Download Exploring Nitrogen Fixing, Chemo heterotrophic Oligophiles from

Open Access
Scientific Reports
Open Access Scientific Reports
Pathak and Kalekar, 1:12
http://dx.doi.org/10.4172/scientificreports.555
Open
OpenAccess
Access
Research Article
Exploring Nitrogen Fixing, Chemo heterotrophic Oligophiles from Natural
Habitats for Preparing Biofertilizers
Leena Pathak* and Saylee Kalekar
HPT Arts and RYK.Science College, Nashik, Maharashtra, India
Introduction
Protocol
Chemical fertilizers have been proved to be hazardous to nature.
Eutrophication is a process caused due to excess of chemical fertilizers
which is an indication of gross pollution of the aquatic environment.
Biofertilizers are eco friendly fertilizers [1]. They cause no pollution
and are not expensive. They are suitable for all crops. They are prepared
using various microorganisms such as, Nitrogen fixers-Azotobacter
spp, Rhizobium spp, Blue green algae etc. and phosphate solubilizersMycorrhizal associations.
Total genomic DNA was isolated using GeneElute genomic DNA
isolation kit (Sigma, USA) as per the manufacturer’s instructions
and used as a template for PCR. Each reaction mixture contain
approximately 10 ng of DNA; 2.5 mm MgCl2, 1x PCR buffer (Genei,
Banglore, India), 200 μM each dCTP, dGTP, dATP and dTTP. 2 pmol
of each forward and reverse primer, and 1 U of Taq DNA polymerase
(Genei, Banglore, India) in a final volume of 20 μl. FDD2 and RPP2
primers were used to amplify almost entire 16s rRNA gene as
described previously (Rawlings 1995). The PCR was performed using
the Eppendorf Gradient Mastercycler system with a cycle of 94°C for
5 minutes; 30 cycles of 94°C, 60°C, and 72°C for 1 minute each. Final
extension was done at 72°C for 10 minute, and mixture was held at
4°C. The PCR product was precipitated using polyethylene glycol (PEG
6000, 8.5%) washed thrice-using 70% ethanol and dissolved in tris-HCl
(10 mM, pH-8.0).
Oligophiles are a new group of bacteria, able to grow at extremely
low concentration of nutrients [2]. A substantial proportion of bacteria
long thought to be unable to grow on culture media were recently
shown to be oligophilic [3]. Majority of natural habitats are nutrient
deficient. Numerous species of oligophiles are likely to be existing in
nature. These organisms need to be explored for various beneficial
purposes.
Hypothesis
Nitrogen fixing, chemoheterotrophic oligophiles are existing in
nature. They can be isolated on culture media and have beneficial
activities. They can be used for preparation of biofertilizers. These
biofertilizers will be much cheaper and more effective than the existing
one.
Objectives
Objectives of the study were to formulate suitable culture media for
isolation of nitrogen fixing chemoheterotrophic oligophiles. Isolating
nitrogen fixing chemoheterotrophic oligophiles from natural habitats
such as soil, air, water etc. and to identify these isolates. To study the
effect of various carbon sources on growth of these bacteria. Exploring
the possibility of using these microbes in preparing biofertilizers.
Materials
Various natural sources such as soil from rhizosphere, water, air. Media used for isolating the culture were nitrogen free glucose agarNorris Medium, the most common medium used for isolation of
Azotobacter spp. 1:100, 1:500, 1:1000 diluted. Nitrogen free medium
with different carbon sources such as Glucose, Mannitol, and Sucrose
etc.
Methodology
Spread suspension of soil from rhizosphere on various dilutions of
nitrogen free glucose agar. Expose some plates of diluted medium to
air. Incubate all plates at room temperature till some colonies appear
on these media. Record colony characteristics and obtain pure cultures
on slants of the respective media. Study the effect of various carbon
sources on growth of these bacteria. Prepare a liquid medium with
the carbon source giving maximum growth. Using the above medium
prepare liquid bio-fertilizer and check their efficiency of nitrogen
fixation by field trials. Compare with Azotobacter biofertilizer with
respect to efficiency, cost, production, time etc. Subject the isolates to
identification by latest technique.
The ABI Prism BigDye Terminator Cycle Sequencing Ready
Reaction kit (Applied Biosystems, Foster City, Calif.) was used for the
sequencing of the PCR product. A combination of universal primers was
chosen to sequence the nearly complete gene. The sequencing reaction
and template preparation were performed and purified in accordance
with the directions of the manufacturer (Applied Biosystems). The
sequencing output was analyzed using the accompanying DNA
Sequence Analyzer computer software (Applied Biosystems). The
sequence was compared with National Center for Biotechnology
Information GenBank entries by using the Blast algorithm.
Results and Conclusions
Photographs of some common bacteria unable to grow on dilute
media were shown in figures 1-5.
Several colonies were obtained on 1:100, 1:500 and 1:1000 dilutions
of Nitrogen free glucose agar after 4-5 days of incubation at room
temperature. Nitrogen free glucose agar with three different energy
sources -Glucose, Sucrose and Mannitol was prepared and comparative
study on their dilutions was carried out. Glucose and Mannitol were
found to be suitable but not sucrose. Liquid bio fertilizer using 1:1000
dilution of the medium with Glucose was prepared but the cell density
was too less after incubation for one week.
Hence, lower dilution 1:500 was used. It has given promising
*Corresponding author: Leena Pathak, H.P.T.Arts and R.Y.K.Science College,
Nashik, Maharashtra, India, E-mail: [email protected]
Received April 26, 2012; Published November 27, 2012
Citation: Pathak L, Kalekar S (2012) Exploring Nitrogen Fixing, Chemo
heterotrophic Oligophiles from Natural Habitats for Preparing Biofertilizers. 1:555
doi:10.4172/scientificreports.555
Copyright: © 2012 Pathak L, et al. This is an open-access article distributed under
the terms of the Creative Commons Attribution License, which permits unrestricted
use, distribution, and reproduction in any medium, provided the original author and
source are credited.
Volume 1 • Issue 12 • 2012
Citation: Pathak L, Kalekar S (2012) Exploring Nitrogen Fixing, Chemo heterotrophic Oligophiles from Natural Habitats for Preparing Biofertilizers.
1:555 doi:10.4172/scientificreports.555
Page 2 of 3
>OLIGO
TCCCCCCCNCCATGGGCATTGCCAATGGGCGAAACCTGTTTGCCCGACGCCGCGTGAGTGATGACGGC
CTTCGGGTTGTAACCTCTTTCATCAGGGAAGAAGCGAAAGTGACGGTACCTGCAGAAGATGGCCGGCT
AACTACGTGCCAGCCAGCCGCGGTAAGACGTAGGGCGCAAGCGTTGTCCGGAGTTATTGGGCGTAAAT
AGCTCGTAAGCGGCTTGTCGCGTCTGTTGTGCAAAGCCCGGGGCTTAACCCCGGGTCTGCAGTCGATA
CGGGCAGGCTATATTCGGTAGGGGAGATCGNGAATTCCTGGTGTAGCGGTGAAATGCCCAGATATCAC
GGAGGAACACCGGTGGCGAAGGCGGATCTCTGGTCCGCATACTGCACGCTGNATGAGGCTAAAGCGT
GAGGCGGCCAAGANGATTAGATACCCTGGTAGTCCACGCCGTTAACGGTGGGCACTAGGGGTGGGCA
ACATTCCACGTTGTCCGTGCCGCATCTAACCCATTAATTGCCCCGCCTGGGGAGTACGGCCGCAACGCT
AAAACTCAAAGGAATTGACGGGGGCCCGCACAAGTTGCCGGAGCATGTGGCTTAATTCCGACACCAC
GCGAATAACCTTNACCAAGGCTTGA
Figure 1: E.coli, Bacillus spp., Klebsiella spp., Serratia marscescens
replicated from normal nutrient agar on 1:1000 dilution showed no growth.
Strain
Total Max
Description
Designation
score ident
Streptomyces fragilis NRRL 2424 (T) 16S ribosomal RNA gene, partial sequence
Oligo
(AY999917)
712 93%
Streptomyces viridochromogenes NBRC3113T(AB184728)
65 Streptomyces pactum NBRC13433T(AB184398)
Streptomyces violascens ISP 5183T(AY999737)
Streptomyces nogalater JCM 4799T(AB045886)
Streptomyces fumanus NBRC13042T(AB184273)
48 Streptomyces viridiviolaceus NBRC13359T(AB184350)
Streptomyces spiralis NBRC14215T(AB184575)
2
Streptomyces niveoruber NBRC 15428T(AB184675)
42
53
Streptomyces diastaticus subsp.ardesiacusNRRLB-1773T(DQ026631)
4 Streptomyces naganishii NBRC12892T(AB184224)
Streptomyces coeruleofuscus NBRC12757T(AB184840)
11
Streptomyces cinereospinus NBRC15397T(AB184648)
Streptomyces spinoverrucosus NBRC14228T(AB184578)
1Streptomyces fragilis NRRL2424T(AY999917)
Streptomyces hyderabadensis OU-40T(FM998652)
Figure 2: Colonies of Azotobacter spp. on nitrogen free glucose agar.
OLIGO
0.005
Figure 5: Identification report by 16S rRNA gene sequencing approach.
Reagents required
Volume required
ddH2O
12.0 μl
10X PCR buffer
2.0 μl
dNTPs
2.0 μl
Forward primer
0.4 μl
Reverse primer
0.4 μl
Taq DNA Polymerase
2.0 μl
Template DNA
3.0 μl
Total volume
20.0 μl
Table 1: PCR reaction mixture set up.
Figure 3: Few colonies of Azotobacter spp. transferred to 1:1000,
1:2000 dilutions of medium-no growth.
results. Standardization of this biofertilizer is being done. One isolate
was given to Agharkar research institute, Pune for identification by 16S
r RNA method and the isolate has been identified as follows.
Identification of strain by 16SrRNA gene sequencing was shown
in figure 2.
The cultural sample was processed for identification in the
following manner –
1. Genomic DNA was isolated from the culture by using Sigma’s,
“GenElute Bacterial Genomic DNA” Kit.
2. PCR was carried out using the following combination of primers
–
1:1000 SOIL
FDD2 – RPP2 (universal primers for 1.5 kb fragment
amplification for eubacteria)
1:1000 AIR
INCUBATED FOR 5 DAYS AT ROOM TEMPERATURE
Template DNA – Genomic DNA
Figure 4: Colonies of Oligophilic Bacteria on 1:1000 Diluted Nitrogen
Free Glucose Agar.
Sequences of the primer pair used for amplification RPP2 – CCAAGCTTCTAGACGGITACCTTGTTACGACTT
Volume 1 • Issue 12 • 2012
Citation: Pathak L, Kalekar S (2012) Exploring Nitrogen Fixing, Chemo heterotrophic Oligophiles from Natural Habitats for Preparing Biofertilizers.
1:555 doi:10.4172/scientificreports.555
Page 3 of 3
FDD2 – CCGGATCCGTCGACAGAGTTTGATCITGGCTCAG
The PCR reaction mixture was presented in table 1.
3. The PCR products obtained from above reactions were then
processed for Cycle sequencing reaction (PCR performed using
only one primer – SRV3-1)
4. Following the above reaction, the samples were cleaned up and
loaded on the sequencer. (Avant 3100 Gene Analyser)
Future Prospects
• Large scale production and field trials of the product will be taken.
• Development of genetic recombinant of Azotobacetr and an
oligophile can be tried.
References
1. Subba Rao NS (1988) Biofertilizers in agriculture 2nd edition-Oxford & IBH
publishing co. pvt.ltd (pg 194)
2. Watve MG, Shejwal V, Sonawane C, Rahalkar M, Matapurkar A, et al. (2000)
The ‘k’ selected oligophilic bacteria: a key to uncultured diversity? Current
science 78: 1535-1542.
3. Nagarkar PP, Ravetkar SD, Watve MG (2001) Oligophilic bacteria as tools to
monitor aseptic pharmaceutical production units. Appl Environ Microbiol 67:
1371-1374.
Volume 1 • Issue 12 • 2012