Survey
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Groups of 3 (each person will be one of the three types of RNA then change roles) -mRNA will get the message (code) from the over head. -rRNA will translate the message by telling the tRNA the correct codon to use to find the Amino Acid sequence needed for protein called for. -tRNA will help rRNA during translation by finding the correct Amino Acid from the codon chart. Each person will trade roles after each protein is produced. Turn in paper with 3 transcribed mRNA and amino acid sequence produced. If a mutation is apparent then give the name for the mutation. Eg.: AUGCCAGACAUAAUCGAUACACCCCGUUUUAA mRNA gives the transcribed message to rRNA AUG CCA GAC AUA AUC GAU ACA CCC CGU UUU UAA rRNA will read off the correct codons to the tRNA met pro arg his asp arg tyr thr pro phe stop tRNA will use the codon chart to translate to amino acds no mutation 1. 1. TACCCTACCAGTGGCCCCCACTTCAAAATT 2. TACCCTACCAGTCGCCCCCACTTCAAAATT 3. TACCCTACCAGTGGCTCCCCACTTCAAAATT 1. TAC CCT ACC AGT GGC CCC CAC TTC AAA ATT mRNA AUG GGA UGG UCA CCG GGG GUG AAG UUU UAA Transl met gly try ser pro gly val lys phe stop 2. TAC CCT ACC AGT CGC CCC CAC TTC AAA ATT mRNA AUG GGA UGG UCA GCG GGG GUG AAG UUU UAA Transl met gly try ser ala gly val lys phe stop Point mutation 3. TAC CCT ACC AGT GGC TCC CCA CTT CAA AAT T mRNA AUG GGA UGG UCA CCG AGG GGU GAA GUU UUA Transl met gly try ser pro arg gly glu val leu… Framshift