Download Differential Enzyme Targeting As an Evolutionary Adaptation to

Differential Enzyme Targeting As an Evolutionary Adaptation to
Herbivory in Carnivora
Graeme M. Birdsey,* Jackie Lewin, Andrew A. Cunningham,à
Michael W. Bruford,§ and Christopher J. Danpure*
*Department of Biology, University College London, EM Unit, Royal Free and University College Medical School,
àInstitute of Zoology, London, UK; §Cardiff School of Biosciences, Cardiff University, Cardiff, UK
Not all members of the order Carnivora are carnivorous. Some are omnivorous, and a few, such as the giant panda,
Ailuropoda melanoleuca, are almost exclusively herbivorous. Although a number of adaptations to increased plant-eating
are recognized within Carnivora, few have been studied at the molecular level. One molecular adaptation to diet that is
spread widely across Mammalia is the differential intracellular targeting of the intermediary metabolic enzyme
alanine:glyoxylate aminotransferase (AGT), which tends to be mitochondrial in carnivores, peroxisomal in herbivores,
and both mitochondrial and peroxisomal in omnivores. In the present study, we have analyzed the targeting of AGT in
Carnivora in relation to species’ natural diets. We show not only that there has been an adaptive shift in AGT targeting
from the mitochondrion toward the peroxisome as diets have shifted from being mainly carnivorous to ones that are more
omnivorous and herbivorous but also that in one lineage, namely that of the giant panda, there is evidence for positive
selection pressure at the molecular level on the AGT mitochondrial targeting sequence to decrease its efficiency, thereby
allowing more AGT to be targeted to the peroxisomes.
Introduction
The subcellular distribution of the intermediary metabolic enzyme alanine:glyoxylate aminotransferase (AGT)
has changed on numerous occasions during the evolution of
mammals, apparently under the influence of dietary selection pressure. There is a tendency for AGT to be mitochondrial in carnivores (including insectivores), peroxisomal in
herbivores, and both mitochondrial and peroxisomal in
omnivores (Danpure et al. 1990,1994). AGT catalyses the
detoxification of the intermediary metabolite glyoxylate to
glycine, preventing it from being oxidized to oxalate. Too
much oxalate can be life threatening because its calcium salt
is poorly soluble and readily crystallizes out in the kidney
and urinary tract, causing blockages and organ failure
(Danpure and Smith 1996). For glyoxylate detoxification
to be efficient, AGT must be concentrated at the site of
glyoxylate synthesis. This is likely to be different in carnivores and herbivores because the main dietary precursor of
glyoxylate in herbivores is thought to be glycolate, which is
metabolized to glyoxylate in the peroxisomes (Noguchi
1987), whereas in carnivores it is more likely to be hydroxyproline that is converted to glyoxylate in the mitochondria
(Takayama et al. 2003). The best evidence that the correct
subcellular distribution of AGT is important in at least some
species comes from the potentially lethal human hereditary
kidney stone disease primary hyperoxaluria type 1 (PH1)
(Danpure 2001). Although in most normal humans AGT is
peroxisomal, in many PH1 patients AGT is mistargeted to
the mitochondria (Danpure et al. 1989). Mistargeted AGT
remains catalytically active but is unable to fulfill its metabolic role of glyoxylate detoxification efficiently. As a result,
oxalate synthesis increases and calcium oxalate crystallizes
out, usually as stones, in the kidney and urinary tract.
Key words: molecular adaptation, alanine:glyoxylate aminotransferase, dietary selection pressure, protein targeting, mitochondria,
peroxisomes.
E-mail: [email protected].
Mol. Biol. Evol. 21(4):632–646. 2004
DOI: 10.1093/molbev/msh054 Advance Access publication January 22, 2004
Molecular Biology and Evolution, Vol. 21, No. 4,
Ó Society for Molecular Biology and Evolution 2004; all rights reserved.
632
The single-copy AGT gene has the potential to encode
a cleavable N-terminal mitochondrial targeting sequence
(MTS) and a C-terminal type 1 peroxisomal targeting
sequence (PTS1) by the variable use of two transcription
and two translation initiation sites (see figure 3A) (Oda,
Funai, and Ichiyama 1990; Oatey, Lumb, and Danpure
1996; Danpure 1997). In many species in which AGT is
entirely peroxisomal (e.g., human, rabbit, and guinea pig)
translation start site 1 has been lost during evolution
(Takada et al. 1990; Purdue, Lumb, and Danpure 1992;
Birdsey and Danpure 1998), whereas AGT in the cat is
almost entirely mitochondrial because of absence of the
second transcription start site (Lumb, Purdue, and Danpure
1994). Species that retain both translation and transcription
start sites, such as the rat (Oda, Funai, and Ichiyama 1990)
and the marmoset (Purdue, Lumb, and Danpure 1992),
retain the potential to target AGT to both organelles. The
final intracellular destination of AGT is dependent on the
expression of the MTS rather than that of the PTS1, with
the former being functionally dominant over the latter
(Oatey, Lumb, and Danpure 1996). Thus, a decrease in
mitochondrial targeting can lead to an increase in
peroxisomal targeting.
The only group of mammals in which the evolutionary biology, as opposed to the cell or molecular biology, of
AGT targeting has been studied in detail is the Anthropoidea suborder of Primates. Analysis of seven Catarrhini
and six Platyrrhini suggested that there was negative
selection pressure to conserve the functioning of the MTS
in their early evolutionary history but positive selection
pressure to diminish or abolish its function in many later
branches (Holbrook et al. 2000). Despite the fact that the
diets of many extant Primates are not particularly extreme
or specialized, most being opportunistic omnivores, the
changes to the MTS could be related to a general
evolutionary trend of increasing body size and adaptation
to diets that were less carnivorous/insectivorous to ones
that were more frugivorous and folivorous.
Unlike Primates, extreme differences in diet can be
found in other mammalian orders such as Carnivora.
Molecular Adaptation of AGT Targeting in Carnivora 633
Although most members of the Carnivora are carnivorous,
some are omnivorous, and a few, such as the giant panda,
are almost entirely herbivorous (Nowak 1991). In the
present study, we have investigated whether the evolution
of plant-eating in the Carnivora has been accompanied by
specific changes to AGT targeting similar to those found in
Primates, and whether any changes have resulted from
positive evolutionary selection pressure at the molecular
level. We have determined the subcellular distribution of
AGT in 23 members of Carnivora and analyzed the 59
region of the AGT gene (including both translation start
sites and the region encoding the MTS) in seven members
with carnivorous, omnivorous, and herbivorous diets.
Materials and Methods
Animals
The following members of Carnivora were investigated or discussed in this study: polecat ferret (Mustela
putorius furo), oriental small-clawed otter (Amblonyx
cinereus), Chinese ferret badger (Melogale moschata),
hog badger (Arctonyx collaris), domestic dog (Canis
familiaris), African hunting dog (Lycaon pictus), raccoon
dog (Nyctereutes procyonoides), domestic cat (Felis
catus), ocelot (Felis pardalis), clouded leopard (Neofelis
nebulosa), Persian leopard (Panthera pardus saxicolor),
Asiatic lion (Panthera leo persica), Sumatran tiger
(Panthera tigris sumatrae), small-toothed palm civet
(Arctogalidia trivirgata), slender-tailed meerkat (Suricata
suricatta), binturong (Arctictis binturong), blotched genet
(Genetta tigrina), mongoose (Herpestes urva), brown bear
(Ursus arctos), giant panda (Ailuropoda melanoleuca),
sloth bear (Melursus ursinus), raccoon (Procyon lotor),
coati (Nasua narica), red panda (Ailurus fulgens),
California sea lion (Zalophus californianus), and grey
seal (Halichoerus grypus).
Frozen blood samples for DNA extraction were
obtained from the Zoobank in the Institute of Zoology,
London, UK. Liver samples for immunoelectron microscopy were obtained from the pathology tissue archive,
Zoological Society of London. Additional samples of giant
panda liver were kindly provided by Richard Montali,
National Zoological Park, Washington D.C. Samples of
tissue were taken at routine necroscopy of animals that had
been found dead or from animals shortly after they had
been euthanased on humane grounds.
Immunoelectron Microscopy
Analysis of the intracellular compartmentalization of
immunoreactive AGT was determined by immunoelectron
microscopy (Cooper et al. 1988; Danpure et al. 1989). In
many instances, fresh glutaraldehyde-fixed liver was not
available. On these occasions, we made use of the Institute
of Zoology’s extensive archived collection of formalinfixed wax-embedded liver samples, which were reprocessed as described previously (Lewin et al. 1995). Liver
sections were either immunolabelled singly for AGT using
10 nm gold conjugated goat anti-rabbit IgG, or doubleimmunolabelled for AGT (10 nm gold) followed by the
peroxisomal marker catalase (20 nm gold) or the mitochon-
drial marker (organelle-specific mitochondrial antigens
prepared from homogenized purified rat liver mitochondria)
(20 nm gold). As quantitative morphometry was not
possible on inevitably scarce and non-ideally fixed specimens, we used the relative number of gold particles per
organelle to categorize the distribution of AGT between
mitochondria and peroxisomes. If the ratio of the gold
labeling density per mitochondrion to that per peroxisome,
in specimens singly immunolabeled for AGT, was greater
than the arbitrarily chosen value of 10, then the AGT
distribution was defined as mitochondrial. If the reverse
pertained, then AGT was defined as being peroxisomal.
Labeling ratios in between these two extremes led to the
distribution being defined as mitochondrial þ peroxisomal.
Molecular Biology
To obtain species-specific AGT sequence, PCR
amplification of genomic DNA from California sea lion,
grey seal, brown bear, sloth bear, and giant panda was
carried out using degenerate primers P1-CTSMTGYTDGGBCCBGGHCCYTC and P2-CAGBGTGAGBGGGTTCCTGGTCTGGAA that mapped to conserved regions
of AGT exons 1 and 2, respectively. Rapid amplification
of genomic ends (RAGE) was used to amplify 59-AGT
genomic sequence containing both of the potential translation initiation sites, as described previously (Mizobuchi
and Frohman 1993; Birdsey and Danpure 1998). Briefly,
genomic DNA from selected Carnivora was digested with
either restriction enzyme BamHI, EcoRI, or HindIII
(Promega). Plasmid pBluescript KSþ (Stratagene) was
digested with the same enzymes and then dephosphorylated with calf intestinal alkaline phosphatase (Promega).
Digested genomic DNA and plasmid DNA were ligated
with T4 DNA ligase (Promega). PCR amplification was
carried out using the AGT-specific primer P2 and a vector
primer P3-GATGTGTGCAAGGCGATTAAGTTGGT. A
second round of PCR amplification was performed using
0.1% of the first amplification products with a nested
vector primer P4-CAGGGTTTCCCAGTCACGACGTTT
and a nested AGT-specific primer P5-GGCCTACYGGAACATCTCYTTGTG. The final RAGE products were
gel purified and cloned into pGEM T-Easy vector
(Promega), before sequencing.
To analyze the efficiency of mitochondrial import,
various AGT N-terminal MTS-GFP fusions were constructed for expression studies in tissue culture cells. PCR
was used to amplify the 59 region of the AGT gene flanking
the MTS. PCR amplification was carried out on genomic
DNA using the primer pairs P6-ACGTAAGCTTACAAGGCCCCCTGGGAAATG and P7-ACGTGGATCCGGCCCGCACCCCACCTACCAC (giant panda) and P6 and
P8-ACGTGGATCCGGTCCGCACCCAACCTGCC (sloth
bear) and carried out on cDNA clones using P9-ACGTAAGCTTAGGCCAGCTGGGAAATGTTCC and P10CGAGGATCCGGCCTGCCCACCGGCCAC (domestic
cat [Lumb, Purdue, and Danpure 1994]) and P11-ACGAAGCTTAGCTCCGGGAATGTTCC and P12-CGAGGATCCGGCTCACCCACCTGCCGC (olive baboon [Holbrook
et al. 2000]). PCR products were gel purified and cloned
into the HindIII /BamHI sites of pEGFP-N3 (Clontech).
634 Birdsey et al.
Cell Culture, Transfection, and Confocal Microscopy
SV40-transformed monkey kidney cells (COS1a)
were grown on glass coverslips in Dulbecco’s modified
Eagle’s medium (Invitrogen), supplemented with 10%
fetal calf serum at 378C under 5% CO2. Cells were transfected with the MTS-GFP fusion constructs using Superfect (Qiagen), according to the manufacturer’s instructions.
Two days after transfection, the cells were washed in
phosphate-buffered saline and stained with the autofluorescent vital dye MitoTracker (Molecular Probes, Cambridge Bioscience). The cells were then fixed in freshly
prepared 3% (w/v) paraformaldehyde for 15 min at room
temperature, followed by permeabilization with 1% Triton
X-100 for 15 min at room temperature. The cover slips
were mounted onto glass slides in Mowiol (Harlow
Chemical Co. Ltd) containing diazabicyclo[2,2,2]octane
(DABCO, Sigma). The autofluorescent staining pattern of
GFP and MitoTracker was visualized in a BioRad
MRC1024 confocal laser-scanning microscope and the
images were digitally recorded.
Data Analysis
Nucleotide sequences were aligned using ClustalW
version 1.7 (Thompson, Higgins, and Gibson 1994).
Reconstruction of ancestral sequences was carried out by
codon-based maximum-likelihood analysis using marginal
reconstruction of ancestral sequences (Yang, Kumar, and
Nei 1995). Estimation of the dN/dS(x) among lineages was
calculated by the maximum-likelihood method (Yang
1998) using the computer software package PAML
version 3.13a (Yang 1997). In all analyses, the codon
frequencies were calculated from the average nucleotide
frequencies (F1X4), and the transition/transversion rate
ratio (kappa) was fixed at 1. Likelihood ratio tests were
used to compare models, with the v2 distribution used as
an approximation. Computer prediction of the targeting
efficiency of AGT MTSs was carried out using PSORT
(Nakai and Horton 1999).
Results
We determined the subcellular distribution of AGT
using immunoelectron microscopy on liver sections from
20 species from the order Carnivora (figs. 1 and 2A). These
results, together with those already known for the domestic
cat, domestic dog, and polecat ferret (Danpure et al. 1994),
were compared with their natural diets (fig. 2A and B). Of
the 13 species classified as mainly or entirely carnivorous,
all but one (mongoose) had AGT mainly or exclusively in
the mitochondria (fig. 1A and B). At the other extreme, all
three mainly herbivorous species (coati, red panda, and
giant panda) had AGT in both mitochondria and
peroxisomes (figs. 1C, 1D, and 2A). In all but two of the
eight species categorized as omnivorous, AGT was also
both mitochondrial and peroxisomal. Although the distribution of AGT was invariant in some families, such as
Canidae and Felidae (mitochondrial) and Procyonidae
(mitochondrial and peroxisomal), in others, such as
Mustelidae (mitochondrial or mitochondrial and peroxisomal), it was variable. Unlike many members of other
orders (Danpure et al. 1994), in no cases were any
Carnivora found to have only peroxisomal AGT. Nevertheless, there was a clearly identifiable trend in which
carnivorous Carnivora were more likely to have mitochondrial AGT, whereas omnivorous and herbivorous
Carnivora were more likely to have both mitochondrial
and peroxisomal AGT (fig. 2B).
To determine the molecular basis for the changes in
AGT distribution in Carnivora, we analyzed the AGT gene
from seven species: domestic cat (Felis catus), blotched
genet (Genetta tigrina), California sea lion (Zalophus
californianus), grey seal (Halichoerus grypus), brown bear
(Ursus arctos), sloth bear (Melursus ursinus), and giant
panda (Ailuropoda melanoleuca). Using genomic DNA as
template, the 59 region of AGT was amplified by PCR and
RAGE (Mizobuchi and Frohman 1993) (with the exception of the domestic cat, the cDNA of which had
previously been cloned [Lumb, Purdue, and Danpure
1994]). The amplified region included all the sequence
from exon 1 and most or all of the 59 UTR (see fig. 3A).
Analysis of the sequences revealed the presence of both
ancestral translation start sites (1 and 2 in figure 3A) in all
seven species, as predicted from the observation that at
least some AGT is mitochondrial in all cases. An
alignment (fig. 3B) of the 55–amino acid sequence encoded
by exon 1 downstream of, and including, the second
translation start site revealed a high degree of conservation
with an 84% sequence identity across all seven species. In
contrast, a similar analysis of the 22–amino acid sequence
(19 amino acids in the sloth bear) with potential to encode
the MTS (i.e., the region upstream of the second
translation start site) showed only 50% amino acid
identity. Such low conservation is unsurprising as MTSs
are defined more by their three-dimensional structure
(positively-charged amphiphilic a-helices [von Heijne
1986]) than by any particular consensus sequence.
To determine the number of changes that have
occurred to the MTS during the evolution of Carnivora
and their temporal relationships, we used a codon-based
maximum-likelihood analysis (Yang, Kumar, and Nei
1995) to reconstruct ancestral sequences (fig. 4A). The
accuracy of the reconstruction was maximized by the
inclusion of the N-terminal sequences of 24 additional
mammals, including those from the Anthropoidea previously analyzed (Holbrook et al. 2000) and a variety of
others, both published and unpublished (see legend to
figure 4A for details). In the Carnivora, by far the most
amino acid substitutions occurred in the most recent
branch leading to the giant panda. A third (7/22) of the
amino acids comprising the MTS had changed in this one
branch. Many of the changes in the giant panda MTS are
predicted to decrease the effectiveness of the MTS by
decreasing its helix-forming potential and decreasing its
positive charge. Other branches have far fewer or no
amino acid changes and, with the exception of the sloth
bear, are not predicted to have any influence on the
effectiveness of the MTS. The sloth bear lineage is unusual
in that there has been a loss of three adjacent amino acids,
the consequences of which are less predictable. Analysis
of the MTS region using the PSORT computer program
(Nakai and Horton 1999) predicts that the MTS of the
Molecular Adaptation of AGT Targeting in Carnivora 635
FIG. 1.—Dietary dependence of AGT distribution in the livers of Carnivora. Subcellular distribution of AGT was determined by immunoelectron
microscopy in liver sections obtained from necroscopy specimens from (A) oriental small-clawed otter (carnivore), (B) blotched genet (carnivore), (C)
red panda (herbivore-omnivore), and (D) giant panda (herbivore). In A, B, C, and D1, the specimens were singly labeled for AGT (10 nm gold). In D2,
the specimen was doubly immunolabeled for AGT (10 nm gold) and the peroxisomal marker catalase (20 nm). In D3, the specimen was doubly
immunolabeled for AGT (10 nm gold) and organelle-specific mitochondrial antigens (20 nm). M ¼ mitochondrion, P ¼ peroxisome. The number in
brackets after M or P indicates the number of 10 nm gold particles located in the cross-sectional profile of that organelle (for comparative purposes
only). For the giant panda (D) the areas indicated by the rectangles in the upper images are magnified to give the lower images. Size bars ¼ 200 nm. Such
immunolabeling shows that AGT is mitochondrial in the carnivores (A and B) but both peroxisomal and mitochondrial in the herbivores (C and D).
giant panda and the sloth bear should be very weak,
whereas that of the blotched genet, domestic cat, brown
bear, grey seal, and California sea lion should be strong
(fig. 6A). Interestingly, the PSORT prediction of the
reconstructed ancestral mammalian MTS (fig. 4A) suggested that it would have a lower mitochondrial targeting
efficiency than the MTS of the ancestral Carnivora (1.09
compared to 1.49, respectively).
Ancestral reconstruction of exon 1 sequence downstream of the MTS in the Carnivora (fig. 4B) showed a very
different picture to that found in the MTS region. Although
several amino acid changes were identified in a number of
branches, the most recent branch leading to the giant panda
contained no changes at all, even though this region
contained 55 amino acids (compared to 22 amino acids in
the MTS region).
Amino acid changes in the MTS region could be
neutral or an adaptive response to selection pressure to
change AGT distribution. Using a maximum-likelihood
method (Yang 1998), we have determined the relative
number of nonsynonymous differences per nonsynonymous site (dN) compared with the number of synonymous
differences per synonymous site (dS) in the region with
potential to encode a MTS and downstream of this region.
The dN/dS ratio (x) provides a measure of the selection
pressure acting on genes or parts of genes. Thus, dN/dS ,
1 suggests that there has been negative selection pressure
(i.e., pressure for conservation), dN/dS . 1 suggests that
636 Birdsey et al.
FIG. 2.—AGT distribution in Carnivora is related to diet. (A) Phylogenetic tree (Bininda-Emonds, Gittleman, and Purvis 1999) of 26 members of
Carnivora showing natural diet (Carniv ¼ carnivorous, Omniv ¼ omnivorous, Herbiv ¼ herbivorous, Carniv-Omniv ¼ mainly carnivorous, but some
plant material eaten, Herbiv-Omniv ¼ mainly herbivorous, but some animal material eaten) and the subcellular distribution of AGT in liver cells (M ¼
mitochondrial, MþP ¼ mitochondrial plus peroxisomal, ? ¼ unknown). (B) Relationship between natural diet and intracellular compartmentalization of
AGT in Carnivora. All positions within any one box are equivalent. Numbering is the same as for figure 2A. As no members of Carnivora have yet been
categorized as having only peroxisomal AGT, a few species from other orders have been included for comparison. Herbiv ¼ herbivorous, Omniv ¼
omnivorous, Carniv ¼ carnivorous.
there has been positive selection pressure (i.e., pressure for
change), and dN/dS ¼ 1 suggests that the region is neutral
(i.e., no selection pressure). When comparing the MTS
region in the seven Carnivora (fig. 5A), we find that out of
the branches where dS 6¼ 0, dN/dS . 1 in only one (i.e., the
most recent branch leading to the giant panda). In all other
branches where dS 6¼ 0, dN/dS , 1. In the one other
Carnivora branch where dN/dS . 1 (i.e., branch 10), there
has been one nonsynonomous substitution and no synonomous substitutions, giving dN/dS ¼ ‘. The significance
Molecular Adaptation of AGT Targeting in Carnivora 637
FIG. 3.—(A) Diagrammatic structure of the archetypal mammalian AGT gene. Ancestral translation start sites 1 and 2 and transcription start sites A
and B, are indicated. The region encoding the MTS (between translation start sites 1 and 2) and the PTS1 are shown. (B) Deduced amino acid sequences
encoded by the 59 region of the AGT gene in various Carnivora. In the aligned sequences, asterisks denote residues identical between all species. The
amino acids encoded by the two translation sites are indicated in bold.
of this observation is unclear and may be caused by
a threshold effect associated with the comparison of short
sequences (see Holbrook et al. [2000]).
To determine whether the dN/dS ratio in the lineage
leading to the giant panda was significantly different (i.e.,
greater) than in other Carnivora lineages, the Carnivora
data set was fitted to various models of sequence evolution.
The models were compared by the likelihood ratio test
using the v2 approximation (Yang 1998). The ‘‘one-ratio’’
model (which assumes the same ratio for all branches in
the phylogeny) was compared with the ‘‘two-ratio’’ model
(which assumes that the branch of interest has a dN/dS ratio
that is different from the background ratio). The loglikelihood value from the two-ratio model is l1 ¼191.89.
The log-likelihood value obtained under the one-ratio
model is l0 ¼194.11. Twice the log-likelihood difference,
2l ¼ (l1 l0), can be compared with a v2 distribution to
test whether the two-ratio model fits the data significantly
!
FIG. 4.—Ancestral reconstruction of the amino acid substitutions in the N-terminus of mammalian AGT. Reconstructions were carried out using
a codon-based maximum-likelihood analysis (Yang, Kumar, and Nei 1995). The phylogenetic tree is based on that of Springer et al. (2003) and includes
all mammalian species (31 in total) in which the N-terminal sequence of AGT is known. The branches are arbitrarily labeled 1 to 59. (A) MTS region;
(B) exon 1 downstream of the MTS region. The ancestral node is indicated by the closed circle and the calculated ancestral sequence is indicated to the
left of the tree. The amino acid substitutions are shown along each branch. The asterisk (*) in branch 34 (slow loris) in (A) indicates an insertion of R
between residues 3 and 4. In addition to the seven members of Carnivora, the following species are also shown on the tree: brown big-eared bat
(Plecotus auritus), domestic cow (Bos taurus), pigmy hippopotamus (Hexaprotodon liberiensis), harbor porpoise (Phocena phocoena), killer whale
(Orcinus orca), Przewalski’s horse (Equus caballus przewalskii), European rabbit (Oryctolagus cuniculus), guinea pig (Cavia porcellus), Norway rat
(Rattus norvegicus), house mouse (Mus musculus), slow loris (Nycticebus coucang), white-handed gibbon (Hylobates lar), common gorilla (Gorilla
gorilla), human (Homo sapiens), chimpanzee (Pan troglodytes), Diana monkey (Cercopithecus diana), olive baboon (Papio anubis), celebes macaque
(Macaca nigra), squirrel monkey (Saimiri sciureus), Goeldi’s monkey (Callimico goeldii), golden lion tamarin (Leontopithecus rosalia), common
marmoset (Callithrix jacchus), white-faced saki monkey (Pithecia pithecia), and black spider monkey (Ateles paniscus). The N-terminal AGT
sequences used in the PAML analysis were obtained from the following sources: cow (Takasuga et al. 2001), rabbit (Purdue, Lumb, and Danpure
1992), cat (Lumb, Purdue, and Danpure 1994), guinea pig (Birdsey and Danpure 1998), rat (Oda et al. 1987), mouse (Li, Salido, and Shapiro 1999), and
Primates (Holbrook et al. 2000). The remaining sequences were obtained from genomic DNA using the RAGE technique (see Materials and Methods).
Accession numbers for the unpublished AGT sequences are listed as Supplementary Material. The Carnivora analyzed as part of the present study and
the Anthropoidea analyzed previously by Holbrook et al. (2000) are boxed in gray. In (A), branches containing loss of translation start site 1 are dashed,
to indicate that at some point along the branch, the MTS would have been excluded from the open reading frame.
638 Birdsey et al.
Molecular Adaptation of AGT Targeting in Carnivora 639
FIG. 4. (Continued).
640 Birdsey et al.
better than the one-ratio model. The test statistic 2l ¼
4.44 has a P value of 0.035, which indicates that the dN/dS
ratio for the MTS region in the branch leading to the giant
panda is significantly greater than that found in other
Carnivora branches of the tree.
To test whether the dN/dS ratio for the giant panda
lineage (x1) was significantly greater than 1, a likelihood
ratio test was carried out on the Carnivora data set using
the two-ratio model with and without x1 fixed at 1. The
log-likelihood value obtained when x1 was estimated by
maximum likelihood is l1 ¼ 191.89, compared with
a value of l0 ¼ 192.66 when x1 ¼ 1. The test statistic
2l ¼ 1.54 with P ¼ 0.215 indicates that the difference
between the two models was not significant. Notwithstanding this latter result, which in itself is not incompatible with the existence of positive selection
pressure (Yang 1998), all the data taken together are
compatible with the suggestion that, within Carnivora,
there has been positive selection pressure to alter the MTS
in the giant panda lineage. In constrast, evolution of this
region in most other Carnivora lineages appears to have
been subjected to negative selection pressure (i.e, pressure
to maintain its function as a MTS). Although not part of
the present study, it is interesting to note that analysis of
the dN/dS ratio in a number of other mammalian lineages
also show some branches with x greater than 1 (fig. 5A).
This would be compatible with episodic adaptive evolution
of the MTS of AGT across Mammalia, similar to that
identified in primate lysozymes (Messier and Stewart
1997). When the rest of exon 1 (i.e., downstream of the
MTS) is compared in the different Carnivora species,
a rather different picture emerges. In this region dN/dS , 1
in all branches in which dS 6¼ 0 (fig. 5B). Of particular note is
the fact that the giant panda branch contains no nonsynonymous mutations, and only one synonymous mutation, in this region of 165 nucleotides (55 amino acids),
whereas there were seven nonsynonymous changes in the
MTS region of 66 nucleotides (22 amino acids) (see above).
Although the effectiveness of the MTSs of the giant
panda and the sloth bear were predicted to be much less
than those of the more-carnivorous species, such as the
domestic cat and blotched genet, using the PSORT computer program (fig. 6A), a direct measurement of their
strength was made using a mitochondrial-reporter protein
import assay in tissue culture cells. Constructs containing
the MTS from different species (domestic cat, sloth bear,
and giant panda) were attached to the N-terminus of green
fluorescent protein (GFP) and transiently expressed in
COS1a tissue culture cells. The targeting of the fusion
constructs was determined by confocal fluorescence microscopy (fig. 6B–F). GFP alone and GFP fused to the
‘‘MTS’’ of baboon (Papio anubis) AGT (Holbrook et al.
2000), which has previously been shown not to target to
mitochondria (Danpure et al. 1990) and which has no
features of an MTS as determined by the PSORT program
(fig. 6A), were used as negative controls. In the absence of
any mitochondrial targeting, GFP and baboon MTS-GFP
were diffusely distributed across the cytosol and nucleus,
as is frequently found in nontargeted GFP constructs
(Lumb, Drake, and Danpure 1999) (see also http://www.
clontech.com/techinfo/faqs/LivingColors/general.shtml).
In contrast, the MTS of domestic cat AGT was very
efficient at targeting GFP, all of which appeared to be
mitochondrial, as shown by the yellow colocalization of
GFP with the mitochondrial marker MitoTracker and the
absence of any GFP in the cytosol or nucleus (fig. 6D).
However, the ability of the MTSs of sloth bear and giant
panda to target GFP fusions to mitochondria was much
less (fig. 6E and F). In both cases, although some
mitochondrial localization of the fusion proteins was
observed, most failed to target and was cytosolic and
nuclear. These targeting studies are compatible with the
predictions of the PSORT analysis, that the mutations that
occur in the MTS of sloth bear and giant panda decrease its
effectiveness. At least in the case of the giant panda, this
finding is entirely compatible with the previous evidence
!
FIG. 5.—Nonsynonymous/synonymous substitution ratios (dN/dS) among lineages in the 59-region of the AGT gene in mammals. The phylogenetic
trees were derived from that of Springer et al. (2003) using the PAML program (see Material and Methods) and drawn using the TREEVIEW program
(Page 1996). The branch lengths and the dN/dS ratios were calculated using the free-ratios model (Yang 1998). The apparent loss of some branches
results from the fact that in some cases dN ¼ dS ¼ 0, so that the branch length is zero. (A) MTS region; (B) exon 1 downstream of the MTS. The animals
studied and their sources are described in the legend to figure 4. The Carnivora analyzed as part of the present study and the Anthropoidea analyzed
previously by Holbrook et al. (2000) are boxed in gray. Branches in which dN/dS . 1 are shown by the use of thick lines. In (A), branches containing
loss of translation start site 1 are dashed, to indicate that at some point along the branch, the MTS would have been excluded from the open reading
frame. In branches where dN/dS . 1, the ratio is shown above the branch. An asterisk (*) indicates that dS ¼ 0, so that dN/dS ¼ ‘. The calculated dN/dS
ratios (dN, dS) along the various branches are as follows: MTS (A) 1 ¼ 0.021 (dN), 0.106 (dS); 2 ¼ 0, 0; 3 ¼ 0.02, 0.05; 4 ¼ 0, 0; 5 ¼ 0, 0; 6 ¼ 0.165,
0.051; 7 ¼ 0, 0; 8 ¼ 0, 0.056; 9 ¼ 0, 0; 10 ¼ 0.021, 0; 11 ¼ 0.043, 0.106; 12 ¼ 0.042, 0.109; 13 ¼ 0.034, 0.055; 14 ¼ 0.069, 0.327; 15 ¼ 0.006, 0.048; 16
¼ 0.077, 0.048; 17 ¼ 0.021, 0; 18 ¼ 0.113, 0.195; 19 ¼ 0, 0; 20 ¼ 0.051, 0.379; 21 ¼ 0, 0; 22 ¼ 0, 0; 23 ¼ 0.02, 0; 24 ¼ 0.122, 0.308; 25 ¼ 0.045, 0.05; 26
¼ 0, 0; 27 ¼ 0.247, 0.079; 28 ¼ 0, 0; 29 ¼ 0.181, 0.299; 30 ¼ 0.123, 0.39; 31 ¼ 0, 0; 32 ¼ 0.046, 0.204; 33 ¼ 0, 0.05; 34 ¼ 0.209, 0.158; 35 ¼ 0.022,
0.099; 36 ¼ 0.024, 0.051; 37 ¼ 0, 0; 38 ¼ 0.049, 0.045; 39 ¼ 0.05, 0.045; 40 ¼ 0.025, 0; 41 ¼ 0, 0; 42 ¼ 0, 0; 43 ¼ 0.026, 0; 44 ¼ 0.075, 0; 45 ¼ 0.101, 0;
46 ¼ 0, 0; 47 ¼ 0, 0; 48 ¼ 0, 0; 49 ¼ 0, 0.218; 50 ¼ 0, 0; 51 ¼ 0.076, 0; 52 ¼ 0, 0; 53 ¼ 0, 0.049; 54 ¼ 0, 0; 55 ¼ 0.05, 0; 56 ¼ 0, 0; 57 ¼ 0, 0; 58 ¼ 0.076,
0; 59 ¼ 0.051, 0. Exon 1 (B) 1 ¼ 0 (dN), 0.039 (dS); 2 ¼ 0, 0.032; 3 ¼ 0.009, 0.113; 4 ¼ 0, 0.115, 5 ¼ 0.009, 0.049; 6 ¼ 0, 0.022; 7 ¼ 0, 0; 8 ¼ 0.009, 0; 9
¼ 0.017, 0; 10 ¼ 0, 0.127; 11 ¼ 0.064, 0.129; 12 ¼ 0.009, 0.044; 13 ¼ 0, 0.063; 14 ¼ 0.042, 0.131; 15 ¼ 0, 0; 16 ¼ 0.056, 0.106; 17 ¼ 0.017, 0; 18 ¼
0.066, 0.092; 19 ¼ 0.013, 0.156; 20 ¼ 0.029, 0.134; 21 ¼ 0, 0; 22 ¼ 0, 0.071; 23 ¼ 0, 0.08; 24 ¼ 0.025, 0.176; 25 ¼ 0, 0; 26 ¼ 0, 0.014; 27 ¼ 0.067, 0.4;
28 ¼ 0, 0; 29 ¼ 0.042, 0.284; 30 ¼ 0.074, 1.23; 31 ¼ 0.039, 0.208; 32 ¼ 0, 0; 33 ¼ 0, 0.055; 34 ¼ 0.059, 0.161; 35 ¼ 0.05, 0.109; 36 ¼ 0.022, 0.079; 37 ¼
0.013, 0.022; 38 ¼ 0.026, 0.117; 39 ¼ 0.035, 0.037; 40 ¼ 0, 0; 41 ¼ 0, 0; 42 ¼ 0, 0; 43 ¼ 0, 0; 44 ¼ 0.043, 0; 45 ¼ 0.099, 0.087; 46 ¼ 0, 0.116; 47 ¼
0.018, 0.09; 48 ¼ 0.009, 0.038; 49 ¼ 0.016, 0.052; 50 ¼ 0, 0; 51 ¼ 0.051, 0.091; 52 ¼ 0.016, 0.057; 53 ¼ 0, 0.047; 54 ¼ 0, 0; 55 ¼ 0, 0; 56 ¼ 0.008,
0.126; 57 ¼ 0, 0.041; 58 ¼ 0.033, 0.06; 59 ¼ 0.096, 0.099. For the purposes of this analysis, the R inserted between residues 3 and 4 in the slow loris
MTS was removed and the alignment gap created by the deletion of residues F2, R3, and A4 in the sloth bear MTS was not taken into account. The
results of the analysis of Anthropoidea are slightly, but not significantly, different from those obtained by Holbrook et al. (2000). This is because of the
inclusion in the current, but not the previous, analysis of translation start site 1 and the need to change some of the program parameters to optimize the
analysis over many more species.
Molecular Adaptation of AGT Targeting in Carnivora 641
642 Birdsey et al.
FIG. 5. (Continued).
Molecular Adaptation of AGT Targeting in Carnivora 643
presented in this paper that positive selection pressure for
change has led to decreased mitochondrial targeting of
AGT and, hence, its increased peroxisomal targeting.
Although the subcellular distribution of AGT in the
sloth bear is currently unknown, the deletion of three
amino acids from the MTS and the inefficient mitochondrial import of the sloth bear MTS-GFP fusion protein are
suggestive of a similar AGT distribution to that seen in the
giant panda (i.e., mitochondrial and peroxisomal). The
extent to which this represents an adaptive response to the
unusual seasonally herbivorous diet of the sloth bear
(Nowak 1991; Joshi, Garshelis, and Smith 1997) remains
to be determined.
Discussion
In the present study, we have extended our analyses
of the adaptive evolution of AGT targeting in mammals
under the influence of dietary selection pressure, by
determining the subcellular distribution of AGT in the
livers of Carnivora, the members of which have extremely
divergent diets, ranging from absolute carnivory in lions
and tigers to absolute herbivory in the giant panda. In
addition, we have investigated the evolutionary changes to
the structure and function of the region of AGT known to
be responsible for its targeting to mitochondria (i.e., its Nterminus).
The results show that the distribution of AGT in
Carnivora is related to diet, as it is in Mammalia as a whole,
there being an adaptive shift in its distribution from
mitochondria to peroxisomes as diets change from being
more carnivorous to more herbivorous. Thus, in the most
carnivorous species, AGT is more likely to be entirely or
mainly mitochondrial, whereas in most omnivorous or
herbivorous species, AGT is more likely to be spread more
evenly between both mitochondria and peroxisomes.
Although, unlike many other mammals, no members of
Carnivora had exclusively peroxisomal AGT, the greatest
proportion of peroxisomal AGT was found in the most
herbivorous member of the order, the giant panda.
The results also show that the shift in AGT targeting
away from the mitochondria and toward the peroxisomes in
the giant panda is related to the accumulation of nonsynonymous mutations in the MTS that decrease its
efficiency compared with that in carnivorous Carnivora.
In addition, evidence is presented that the MTS in the most
recent lineage leading to the giant panda has been subjected
to positive selection pressure to change (i.e., to decrease its
efficiency), thereby allowing more AGT to be targeted to
the peroxisomes. This could have been a defining moment
in the evolution of the most herbivorous member of the
order, enabling the giant panda to detoxify glyoxylate
derived from plant-based oxalate precursors, such as
glycolate, with greater efficiency at the expense of a lower
efficiency for the detoxification of glyoxylate derived from
meat-based precursors, such as hydroxyproline.
AGT distribution has changed on numerous occasions during the evolution of mammals (see Introduction),
but only in the case of Primates has it been suggested to be
the result of positive selection pressure (Holbrook et al.
2000). Where a temporal trend can be discerned, the
change in AGT distribution in mammals is manifested by
an increase in peroxisomal AGT at the expense of
mitochondrial AGT. No clear-cut examples of the reverse
have yet been found. More particularly, once mitochondrial AGT targeting has been lost, it is unlikely to be
reacquired (one notable example where this is not the case
is found in humans homozygous for a normally occurring
Pro11 Leu polymorphism, which creates a weak MTS
sufficient to target approximately 5% of their AGT to
mitochondria (Danpure 1997)). This fits in with the
general trend away from carnivory and toward herbivory
that characterises mammalian evolution in many lineages.
Although there are similarities between the evolution
of AGT targeting in Carnivora and Primates (Holbrook
et al. 2000), there are significant differences too. These
differences may reflect differences in the nature of the
dietary selection pressure in the two orders. For example,
although there has been a general shift away from more
carnivorous/insectivorous diets toward more frugivorous/
folivorous diets in Primates, within Carnivora some
lineages (e.g., giant panda) have moved in the direction
of herbivory, whereas others (e.g., lions, tigers etc) have
probably become more carnivorous relative to the ancestral
Carnivora. In this respect, it is interesting to note that the
PSORT mitochondrial targeting index of the reconstructed
ancestral AGT MTSs varies significantly. For example, the
PSORT indices for the MTS in the ancestral mammal
(sequence at the ancestral node in figure 4A), the ancestral
Carnivora (branch 13 in figure 4A), and the extant cat
(branch 11) are 1.09, 1.49, and 1.79, respectively. This is
compatible with increasing carnivory and increasing
mitochondrial AGT. The index for the brown bear at 1.49
might suggest a diet and AGT distribution similar to that of
the ancestral Carnivora. On the other hand, the index for the
giant panda at 1.24 is compatible with a diet much more
herbivorous than that of the ancestral Carnivora and much
more AGT in the peroxisomes.
As far as AGT targeting is concerned, the main
difference between Carnivora and Primates is that AGT is
either mitochondrial or mitochondrial þ peroxisomal in the
former, whereas it is either mitochondrial þ peroxisomal or
peroxisomal in the latter. AGT has yet to be found
exclusively in the peroxisomes in Carnivora or exclusively
in the mitochondria in Primates. Whether this is related to
the rarity of obligate herbivores in Carnivora and obligate
carnivores in Primates is unclear.
As far as the molecular basis of changes to AGT
targeting are concerned, the main difference between
Carnivora and Primates is that whereas mitochondrial
AGT targeting is diminished by the accumulation of mutations in the MTS that decrease its efficiency in the former,
mitochondrial targeting in Primates has been frequently
abolished by loss of translation start site 1 (see Introduction) and permanent exclusion of the MTS from the open
reading frame. There is evidence that in one Primate lineage
ancestral to the olive baboon and celebes macaque (branch
44 in figure 4A) mitochondrial AGT targeting has been lost
also by the accumulation of mutations in the MTS region,
as occurs in Carnivora (but see below).
Although the differential targeting of AGT between
mitochondria and peroxisomes is an unparalleled system
644 Birdsey et al.
FIG. 6.—Dietary selection pressure leads to the evolution of an inefficient MTS. (A) PSORT computer prediction scores indicate the relative
strength of the MTS from each animal, which are color-coded according to diet (carnivorous species are color-coded red, herbivorous species are green,
and omnivorous species are blue). The nonfunctional ‘‘MTS’’ from olive baboon AGT is included for comparison. (B–F) COS cells were transiently
transfected with various GFP constructs—GFP alone (B), baboon MTS-GFP (C), domestic cat MTS-GFP fusion (D), sloth bear MTS-GFP fusion (E),
and giant panda MTS-GFP fusion (F). GFP and baboon MTS-GFP were used as negative controls. GFP autofluorescence ¼ green, MitoTracker
(mitochondrial marker) ¼ red, colocalization ¼ yellow. All panels are at the same magnification. Bar ¼ 10 lm.
with which to study the ability of mammals, both extant and
ancestral, to adapt to changes in dietary selection pressure,
the system is not without its technical difficulties that, to
some extent, compromise its robustness. First, the sequence
responsible for mitochondrial targeting and subject to
dietary selection pressure is short (i.e., only 22 amino acids
in most mammals). Second, MTSs tend to be conserved
at the structural level (positively charged amphiphilic ahelices) rather than sequence level. This not only makes
long distance comparisons (e.g., between different phyla)
difficult because the sequences cannot be aligned, but also
means that the MTS sequence is less well conserved than
most of the rest of the protein, irrespective of any dietary
differences. Third, to act as a MTS, the region between
translation start sites 1 and 2 (see Introduction) must be
contained within the open reading frame. This means that
not only must translation start site 1 exist, but also
transcription start site A must exist. The former can be
determined by sequencing genomic DNA, but the latter can
only be determined by transcript mapping, a procedure that
requires fresh liver tissue. Although this is no problem with
laboratory species, such as the rat, mouse, cat, or even
human, it is difficult to obtain such material from wild
animals, even those in zoos. In the case of at least six
Primates (see figure 4A), it is clear that the MTS is excluded
from the open reading frame because the loss of translation
start site 1 simply by sequencing genomic DNA (Holbrook
et al. 2000). Equally, it is likely that in all the Carnivora
studied, the MTS is within the open reading frame, because
not only is translation start site 1 present but also AGT is at
least partly targeted to mitochondria in all cases. However,
in species where translation start site 1 is still present, yet
AGT is exclusively targeted to peroxisomes (e.g., as occurs
in the baboon), then difficulties can arise. It so happens that
in the case of the baboon its MTS does not work (see figure
6) whether it is in the open reading frame or not.
Because the present study is based on genomic DNA,
rather than cDNA, the big unknown is what is the relative
usage of transcription start sites A and B in the AGT gene
(see figure 3A) in the members of Carnivora and to what
extent this might influence the intracellular distribution of
AGT. The only information currently available comes from
studies on the domestic cat (Lumb, Purdue, and Danpure
1994), in which all transcripts initiate from site A, upstream
of both translation start sites 1 and 2. If this occurred
throughout Carnivora, then peroxisomal targeting of AGT
could be dependent either on leaky ribosome scanning
through translation start site 1, with subsequent translation
from start site 2 (see figure 3A), or by a functional
weakening of the MTS counteracting its hierarchical
dominance over the PTS1 (see Introduction). The molecular determinants of leaky ribosome scanning are unclear,
but they might be related to the degree of match of each
potential translation start site to the so-called Kozak
consensus sequence (Kozak 1986, 1989). In this respect it
is interesting to note that the Kozak sequence found at both
Molecular Adaptation of AGT Targeting in Carnivora 645
sites are very similar between the domestic cat and the giant
panda, even though the latter targets a greater proportion of
its AGT to peroxisomes than does the former. Evidence
presented above suggests that a functional weakening of the
MTS is the more likely explanation.
Molecular adaptation of many other genes to dietary
changes must have occurred during the evolution of
mammals. However, surprisingly few examples have been
demonstrated to result in functional changes to the gene
product or to be the result of positive selection pressure. A
notable and prototypical exception is that of lysozyme that
has evolved independently in langurs (Primates) and
Artiodactyla to survive the rigours of a nutritionally poor
folivorous diet and the necessity of foregut fermentation
(Stewart, Schilling, and Wilson 1987; Messier and Stewart
1997). Unlike lysozyme, however, the relationship between AGT distribution and diet is spread across many
orders of mammals. If the distribution of AGT is an
important determinant of an animal’s diet and if, as seems
likely, mitochondrial AGT targeting is more easily lost
than acquired, then it is not surprising that secondary
carnivory is a rare event in mammalian evolution.
Supplementary Material
The novel sequences discussed in this paper have
been submitted to the Nucleotide Sequence Database
under accession numbers AJ539309 (H. grypus.),
AJ539310 (Z. californianus), AJ539311 (A. melanoleuca),
AJ539312 (G. tigrina), AJ539313 (M. ursinus), AJ539314
(U. arctos), AJ567378 (P. auritus), AJ567379 (O. orca),
AJ567380 (E. przewalskii), AJ567381 (H. liberiensis),
AJ567382 (P. phocoena), and AJ567383 (N. coucang).
Acknowledgments
We thank Gemma Athorn for technical assistance.
Access to the Zoobank frozen tissue and blood archive was
arranged by Dada Gottelli, Institute of Zoology, London.
We thank Richard Montali, National Zoological Park,
Washington D.C. for providing samples of giant panda
liver. We are grateful to Ziheng Yang for help in using the
PAML program and to Andy Purvis for helpful discussions.
This work was supported by the Leverhulme Trust.
Literature Cited
Bininda-Emonds, O. R. P., J. L. Gittleman, and A. Purvis. 1999.
Building large trees by combining phylogenetic information:
a complete phylogeny of the extant Carnivora (Mammalia).
Biol. Rev. 74:143–175.
Birdsey, G. M. and C. J. Danpure. 1998. Evolution of
alanine:glyoxylate aminotransferase intracellular targeting.
Structural and functional analysis of the guinea pig gene.
Biochem. J. 331:49–60.
Cooper, P. J., C. J. Danpure, P. J. Wise, and K. M. Guttridge.
1988. Immunocytochemical localization of human hepatic
alanine: glyoxylate aminotransferase in control subjects and
patients with primary hyperoxaluria type 1. J. Histochem.
Cytochem. 36:1285–1294.
Danpure, C. J. 1997. Variable peroxisomal and mitochondrial
targeting of alanine: glyoxylate aminotransferase in mammalian evolution and disease. Bioessays 19:317–326.
———. 2001. Primary hyperoxaluria. Pp. 3323–3367 in C. R.
Scriver, A. L. Beaudet, W. S. Sly, D. Valle, B. Childs, K. W.
Kinzler, and B. Vogelstein, eds. The molecular and metabolic
bases of inherited disease. McGraw-Hill, New York.
Danpure, C. J., P. J. Cooper, P. J. Wise, and P. R. Jennings. 1989.
An enzyme trafficking defect in two patients with primary
hyperoxaluria type 1: peroxisomal alanine/glyoxylate aminotransferase rerouted to mitochondria. J. Cell Biol. 108:1345–
1352.
Danpure, C. J., P. Fryer, P. R. Jennings, J. Allsop, S. Griffiths,
and A. Cunningham. 1994. Evolution of alanine:glyoxylate
aminotransferase 1 peroxisomal and mitochondrial targeting:
a survey of its subcellular distribution in the livers of various
representatives of the classes Mammalia, Aves and Amphibia.
Eur. J. Cell Biol. 64:295–313.
Danpure, C. J., K. M. Guttridge, P. Fryer, P. R. Jennings, J.
Allsop, and P. E. Purdue. 1990. Subcellular distribution of
hepatic alanine:glyoxylate aminotransferase in various mammalian species. J. Cell Sci. 97:669–678.
Danpure, C. J. and L. H. Smith. 1996. The primary hyperoxalurias. Pp. 859–881 in F. L. Coe, M. J. Favus, C. Y. Pak,
J. H. Parks, and G. M. Preminger, eds. Kidney stones: medical
and surgical management. Lippincott-Raven, Philadelphia.
Holbrook, J. D., G. M. Birdsey, Z. Yang, M. W. Bruford, and
C. J. Danpure. 2000. Molecular adaptation of alanine:glyoxylate aminotransferase targeting in primates. Mol. Biol. Evol.
17:387–400.
Joshi, A. R., D. L. Garshelis, and J. L. D. Smith. 1997. Seasonal
and habitat-related diets of sloth bears in Nepal. J.
Mammalogy 78:584–597.
Kozak, M. 1986. Point mutations define a sequence flanking the
AUG initiator codon that modulates translation by eukaryotic
ribosomes. Cell 44:283–292.
———. 1989. The scanning model for translation: an update. J.
Cell Biol. 108:229–241.
Lewin, J., A. P. Dhillon, R. Sim, G. Mazure, R. E. Pounder, and
A. J. Wakefield. 1995. Persistent measles virus infection of
the intestine: confirmation by immunogold electron microscopy. Gut 36:564–569.
Li, X. M., E. C. Salido, and L. J. Shapiro. 1999. The mouse
alanine:glyoxylate aminotransferase gene (Agxt1): cloning,
expression, and mapping to chromosome 1. Somat. Cell Mol.
Genet. 25:67–77.
Lumb, M. J., A. F. Drake, and C. J. Danpure. 1999. Effect of Nterminal alpha helix formation on the dimerization and
intracellular targeting of alanine:glyoxylate aminotransferase.
J. Biol. Chem. 274:20587–20596.
Lumb, M. J., P. E. Purdue, and C. J. Danpure. 1994. Molecular
evolution of alanine/glyoxylate aminotransferase 1 intracellular targeting: analysis of the feline gene. Eur. J. Biochem.
221:53–62.
Messier, W., and C. B. Stewart. 1997. Episodic adaptive
evolution of primate lysozymes. Nature 385:151–154.
Mizobuchi, M., and L. A. Frohman. 1993. Rapid amplification of
genomic DNA ends. Biotechniques 15:214–216.
Nakai, K., and P. Horton. 1999. PSORT: a program for detecting
sorting signals in proteins and predicting their subcellular
localization. Trends. Biochem. Sci. 24:34–36.
Noguchi, T. 1987. Amino acid metabolism in animal peroxisomes. Pp. 234–243 in H. D. Fahimi and H. Sies, eds.
Peroxisomes in biology and medicine. Springer-Verlag,
Berlin.
Nowak, R. M. 1991. Walker’s mammals of the world. John
Hopkins University Press, Baltimore.
Oatey, P. B., M. J. Lumb, and C. J. Danpure. 1996. Molecular
basis of the variable mitochondrial and peroxisomal
646 Birdsey et al.
localization of alanine:glyoxylate aminotransferase. Eur. J.
Biochem. 241:374–385.
Oda, T., T. Funai, and A. Ichiyama. 1990. Generation from
a single gene of two mRNAs that encode the mitochondrial
and peroxisomal serine:pyruvate aminotransferase of rat liver.
J. Biol. Chem. 265:7513–7519.
Oda, T., H. Miyajima, Y. Suzuki, and A. Ichiyama. 1987.
Nucleotide sequence of the cDNA encoding the precursor for
mitochondrial serine:pyruvate aminotransferase of rat liver.
Eur. J. Biochem. 168:537–542.
Page, R. D. 1996. TREEVIEW: an application to display
phylogenetic trees on personal computers. Computer Appl.
Biosci. 12:357–358.
Purdue, P. E., M. J. Lumb, and C. J. Danpure. 1992. Molecular
evolution of alanine:glyoxylate aminotransferase 1 intracellular targeting: analysis of the marmoset and rabbit genes. Eur.
J. Biochem. 207:757–766.
Springer, M. S., W. J. Murphy, E. Eizirik, and S. J. O’Brien.
2003. Placental mammal diversification and the CretaceousTertiary boundary. Proc. Natl. Acad. Sci. USA 100:1056–
1061.
Stewart, C. B., J. W. Schilling, and A. C. Wilson. 1987. Adaptive
evolution in the stomach lysozymes of foregut fermenters.
Nature 330:401–404.
Takada, Y., N. Kaneko, H. Esumi, P. E. Purdue, and C. J.
Danpure. 1990. Human peroxisomal L-alanine: glyoxylate
aminotransferase: evolutionary loss of a mitochondrial targeting signal by point mutation of the initiation codon. Biochem.
J. 268:517–520.
Takasuga, A., S. Hirotsune, R. Itoh, A. Jitohzono, H. Suzuki,
H. Aso, and Y. Sugimoto. 2001. Establishment of a high
throughput EST sequencing system using poly(A) tailremoved, cDNA libraries and determination of 36 000 bovine
ESTs. Nucleic Acids Res. 29:e108.
Takayama, T., K. Fujita, K. Suzuki, M. Sakaguchi, M. Fujie, E.
Nagai, S. Watanabe, A. Ichiyama, and Y. Ogawa. 2003.
Control of oxalate formation from L-hydroxyproline in liver
mitochondria. Journal of the American Society of Nephrology
14:939–946.
Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994.
CLUSTAL W: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting,
position-specific gap penalties and weight matrix choice.
Nucleic Acids Res. 22:4673–4680.
von Heijne, G. 1986. Mitochondrial targeting sequences may
form amphiphilic helices. EMBO J. 5:1335–1342.
Yang, Z. 1997. PAML: a program package for phylogenetic
analysis by maximum likelihood. CABIOS 13:555–556.
———. 1998. Likelihood ratio tests for detecting positive
selection and application to primate lysozyme evolution.
Mol. Biol. Evol. 15:568–573.
Yang, Z., S. Kumar, and M. Nei. 1995. A new method of
inference of ancestral nucleotide and amino acid sequences.
Genetics 141:1641–1650.
Dan Graur, Associate Editor
Accepted November 4, 2003