Nishimura M (2005)
Vacuolar processing enzyme: an executor of plant cell death. Curr Opin Plant Biol 8:
404-408
635
Hood EE, Gelvin SB, Melchers LS, Hoekema A (1993) New Agrobacterium vector for
plant transformation. Transgenic Res 2: 208-218
Hückelhoven R (2004) Bax inhibitor-1, an ancient cell death suppressor in animals and
plants with prokaryotic relatives. Apoptosis 9: 299-307
Hückelhoven R, Dechert C, Kogel KH (2003) Overexpression of barley BAX inhibitor 1
28
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
640
induces breakdown of mlo-mediated penetration resistance to Blumeria graminis. Proc
Natl Acad Sci USA 100: 5555-5560
Hwang I, Sze H, Harper JF (2000) A calcium-dependent protein kinase can inhibit a
calmodulin-stimulated Ca2+ pump (ACA2) located in the endoplasmic reticulum of
Arabidopsis. Proc Natl Acad Sci USA 97: 6224-6229
645
Kadota Y, Furuichi T, Sano T, Kaya H, Gunji W, Murakami Y, Muto S, Hasezawa S,
Kuchitsu K (2005) Cell-cycle-dependent regulation of oxidative stress responses and
Ca2+ permeable channels NtTPC1A/B in tobacco BY-2 cells. Biochem Biophys Res
Comm 336: 1259-1267
Karimi M, Inzé D, Depicker A (2002) GATEWAY vectors for Agrobacterium-mediated
650
plant transformation. Trends Plant Sci 7: 193-195
Kawai M, Pan L, Reed JC, Uchimiya H (1999) Evolutionally conserved plant homologue
of the Bax inhibitor-1 (BI-1) gene capable of suppressing Bax-induced cell death in yeast.
FEBS Lett 464: 143-147
Kawai-Yamada M, Jin L, Yoshinaga K, Hirata A, Uchimiya H (2001) Mammalian
655
Bax-induced plant cell death can be down-regulated by overexpression of Arabidopsis
Bax Inhibitor-1 (AtBI-1). Proc Natl Acad Sci USA 98: 12295-12300
Kawai-Yamada M, Ohori Y, Uchimiya H (2004) Dissection of Arabidopsis Bax
Inhiibtor-1 suppressing Bax-, hydrogen peroxide-, and salicylic acid-induced cell death.
Plant Cell 16: 21-32
660
Kawano T, Sahashi N, Takahashi K, Uozumi N, Muto S (1998) Salicylic acid induces
extracellular superoxide generation followed by an increase in cytosolic calcium ion in
tobacco suspension culture: the earliest events in salicylic acid signal transduction. Plant
Cell Phys 39: 721-730
Kim MC, Panstruga R, Elliot C, Muller J, Devoto A, Yoon HW, Park HC, Cho MJ,
665
Schulze-Lefert P (2002) Calmodulin interacts with MLO protein to regulate defense
against mildew in barley. Nature 416: 447-450
Knight H, Trewavas AJ, Knight MR (1996) Cold calcium signaling in Arabidopsis
involves two cellular pools and a change in calcium signature after acclimation. Plant
Cell 8: 489-503
670
Lacomme C, Cruz SS (1999) Bax-induced cell death in tobacco is similar to the
hypersensitive response. Proc Natl Acad Sci USA 96: 7956-7961
Lam M, Dubyak G, Chen L, Nunez G, Miedfeld RL, Distelhorst WD (1994) Evidence
that Bcl-2 represses apoptosis by regulating endoplasmic reticulum-associated Ca2+
29
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
fluxes. Proc Natl Acad Sci USA 91: 6569-6573
675
Lapinskas PJ, Lin SJ, Culotta VC (1996) The role of the Saccharomyces cerevisiae CCC1
gene in the homeostasis of manganese ions. Mol Microbiol 21: 519-528
Lecourieux D, Mazar C, Pauly N, Ranjeva R, Pugin A (2002) Analysis and effects of
cytosolic free calcium increases in response to elicitors in Nicotiana plumbaginifolia
cells. Plant Cell 14: 2627-2641
680
Liang F, Cunningham KW, Harper JF, Sze H (1997) ECA1 complements yeast mutants
defective in Ca2+ pumps and encodes an endoplasmic reticulum-type Ca2+-ATPase in
Arabidopsis thaliana. Proc Natl Acad Sci USA 94: 8579-8584
Liang F, Sze H (1998) A high-affinity Ca2+ pump, ECA1, from the endoplasmic reticulum is
inhibited by cyclopiazonic acid but not by thapsigargin. Plant Phys 118: 817-825
685
Locke EG, Bonilla M, Liang L, Takita Y, Cunningham KW (2000) A homolog of
voltage-gated Ca2+ channels stimulated by depletion of secretory Ca2+ in yeast. Mol Cell
Biol 20: 6686-6694
Ma TS, Mann DL, Lee JH, Gallinghouse GJ (1999) SR compartment calcium and cell
apoptosis in SERCA overexpression. Cell Calcium 26: 25-36
690
Matsumura H, Nirasawa S, Kiba A, Urasaki N, Saitoh H, Ito M, Kawai-Yamada M,
Uchimiya H, Terauchi R (2003) Overexpression of Bax inhibitor suppresses the fungal
elicitor-induced cell death in rice (Oryza sativa L) cells. Plant J 33: 425-434
Piffanelli P, Zhou F, Casais C, Orme J, Jarosch B, Schaffrath U, Collins NC, Panstruga
R, Schulze-Lefert P (2002) The barley MLO modulator of defense and cell death is
695
responsive to biotic and abiotic stress stimuli. Plant Physiol 129: 1076-1085
Pinton P, Ferrari D, Rapizzi E, Virgilio FD, Pozzan T, Rizzuto R (2001) The Ca2+
concentration of the endoplasmic reticulum is a key determinant of ceramide-induced
apoptosis: significance for the molecular mechanism of Bcl-2 action. EMBO J 20:
2690-2701
700
Price AH, Taylor A, Ripley SJ, Friffiths A, Trewavas AJ, Knight R (1994) Oxidative
signals in tobacco increase cytosolic calcium. Plant Cell 6: 1301-1310
Rentel MC, Knight MR (2004) Oxidative stress-induced calcium signaling in Arabidopsis.
Plant Phys 135: 1471-1479
Rudolph HK, Antebi A, Fink GR, Buckley CM, Dorman TE, LeVitre J, Davidow LS,
705
Mao JI, Moir DT (1989) The yeast secretory pathway is perturbed by mutation in
PMR1, a member of a Ca2+ ATPase family. Cell 58: 133-145
Sanchez P, de Torres-Zabala M, Grant M (2000) AtBI-1, a plant homologue of Bax
30
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
inhibitor-1, suppresses Bax-induced cell death in yeast and is rapidly upregulated during
wounding and pathogen challenge. Plant J 21: 393-399
710
Sanders D, Pelloux J, Brownlee C, Harper JF (2002) Calcium at the crossroads of
signaling. Plant Cell 14: 401-417
Scorrano L, Oakes SA, Opferman JT, Cheng EH, Sorcinelli MD, Pozzan T, Korsmeyer
SJ (2003) BAX and BAK regulation of endoplasmic reticulum Ca2+: a control point for
apoptosis. Science 300: 135-139
715
Sivaguru M, Yamamoto Y, Rengel Z, Ahn SJ, Matsumoto H (2005) Early events
responsible for aluminum toxicity symptoms in suspension-cultured tobacco cells. New
Phytologist 165: 99-109
Stagljar I, Korostensky C, Johansson N, Heesen S (1998) A genetic system based on
split-ubiquitin for the analysis of interactions between membrane proteins in vivo. Proc
720
Natl Acad USA 95: 5187-5192
Strayle J, Pozzan T, Rudolph HK (1999) Steady-state free Ca2+ in the yeast endoplasmic
reticulum reaches only 10 µM and is mainly controlled by the secretory pathway pump
pmr1. EMBO J 18: 4733-4743
Subbaiah CC, Sachs MM (2000) Maize cap1 encodes a novel SERCA-type
725
calcium-ATPase with a calmodulin-binding domain. J Biol Chem 275: 21678-21687
Sze H, Liang F, Hwang I, Curran AC, Harper JF (2000) Diversity and regulation of plant
Ca2+ pumps: insights from expression in yeast. Annu. Rev Plant Physiol Plant Mol Biol
51: 433-462
Takahashi K, Isobe M, Knight MR, Trewavas AJ, Muto S (1997) Hypoosmotic shock
730
induces increase in cytosolic Ca2+ in tobacco suspension-culture cells. Plant Phys 113:
587-594
Vashist S, Frank CG, Jakob CA, Ng DTW (2002) Tow distinctly localized P-type ATPases
collaborate to maintain organelle homeostasis required for glycoprotein processing and
quality control. Mol Biol Cell 21: 3955-3966
735
Walter M, Chaban C, Schütze K, Batistic O, Weckermann K, Näke C, Blazevic D,
Grefen C, Schumacher K, Oecking C, Harter K, Kudla J (2004) Visualization of
protein
interactions
in
living
plant
cells
using
biomolecular
fluorescence
complementation. Plant J 40: 428-438
Watanabe N, Lam E (2006) Arabidopsis Bax inhibitor-1 functions as an attenuator of biotic
740
and abiotic types of cell death. Plant J 45: 884-894
Wei MC, Zong WX, Cheng EH, Lindsten T, Panoutsakopoulou V, Ross AJ, Roth KA,
31
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
MacGregor GR, Thompson CB, Korsmeyer SJ (2001) Proapoptotic BAX and BAK: a
requisite gateway to mitochondrial dysfunction and death. Science 292: 727-730
Wu Z, Liang F, Hong B, Young JC, Sussman MR, Harper JF, Sze H (2002) An
745
endoplasmic reticulum-bound Ca2+/Mn2+ pump, ECA1, supports plant growth and
confers tolerance to Mn2+ stress. Plant Phys 130: 128-137
Wuytack F, Raeymaekers L, Missiaen L (2003) PMR1/SPCA Ca2+ pumps and the role of
the Golgi apparatus as a Ca2+ store. Pflugers Arcch Eur J Phys 446: 148-153
Xu Q, Reed JC (1998) Bax inhibitor-1, a mammalian apoptosis suppressor identified by
750
functional screening in yeast. Mol Cell 1: 337-346
Yang T, Poovaiah BW (2002) Hydrogen peroxide homeostasis: activation of plant catalase
by calcium/calmodulin. Proc Natl Acad Sci USA 99: 4097-4102
Turner WL, Waller JC, Vanderbeld B, Snedden, WA (2004) Cloning and characterization
of two NAD kinases from Arabidopsis. identification of a calmodulin binding isoform.
755
Plant Phys 135: 1243-1255
Yoshimura H, Tada T, Iida H (2004) Subcellular localization and oligomeric structure of
the yeast putative stretch-activated Ca2+ channel component Mid1. Exp Cell Res 293:
185-915
Yoshinaga K, Arimura S, Hirata A, Niwa Y, Yun DJ, Tsutsumi N, Uchimiya H,
760
Kawai-Yamada M (2005) Mammalian Bax initiates plant cell death through organelle
destruction. Plant Cell Reports 24: 408-417
Zha H, Fisk HA, Yaffe MP, Mahajan N, Herman B, Reed JC (1996) Structure-function
comparisons of the proapoptotic protein Bax in yeast and mammalian cells. Mol Cell
Biol 16: 6494-6508
765
Zielinski RE (2002) Characterization of three new members of the Arabidopsis thaliana
calmodulin gene family: conserved and highly diverged members of the gene family
functionally complement a yeast calmodulin null. Planta 214: 446-455
Zhou YP, Teng D, Dralyuk F, Osterga D, Roe MW, Philipson L, Polondky KS (1998)
Apoptosis in inculin-secreting cells. J Clin Inverst 101: 1623-1632
770
Zuppini A, Navazio L, Mariani P (2004) Endoplasmic reticulum stress-induced
programmed cell death in soybean cells. J Cell Sci 117: 2591-2598
32
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.
Downloaded from on June 18, 2017 - Published by www.
Copyright © 2006 American Society of Plant Biologists. Al
Downloaded from on June 18, 2017 - Published by www.
Copyright © 2006 American Society of Plant Biologists. Al
Downloaded from on June 18, 2017 - Published by www.plantphysiol.org
Copyright © 2006 American Society of Plant Biologists. All rights reserved.