Download A phenylalanine-based folding determinant in intestinal sucrase

Research Article
2775
A phenylalanine-based folding determinant in
intestinal sucrase-isomaltase that functions in the
context of a quality control mechanism beyond the
endoplasmic reticulum
Marcus J. Pröpsting1, Heike Kanapin1, Ralf Jacob1,2 and Hassan Y. Naim1,*
1
Department of Physiological Chemistry, University of Veterinary Medicine Hannover, 30559 Hannover, Germany
Department of Cytobiology, Philipps-University of Marburg, 35037 Marburg, Germany
2
*Author for correspondence (e-mail: [email protected])
Accepted 9 March 2005
Journal of Cell Science 118, 2775-2784 Published by The Company of Biologists 2005
doi:10.1242/jcs.02364
Journal of Cell Science
Summary
Phenotype II of congenital sucrase-isomaltase deficiency in
man is characterized by a retention of the brush border
protein sucrase-isomaltase (SI) in the ER/cis-Golgi
intermediate compartment (ERGIC) and the cis-Golgi. The
transport block is due to the substitution of a glutamine
by a proline at amino acid residue 1098 that generates
a temperature-sensitive mutant enzyme, SIQ1098P, the
transport of which is regulated by several cycles of
anterograde and retrograde transport between the ER and
the cis-Golgi (Propsting, M. J., Jacob, R. and Naim, H. Y.
(2003). J. Biol. Chem. 278, 16310-16314). A quality control
beyond the ER has been proposed that implicates a
retention signal or a folding determinant elicited by the
Q1098P mutation. We have used alanine-scanning
mutagenesis to screen upstream and downstream regions
flanking Q1098 and identified a putative motif, F1093-x-F1095x-x-x-F1099 that is likely to be implicated in sensing the
folding and subsequent trafficking of SI from the ER to
the Golgi. The characteristics of this motif are three
phenylalanine residues that upon substitution by alanine
generate the temperature-sensitive SIQ1098P phenotype.
This mutant protein undergoes transport arrest in the
ERGIC and cis-Golgi compartments and acquires correct
folding and functional activity at reduced temperatures as
a consequence of cycles of anterograde and retrograde
transport between the ER and cis-Golgi. Other amino acid
residues in this motif are not significant in the context of
phenotype II. We propose that the phenylalanine cluster is
required for shielding a folding determinant in the
extracellular domain of SI; substitution of a Q by a P at
residue 1098 of sucrase disrupts this determinant and
elicits retention of SIQ1098P in ERGIC and cis-Golgi in
phenotype II of CSID.
Introduction
A physiological malfunction in many genetic disorders is
elicited by an altered folding determinant in a protein due to
a mutation in the gene leading, for example, to an intracellular
block, missorting or degradation of this protein (Stein et al.,
2002; Bross et al., 1999). Normally, membrane and secretory
proteins that have reached a native, folded and assembled
structure are capable of exiting the endoplasmic reticulum and
are then transported to their target organelles and
compartments within the cell. The cell has exploited quality
control mechanisms that distinguish between correctly folded
and unfolded proteins and these mechanisms are therefore
essential in modulating intracellular transport or degradation
if they do not fold (Brodsky and McCracken, 1999; Ellgaard
et al., 1999; Sitia and Braakman, 2003). Therefore, the quality
control system provides a stringent and precise discriminating
system that provides a structural and functional cellular
integrity. Until very recently, it was thought that the quality
control machinery is exclusive to the endoplasmic reticulum,
with many censoring components, such as molecular
chaperones, sugar residues and catalysts of disulphide bond
formation (Ellgaard and Helenius, 2001; Ellgaard et al., 1999;
Hammond and Helenius, 1994; Vashist et al., 2001). In fact,
many artificially generated mutants of membrane and
secretory proteins, as well as naturally occurring mutants
implicated in genetic diseases, were shown not to traverse the
quality control machinery of the ER but to be retained in that
organelle (Hebert et al., 1997; David et al., 1996; Jacob et al.,
2002; Letourneur et al., 1995; Nehls et al., 2000). The
exception to this rule is found in two cases of the intestinal
disorder, congenital sucrase-isomaltase deficiency (CSID).
CSID is an autosomal recessive intestinal disease that is
characterized by the absence of the sucrase and most of the
maltase digestive activity within the sucrase-isomaltase (SI)
enzyme complex, with the isomaltase activity varying from
absent to normal (Treem, 1995). Clinically, the disease is
manifested as an osmotic-fermentative diarrhoea upon
ingestion of disaccharides and oligosaccharides. Analysis of
this disorder at the molecular and subcellular levels has
unravelled a number of phenotypes of CSID, which are
Key words: Sucrase-isomaltase, ER-quality control, cis-Golgi,
ERGIC, Protein folding, Phenylalanine-based motif
2776
Journal of Cell Science 118 (12)
Table 1. A list of the mutants generated by alanine-scanning mutagenesis
Mutant
Plasmid for biochemical/
confocal analysis
Amino acid sequence and position
Ala1
Ala2
Ala3
Ala4
Ala5
Ala6
Ala21
Ala22
Ala31
Ala32
Ala33
Ala3Q
Ala41
QP
pSIAla1/pSIAla1-YFP
pSIAla2/pSIAla2-YFP
pSIAla3/pSIAla3-YFP
pSIAla4/pSIAla4-YFP
pSIAla5/pSIAla5-YFP
pSIAla6/pSIAla6-YFP
pSIAla21/pSIAla21-YFP
pSIAla22/pSIAla22-YFP
pSIAla31/pSIAla31-YFP
pSIAla32/pSIAla32-YFP
pSIAla33/pSIAla33-YFP
pSIAla3Q/pSIAla3Q-YFP
pSIAla41/pSIAla41-YFP
pSIQP/pSIQP-YFP
L1089G1090P1091 → A1089A1090A1091
G1092F1093 → A1092A1093
F1095D1096Q109 → A1095A1096A1097
F1099I1100Q11101 → A1099A1100A1101
I1102S1103T11104 → A1102A1103A1104
R1106L1107P1108 → A1106A1107A1108
G1094A
F1095A
F1098A
N1096A
D1097A
N1096D1097Q1098 → A1096A1097A1098
F1099A
Q1098P
Mutagenesis primer 5′-3′ forward*
gctatttgggattctgcggcagctggatttgcttttaat
gattcttggctgccggcagctgcttttaatgac
ctgcctggatttgctgcagctgcccagttcattcaaatatc
gcttttaatgaccaggcagctgcaatatcgactcgcc
gaccagttcattcaagcagctgctcgcctgccatcag
cattcaaatatcgactgcagcggcatcagaatatatatatgg
gggattcttggctacctgcatttgcttttaatgacc
gggattcttggctacctggagctgcttttaatgacc
ctgcctggatttgctgctaatgaccaattcattcaaatatc
ctgcctggatttgcttttgctgaccaattcattcaaatatc
ctgcctggatttgctttcaatgcccagttcattcaaatatc
ctggatttgcttttgctgcccgcgttcttcaaata
gcttttaatgaccaggccattcaaatatcgact
cctggatttgctttcaatgacccattcattcaaatatcgac
Journal of Cell Science
*The reverse primers were the complementary sequences of the forward primers.
characterized by perturbations in the intracellular transport,
polarized sorting, aberrant processing and defective function
of SI (Fransen et al., 1991; Jacob et al., 2000c; Ritz et al.,
2003; Sterchi et al., 1990; Naim et al., 1988). The enzyme SI
is a type II transmembrane glycoprotein from the brush border
of intestinal epithelial cells, where it is involved in the
hydrolysis of disaccharides (Semenza, 1986). SI is
synthesized in the ER, processed in the Golgi apparatus and
transported directly to the apical membrane (Matter et al.,
1990). To reach this final destination, SI has to pass several
control points that ensure transport of only properly folded
proteins (Rothman and Orci, 1992). Soon after synthesis in the
ER several chaperones cooperate with modification enzymes
such as protein disulphide isomerase and glycosyl transferases
to generate properly folded molecules (Ellgaard and Helenius,
2001). A quality control mechanism retains improperly folded
molecules in the ER until they have acquired a proper folding,
or directs them to the proteasome for degradation (Brodsky
and McCracken, 1999). However, phenotype II of congenital
SI deficiency (CSID) does not conform to this general
paradigm. In this case SI exits the ER and is retained in the
ER/cis-Golgi intermediate compartment (ERGIC) and the cisGolgi (Fransen et al., 1991; Ouwendijk et al., 1996). The
deficiency is based on a point mutation in the SI gene that
results in a substitution of a glutamine by proline at amino
acid residue 1098 of the sucrase subunit (Q1098P) (Moolenaar
et al., 1997; Ouwendijk et al., 1996). This mutation is found
in a region that has strong homologies with some members of
the family of glycosyl hydrolases (Moolenaar et al., 1997;
Naim et al., 1991; Ouwendijk et al., 1998) in mammalian cells
and also in the yeast Schwanniomyces occidentalis. Strikingly,
substitution of the glutamine residue with proline at the
corresponding position of human lysosomal α-glucosidase,
resulted in its retention in ERGIC and cis-Golgi (Moolenaar
et al., 1997) thus generating a similar phenotype to that of SI
(denoted throughout SIQ1098P). Escape from the ER and
accumulation of this mutant in the cis-Golgi and ERGIC
compartments is suggestive of the existence of a quality
control mechanism operating beyond the ER. A most
important characteristic of this mutant phenotype is its
temperature sensitivity and acquisition of correct folding at a
permissive temperature 25°C (Propsting et al., 2003). The
underlying mechanism of this folding behaviour involves
several cycles of retrograde and anterograde trafficking
between the ER and the cis-Golgi until the protein has attained
the correct folded structure. Key players in this mechanism
are the ER molecular chaperones calnexin and the
immunoglobulin binding protein, BiP, and a putative retention
signal of the protein in the cis-Golgi (Propsting et al., 2003).
Here, mutant SI binds BiP and calnexin and then sequential
binding to these chaperones takes place. The protein is then
brought to the cis-Golgi where it is blocked and brought back
to the ER, presumably through calnexin bound to mutant SI
at this stage. Similar steps occur until the protein has acquired
correct folding, after which it can no longer be blocked in the
cis-Golgi. One possible hypothesis to explain this retention
implicates a subdomain flanking the conserved glutamine
residue at position 1098 in the transport of SI along the
secretory pathway. The exchange of this glutamine, or specific
residues within this domain, would alter the folding of SI and
expose peptides that are recognized in the cis-Golgi, resulting
in the retention of SI in this compartment.
This scenario was examined in the work presented here by
alanine scanning mutagenesis of regions flanking glutamine
1098. The biosynthetic features, temperature sensitivity and
subcellular localization of these mutants were assessed. We
examined in detail a region between amino acids 1093 and
1099 in which three phenylalanines play a central role in
constituting a potential retention signal for cis-Golgi.
Materials and Methods
Materials
Streptomycin, penicillin, glutamine, Dulbecco’s modified Eagle’s
medium (DMEM), methionine-free DMEM (denoted Met-free
medium), Fetal calf serum (FCS) and trypsin were purchased from
BioWest, Essen, Germany. Pepstatin, leupeptin, aprotinin, trypsininhibitor and molecular mass standards for SDS-PAGE were
purchased from Sigma, Deisenhofen/Germany. Soybean trypsin
inhibitor was obtained from Roche Diagnostics, Mannheim, Germany.
L-[35S]methionine (>1000 Ci/mmol) and protein A-Sepharose were
obtained from Amersham Pharmacia Biotech, Freiburg, Germany.
Acrylamide,
N,N′-methylenebisacrylamide
and
N,N,N′,N′tetramethylenediamine (TEMED) were purchased from Carl Roth
GmbH, Karlsruhe, Germany. Sodium dodecyl sulphate (SDS),
ammonium persulphate, dithiothreitol and Triton X-100 (TX-100)
were obtained from Merck, Darmstadt/Germany. Restriction enzymes
Protein quality control beyond the ER
2777
were obtained from MBI Fermentas, St.
Leon-Rot, Germany and Isis-polymerase
was obtained from Qbiogene, Heidelberg,
Germany.
Journal of Cell Science
Immunochemical reagents
For immunoprecipitation of human SI
a mixture of the mouse monoclonal
antibodies (mAb) of hybridoma HBB
1/219, HBB 2/619 and HBB 3/705 was
used (Hauri et al., 1985). Anti-ER-Golgi
intermediate compartment mAb ERGIC53 was a product of hybridoma G1/93
(Schweizer et al., 1988). Antibodies
against GM130 and calreticulin were
obtained
from
BD
Bioscience,
Heidelberg, Germany. The secondary
antibody Alexa Fluor 633 was purchased
from Invitrogen Laboratories, Inc,
Heidelberg, Germany. Calnexin and BiP
were precipitated with the polyclonal
antibodies pAb-calnexin and pAb-BiP.
Fig. 1. Schematic drawing of the sucrase-isomaltase alanine scanning-mutants. The primary
sequence of the SI polypeptide between amino acids W1088 and S1108 is depicted in single letter
code together with the SI cDNA sequence. Q1098 is indicated in bold; this residue is substituted by
P in phenotype II of CSID. The Ala triplets (Ala1 to Ala6) are boxed and shown underneath the
corresponding mutated SI sequences. The individual Ala mutants are shown underneath the
corresponding substituted amino acid residue. Another Ala triplet was constructed to encompass
Q1098 and two upstream residues, N1096 and D1097 (denoted Ala3Q). The Ala triple or single
mutants in grey boxes are responsible for the phenotype II of CSID.
Construction of cDNA clones
Mutation of the plasmids pSI-YFP
(Jacob and Naim, 2001) and pSG8-SI
(Ouwendijk et al., 1996) were generated
by oligonucleotide directed mutagenesis
with the Quick Change™ in vitro
Mutagenesis System from Stratagene (Table 1). The mutations were
confirmed by sequencing. The expression plasmids are indicated by
pSI followed by a suffix corresponding to the Ala triplet or the
Ala single mutant and YFP (yellow
fluorescent protein) in the case of
fusion proteins (for example: pSIAla1
or pSIAla1-YFP) (see Table 1).
Transient transfection of COS1 cells, biosynthetic labelling
and immunoprecipitation
COS-1 cells were transiently
transfected with various plasmids
encoding the SI-cDNA (Table 1) by
Fig. 2. Expression of SI, SIQ1098P and
SIAla1-6 alanine scanning mutants in
COS-1 cells at 37°C and 20°C. COS1 cells were transiently transfected
with the respective expression
plasmids as indicated. Forty-eight
hours after transfection the cells
were pulsed with [35S]methionine for
30 minutes at 37°C followed by
different chase periods at 37°C or
20°C. After cell lysis, SI was
immunoprecipitated with mAb antiSI and the immunoprecipitates were
treated with endo H, endo F/GF or
left untreated. They were subjected
to SDS-PAGE on 5% slab gels and
analysed by phosphorimaging. For
some gels, longer exposure was used
because of the faint band intensity.
using DEAE-dextran essentially as described previously (Jacob et al.,
2000a). 48 hours after transfection, the cells were biosynthetically
labelled. The cells were incubated in methionine-free MEM
2778
Journal of Cell Science 118 (12)
Journal of Cell Science
containing 50 µCi of [35S]methionine for the indicated time intervals
and chased in pulse-chase experiments with non-labelled methionine
for different periods of time. Subsequently, the cells were rinsed twice
with ice-cold PBS and solubilized with 1 ml lysis buffer containing
25 mM Tris-HCl (pH 8.0), 50 mM NaCl, 0.5% deoxycholate (DOC)
and 0.5% TX-100 supplemented with 1 mM PMSF, 1 µg/ml pepstatin,
5 µg/ml leupeptin, 5 µg/ml
aprotinin, 1 µg/ml antipain and
50 µg/ml trypsin inhibitor for
30 minutes at 4°C. After 1 hour
of preclearing with 30 µl
of protein A-Sepharose, the
immunoprecipitation
was
performed with the mAb antiSI mix and 50 µl of protein
A-Sepharose as described
previously (Jacob et al.,
2000b). In some experiments
the cells were labelled at 20°C
and chased for prolonged
periods of times.
SDS-PAGE and
deglycosylation analysis
The immunoprecipitates were
further processed on SDSPAGE according to the method
of Laemmli (Laemmli, 1970).
The apparent molecular masses
were assessed by comparison
with high molecular mass
markers (Sigma, Deisenhofen,
Fig. 3. Colocalization of SI
mutants with ER, ERGIC and
cis-Golgi in transfected COS-1
cells. COS-1 cells were
transfected with pSI Ala1-6-YFP
and incubated at 37°C (A-C)
for 48 hours before fixation. In
some experiments the cells
were cultured at 20°C 1 day
post-transfection and then
overnight at 20°C followed by
a temperature shift to 37°C for
4 hours (D). The subcellular
localization of the YFP fusion
proteins was monitored
utilizing antibodies directed
against calreticulin (A),
ERGIC 53 (B) and GM130
(C). The cells were analysed
by confocal microscopy on a
Leica TCS-SP2 microscope.
YFP fluorescence is indicated
in green and a secondary
Alexa Fluor 633-conjugated
antibody was used for
immunodetection of the
compartment-specific
antibodies (red). Arrows
indicate YFP fluorescence on
the plasma membrane. n,
nucleus. Bars, 25 µm.
Germany) run on the same gel. In some experiments, deglycosylation
of the immunoprecipitates with endo-N-acetylglucosaminidase H
(endo H) and endo-β-N-acetylglucosaminidase F/glycopeptidase F
(endo F) (both from Roche Diagnostics, Mannheim, Germany) was
performed prior to SDS-PAGE analysis as described previously
(Naim et al., 1987). After electrophoresis, the gels were fixed and
Protein quality control beyond the ER
2779
Fig. 4. Expression of SIAla21, SIAla22, SIAla31, SIAla32, SIAla33 and
SIAla41 in COS-1 cells at 37°C and 20°. COS-1 cells were
transiently transfected with pSIAla21, pSIAla22, pSIAla31, pSIAla32,
pSIAla33 or pSIAla41, labelled and processed in a pulse-chase
experiment with [35S]methionine as described for Fig. 2. The
deglycosylated and control samples were subjected to SDS-PAGE
prior to scanning by a phosphorimaging device. For some gels
longer exposure was used because of the faint band intensity.
analysed on a phosphorimaging device (BioRad, Munich,
Germany).
Journal of Cell Science
Confocal laser fluorescence microscopy
The cellular localization of expressed proteins in COS-1 cells was
studied with cells grown on coverslips. Cells were fixed with
4% paraformaldehyde and permeabilized with 0.1% Saponin.
immunolabelling was carried out using mAb anti-ERGIC-53, mAb
anti-calreticulin or mAb anti-GM130. The secondary antibody
Alexa Fluor 633 conjugated
rabbit anti-mouse was used
for fluorescence detection.
Confocal images of fixed cells
were acquired 2 days after
transfection using a Leica TCS
SP2 microscope with an 63
water planapochromat lens
(Leica Microsystems). Dual
colour Alexa Fluor 633 and
YFP images were obtained by
sequential scans with the 633
nm lines of an HeNe laser and
514 nm excitation lines of an
argon laser and the optimal
emission wavelength for Alexa
633 or YFP, respectively, as
previously described (Jacob et
al., 2002). For the assessment of
temperature-sensitive
characteristics the cells were
cultured 1 day after transfection
at 20°C for almost 18 hours
(overnight) and the temperature
was then raised to 37°C for 4
hours.
Fig. 3C,D. See previous page for legend.
Results
The Q1098P substitution in
phenotype II of CSID
generates a temperaturesensitive SIQ1098 mutant enzyme, whose
intracellular transport is regulated by several
cycles of anterograde and retrograde transport
between the ER and the cis-Golgi (Propsting et
al., 2003). A quality control beyond the ER has
been proposed that prevents misfolded proteins
from being further transported along the
secretory pathway to the cell surface, and
implicates a retention signal elicited by the
Q1098P mutation. We therefore set out to
analyse short subdomains in the direct
neighbourhood of Q1098 by alanine scanning
mutagenesis of several blocks upstream and
2780
Journal of Cell Science 118 (12)
Journal of Cell Science
downstream of this particular amino acid residue. Fig. 1 shows
that the region from position L1089 to P1107 was first scanned by
six alanine triple blocks (denoted SIAla1 to SIAla6). Two triplets
were generated that span the central position 1098 and eight
single amino acid exchanges in the A2, A3
and A4 block were introduced for a detailed
analysis of the distinct amino acids. Each
mutant was transiently transfected into
COS-1 cells and analysed 48 hours after
transfection in biosynthetic labelling
experiments at 37°C. Fig. 2 shows that
SIAla1, SIAla5 and SIAla6 revealed similar
biosynthetic features to wild-type SI,
exemplified by the conversion of the
mannose-rich endo H-sensitive 210 kDa
pro-SIh polypeptide to the endo H-resistant
form of 245 kDa (pro-SIc; SIc, complex
glycosylated
SI)
in
pulse-chase
experiments. By contrast, the alanine-triple
mutants SIAla2, SIAla3 and SIAla4 persisted
predominantly
as
mannose-rich
polypeptides throughout the entire chase
time and thus were similar the SIQ1098P
mutant phenotype (Fig. 2). More
importantly, these mutants acquired endo H
resistance, i.e. complex glycosylation when
the cells were labelled at 20°C in a fashion
similar to SIQ1098P, indicating that these
mutants possess similar temperaturesensitive characteristics to SIQ1098P (Fig.
2).
To further investigate whether these
mutants express the same phenotype as
SIQ1098P the subcellular localization of
YFP variants of these mutants was
examined using markers of the ER, ERGIC
and cis-Golgi; calreticulin, ERGIC 53 and
GM130, respectively. The alanine-triplets
SIAla2, SIAla3 and SIAla4 revealed features
similar to those of SIQ1098P. Thus, these
mutants accumulate intracellularly in
perinuclear regions typical of the ER
as assessed by colocalization with
calreticulin (Fig. 3A) and colocalized also
with ERGIC 53 (Fig. 3B) and the cis-Golgi
marker GM 130 (Fig. 3C). Finally, they
were not found in vesicular structures or at
the cell surface. Culturing of the cells
expressing SIAla2, SIAla3 and SIAla4 at 20°C
followed by a shift to 37°C leads to the
appearance of these mutants at the cell
surface, reminiscent of a transportcompetent configuration similar to the
Fig. 5. Colocalization of SIAla21, SIAla22,
SIAla31, SIAla32, SIAla33 and SIAla41 with ER,
ERGIC and cis-Golgi in transfected COS-1
cells. The subcellular localization of
fluorescent alanine scanning mutants of SI and
intracellular markers was monitored as
described for Fig. 3. Arrows indicate YFP
fluorescence on the plasma membrane. n,
nucleus. Bars, 25 µm.
Protein quality control beyond the ER
Journal of Cell Science
SIQ1098P phenotype (Fig. 3D shows the data obtained with the
mutant triplet Ala3 as an example representing the other two
Ala-triplets, Ala2 and Ala4). Altogether, the biochemical and
confocal analyses clearly show that SIQ1098P and the alanine
blocks, SIAla2, SIAla3 and SIAla4 share common phenotypical
characteristics indicating that the domain of SI that is
responsible for a cis-Golgi block in the CSID Q1098P
phenotype encompasses a stretch of ten amino acids from G1092
to Q1101 (Fig. 1).
To precisely define the amino acid residues involved in
generating the phenotype II within these blocks we performed
a second series of alanine scans in which each individual amino
acid residue in these blocks was substituted by alanine. This
series included the mutants SIAla21, SIAla22, SIAla31, SIAla32,
Fig. 5C,D. See previous page for legend.
2781
SIAla33 and SIAla41 (Fig. 1). The A1094 residue in the A2 block
was not further analysed, since it occurs as alanine in the wildtype protein. Pulse-chase analyses indicate that the mutants
SIAla21, SIAla32 and SIAla33 were transport competent, acquired
complex glycosylated forms and as such resembled the wildtype protein (Fig. 4). In contrast, three other mutants, SIAla22,
SIAla31 and SIAla41 revealed characteristics similar to the
SIQ1098P phenotype, since they persisted as mannose-rich
glycosylated forms at 37°C (Fig. 4). We examined the
temperature-sensitive features of SIAla22, SIAla31 and SIAla41 and
performed pulse-chase analyses of these mutants at 20°C. Here
again, processing of these mutants to complex glycosylated
endo H-resistant species was achieved, pointing to a similar
phenotype as that of SIQ1098P (Fig. 4). Confocal microscopy of
these
mutants
corroborated
the
biochemical data and showed that these
mutants were localized in the ER (Fig.
5A), ERGIC (Fig. 5B) and cis-Golgi
(Fig. 5C), based on their colocalization
with the protein markers calreticulin,
ERGIC 53 and GM130. The
temperature-sensitivity of these three
mutants was also analysed by culturing
the transfected cells at 20°C. Here again,
and in line with the biochemical data,
the mutants were detected at the cell
surface after a temperature shift to 37°C
(Fig. 5D shows the data obtained with
the mutant SIAla31, as an example
representing the other two mutants,
SIAla22 and SIAla41). In a fashion similar
to the SIQ1098P mutant, enzymatic
activity of the SIAla31, SIAla22 and SIAla41
mutants could be restored at this
permissive temperature.
Obviously, the SIAla31, SIAla22 and
SIAla41 mutants show similar structural
and functional features to the naturally
occurring mutant SIQ1098P, in which the
acquisition of normal trafficking and
function utilizes several cycles of
anterograde and retrograde steps between
the endoplasmic reticulum and the Golgi,
implicating the molecular chaperones
calnexin and BiP (Propsting et al., 2003).
We therefore investigated the cellular
mechanism that is responsible for the
retention of mutations in the F1093-xF1095-x-x-x-F1099-motif by studying their
interaction with two components of the
quality control system in the ER, BiP and
calnexin. Firstly, the interaction of these
chaperones with SIAla1, a mutant with
comparable structural features to wildtype SI, was compared to that of the
transport incompetent SIAla31 mutant.
Here, transfected COS-1 cells were
biosynthetically
labelled
with
[35S]methionine continuously for 6 hours
and the detergent extracts were
immunoprecipitated with anti-BiP or
Journal of Cell Science
2782
Journal of Cell Science 118 (12)
Fig. 6. Sequential interaction of SIQ/P with BiP and calnexin. COS-1
cells were transfected with pSG8-Ala1 and pSG8-Ala31. (A) Fortyeight hours post-transfection the cells were biosynthetically labelled
at 37°C for 6 hours followed by cell lysis and immunoprecipitation
of SI. The cell lysates were immunoprecipitated with anti-BiP or
anti-calnexin and subsequently with mAb anti-SI. (B) Transiently
transfected COS-1 cells were labelled for 30 minutes followed by
different chase intervals at 20°C. The cell lysates were
immunoprecipitated sequentially with mAb anti-SI and anti-BiP or
anti-calnexin. The samples were analysed with SDS-PAGE and
phosphoimaging.
anti-calnexin antibodies, followed by subsequent precipitation of
the bound material with mAb anti-SI. Fig. 6A demonstrates a
weak interaction of SIAla1 with BiP and calnexin while the
mannose-rich form of the SIAla31 mutant bound more strongly to
both chaperones. The kinetics of this interaction was further
analysed in pulse-chase experiments. Fig. 6B shows an early
interaction of the SIAla31 mutant with BiP and calnexin within
30 minutes of the pulse. Following 30 minutes of chase the
interaction with BiP diminished and the binding to calnexin
increased at the same time to a maximum. This binding pattern
was reversed after 60 minutes of chase. At this time more SIAla31
molecules were found associated with BiP than with calnexin,
indicating that the underlying retention mechanism of SI mutants
in the F1093-x-F1095-x-x-x-F1099-motif is based on cycles of
association, dissociation and re-association with the ER resident
proteins BiP and calnexin. Comparable kinetics of interaction
with BiP and calnexin were obtained with the other two mutants
SIAla22 and SIAla41 (data are not shown).
Strikingly, the mutated residues at positions 1093, 1095 and
1099 that have generated the CSID phenotype II are exclusively
phenylalanines. Obviously, these residues play a central role in
the transport competence of SI within the sequence F1093-xF1095-x-x-x-F1099, whereby x can be any amino acid; alterations
in this motif are not tolerated along the secretory pathway of SI
between the ER and the Golgi, since they result in the retention
of SI as a mannose-rich glycosylated polypeptide in the ERGIC
or cis-Golgi compartments (Figs 4 and 5). What is the role of
the Q1098 residue in this context? We have previously shown by
site-directed mutagenesis of Q1098 that the intracellular transport
of SI to the cell surface is not affected by Q1098 (Ouwendijk et
al., 1998). We corroborated these data by alanine scanning at
Q1098 itself. Fig. 7A demonstrates that the processing profiles of
SI carrying Q1098A were similar to the wild-type SI protein,
exemplified by the mannose-rich and complex glycosylated
forms appearing at 4 hours of pulse labelling. Likewise, confocal
analysis revealed predominant cell surface and Golgi labelling
of the Q1098A mutant similar to wild-type SI (Fig. 7B). Other SI
mutants carrying exchanges of Q1098 by residues from other
amino acid groups, E, Y and N did not reveal a notable alteration
in the transport behaviour (data are essentially similar to those
shown in Fig. 7A and are therefore not shown).
We finally asked whether Q1098 acts in the context of a short
motif, thereby implicating sequences in its immediate vicinity.
For this an Ala-triplet was generated to substitute the sequence
N1096D1097Q1098 (indicated SIAla3a). Here again, a wild-type
phenotype was obtained at the biochemical and subcellular
levels (Fig. 7B). Altogether, the data unequivocally indicate that
the Q1098 is not an essential residue in the F1093-x-F1095-x-x-xF1099 sequence and it is likely that its substitution by a P in the
CSID phenotype has drastically altered the secondary structure
of this motif.
Discussion
The retention of a cell surface protein such as intestinal brush
border sucrase-isomaltase in the ERGIC and cis-Golgi
compartments strongly suggests the existence of putative quality
control mechanisms operating beyond the ER. The structural and
functional characteristics of SI in phenotype II of CSID,
SIQ1098P, provide strong support to this notion. Thus, correct
folding, competent intracellular transport, and full enzymatic
activity can be restored by expression of this mutant at the
permissive temperature of 20-25°C by utilizing several cycles of
anterograde and retrograde steps between the endoplasmic
reticulum and the Golgi apparatus. In addition to the CSID
phenotype II a growing body of information about other
secretory and membrane proteins supports the concept of a
quality control operating beyond the ER. In combined deficiency
of factors V and VIII, an autosomal recessive bleeding disorder,
the post-ER protein, ERGIC-53 or LMAN1, has been proposed
to regulate the transport from ER to Golgi of these coagulation
factors (Cunningham et al., 2003; Nichols et al., 1998). Another
example is that of the GPI-anchored tissue-non-specific alkaline
phosphatase, in which a single amino acid exchange from N153
to D153 in a naturally occurring mutation causes cis-Golgi
retention (Ito et al., 2002). Together with our observations of
phenotype II the consensus is now emerging that multiple quality
control checkpoints, including those in the ER, do exist along
the secretory pathway that regulates the trafficking to the cell
surface but that there are recognition signals and interacting
protein components.
In this work we have identified a consensus signal, F1093-xF1095-x-x-x-F1099, that may function as a sensor for correct
trafficking of SI to the cell surface. The destruction of this motif
by the Q1098P mutation in CSID is sufficient to elicit retention
of SI in the cis-Golgi and the ERGIC compartments.
Interestingly, a similar motif is found in two other membrane
glycoproteins, the mammalian lysosomal α-glucosidase and
glucoamylase of the Schwanniomyces occidentalis yeast
(Ouwendijk et al., 1996; Naim et al., 1991). Strikingly,
mutagenesis of the glutamine in this motif to a proline in
lysosomal α-glucosidase generates a protein that is blocked in
the cis-Golgi and ERGIC in a fashion similar to SI, lending
strong support to the notion that this motif is functional in the
Journal of Cell Science
Protein quality control beyond the ER
2783
Fig. 7. Expression profile and subcellular
localisation of SIQ1098A and SIAla3Q in COS-1 cells.
(A) The cDNAs of the SIQ1098A and the Ala triplet
AlaNDQ mutants were transfected into COS-1. The
cells were biosynthetically labelled for 4 hours with
[35S]methionine, lysed and immunoprecipitated
with mAb anti-SI antibodies. The samples were
analysed by SDS-PAGE and phosphorimaging. (B)
COS-1 cells were transfected with the cDNAs
corresponding to the Ala mutants SIQ1098A and
SIAla3Q to which YFP was fused (denoted
pSIQ1098A-YFP and pSIAla3Q-YFP) and fixed 48
hours after transfection for immunofluorescence
staining with calreticulin-, ERGIC 53- and GM130specific antibodies. Alexa Fluor 633-conjugated
antibody was used for immunodetection of the
compartment-specific antibodies as indicated in
Fig. 3. Arrows indicate YFP fluorescence on the
plasma membrane. n, nucleus. Bars, 25 µm.
context of a different protein and that this motif
is likely to be implicated in a quality control
beyond the ER.
One may postulate that the phenylalanine
cluster in the extracellular domain of SI is required for shielding
of a putative cis-Golgi or ERGIC retention signal that is hidden
in the polypeptide. Disruption of the F1093-x-F1095-x-x-x-F1099
structure by a mutation such as Q1098P in CSID drastically
alters the secondary structure of this sequence and exposes this
retention signal. This sequence may function, therefore, to sense
the correct folding of SI beyond the ER and is implicated in an
anterograde and retrograde transport of mutant SI between the
ER and the cis-Golgi. Only when the protein has acquired
adequate folding after several cycles of binding and dissociation
to BiP and calnexin is its further transport to the cell surface
warranted.
Phenylalanine residues that are implicated in ER export have
so far been found on the cytosolic domains of transmembrane
proteins (Nufer et al., 2002; Otte and Barlowe, 2002). The
membrane protein ERGIC-53 (or LMAN1) carries a C-terminal
di-phenylalanine motif that is required for efficient ER export
and mediates COPII binding (Nufer et al., 2002). In addition,
many G-protein receptors harbour the sequence F(x)6LL in their
cytosolic domains for ER export and proper folding of the
polypeptide (Duvernay et al., 2004). According to these
observations a second role of the phenylalanine cluster in the
F1093-x-F1095-x-x-x-F1099 motif could be the proper folding of the
enzyme, generating a three-dimensional transport competent
that can bypass the quality control mechanism in the ER and
reach the cell surface. In one of the most prominent diseases
involving protein trafficking, the CFTR channel is misfolded
because of the loss of one single phenylalanine (CFTRdelta508)
(Cheng et al., 1990). As a consequence, the mutant is unable to
transit from the ER to the plasma membrane. This effect can be
overcome by compounds known to stabilize proteins in their
native conformation (Brown et al., 1997). Further evidence on
the stabilizing effect of phenylalanine comes from studies on the
headpiece subdomain of villin (Frank et al., 2002). Here a cluster
of three conserved phenylalanine residues forms a hydrophobic
core that may stabilize aromatic-aromatic interactions (Burley
and Petsko, 1985). Any replacement of these residues with
leucine results in destabilization of the domain. The three
aromatic amino acids in the F1093-x-F1095-x-x-x-F1099 motif
could serve a similar purpose in the folding process of SI. In
particular, secondary structures such as alpha helices and beta
strands are stabilized by aromatic side chain interactions
(Meurisse et al., 2004). Furthermore, our observations directly
suggest protein retention at the level of the cis-Golgi complex.
In a classical view, the ER quality control machinery is located
at the exit site of the ER (Ellgaard and Helenius, 2001). Recent
data have provided evidence for sequential checkpoint
mechanisms of ER quality control along the passage from ER
to Golgi (Vashist et al., 2001; Vashist and Ng, 2004). Early
checkpoints would then encompass the chaperones BiP and
calnexin/calreticulin (Molinari and Helenius, 2000), while
ERGIC-53 is involved in the trafficking from ER to Golgi
(Nichols et al., 1998). In this case malfolded SI mutants would
pass these early checkpoints until they reach the cis-Golgi. Here,
a retrieval mechanism would package the enzyme into COPIcoated transport vesicles and recycle them back to the ER.
We thank Hans-Peter Hauri (Biozentrum, University of Basel,
Switzerland), Erwin Sterchi (University of Bern, Switzerland) and
Dallas Swallow (University College London, UK) for the gifts of
2784
Journal of Cell Science 118 (12)
antibodies against SI, and Hans-Peter Hauri for the ERGIC-53 antibody.
This work was supported by a grant from the Deutsche
Forschungsgemeinschaft, DFG (grant no. 331/1-3/1-4 to H.Y.N.).
Journal of Cell Science
References
Brodsky, J. L. and McCracken, A. A. (1999). ER protein quality control and
proteasome-mediated protein degradation. Semin. Cell Dev. Biol. 10, 507-513.
Bross, P., Corydon, T. J., Andresen, B. S., Jorgensen, M. M., Bolund, L. and
Gregersen, N. (1999). Protein misfolding and degradation in genetic diseases.
Hum. Mutat. 14, 186-198.
Brown, C. R., Hong-Brown, L. Q. and Welch, W. J. (1997). Correcting
temperature-sensitive protein folding defects. J. Clin. Invest. 99, 1432-1444.
Burley, S. K. and Petsko, G. A. (1985). Aromatic-aromatic interaction: a
mechanism of protein structure stabilization. Science 229, 23-28.
Cheng, S. H., Gregory, R. J., Marshall, J., Paul, S., Souza, D. W., White, G.
A., O’Riordan, C. R. and Smith, A. E. (1990). Defective intracellular
transport and processing of CFTR is the molecular basis of most cystic
fibrosis. Cell 63, 827-834.
Cunningham, M. A., Pipe, S. W., Zhang, B., Hauri, H. P., Ginsburg, D. and
Kaufman, R. J. (2003). LMAN1 is a molecular chaperone for the secretion
of coagulation factor VIII. J. Thromb. Haemost. 1, 2360-2367.
David, F., Baricault, L., Sapin, C., Gallet, X., Marguet, D., ThomasSoumarmon, A. and Trugnan, G. (1996). Reduced cell surface expression
of a mutated dipeptidyl peptidase IV (DPP IV/CD26) correlates with the
generation of a beta strand in its C- terminal domain. Biochem. Biophys. Res.
Commun. 222, 833-838.
Duvernay, M. T., Zhou, F. and Wu, G. (2004). A conserved motif for the
transport of G protein-coupled receptors from the endoplasmic reticulum to
the cell surface. J. Biol. Chem. 279, 30741-30750.
Ellgaard, L. and Helenius, A. (2001). ER quality control: towards an
understanding at the molecular level. Curr. Opin. Cell Biol. 13, 431-437.
Ellgaard, L., Molinari, M. and Helenius, A. (1999). Setting the standards:
quality control in the secretory pathway. Science 286, 1882-1888.
Frank, B. S., Vardar, D., Buckley, D. A. and McKnight, C. J. (2002). The
role of aromatic residues in the hydrophobic core of the villin headpiece
subdomain. Protein Sci. 11, 680-687.
Fransen, J. A., Hauri, H. P., Ginsel, L. A. and Naim, H. Y. (1991). Naturally
occurring mutations in intestinal sucrase-isomaltase provide evidence for the
existence of an intracellular sorting signal in the isomaltase subunit. J. Cell
Biol. 115, 45-57.
Hammond, C. and Helenius, A. (1994). Quality control in the secretory
pathway: retention of a misfolded viral membrane glycoprotein involves
cycling between the ER, intermediate compartment, and Golgi apparatus. J.
Cell Biol. 126, 41-52.
Hauri, H. P., Sterchi, E. E., Bienz, D., Fransen, J. A. and Marxer, A. (1985).
Expression and intracellular transport of microvillus membrane hydrolases in
human intestinal epithelial cells. J. Cell Biol. 101, 838-851.
Hebert, D. N., Zhang, J. X., Chen, W., Foellmer, B. and Helenius, A. (1997).
The number and location of glycans on influenza hemagglutinin determine
folding and association with calnexin and calreticulin. J. Cell Biol. 139, 613623.
Ito, M., Amizuka, N., Ozawa, H. and Oda, K. (2002). Retention at the cisGolgi and delayed degradation of tissue-non-specific alkaline phosphatase
with an Asn153→Asp substitution, a cause of perinatal hypophosphatasia.
Biochem. J. 361, 473-480.
Jacob, R. and Naim, H. Y. (2001). Apical membrane proteins are transported
in distinct vesicular carriers. Curr. Biol. 11, 1444-1450.
Jacob, R., Alfalah, M., Grunberg, J., Obendorf, M. and Naim, H. Y. (2000a).
Structural determinants required for apical sorting of an intestinal brushborder membrane protein. J. Biol. Chem. 275, 6566-6572.
Jacob, R., Weiner, J. R., Stadge, S. and Naim, H. Y. (2000b). Additional Nglycosylation and its impact on the folding of intestinal lactase-phlorizin
hydrolase. J. Biol. Chem. 275, 10630-10637.
Jacob, R., Zimmer, K. P., Schmitz, J. and Naim, H. Y. (2000c). Congenital
sucrase-isomaltase deficiency arising from cleavage and secretion of a mutant
form of the enzyme. J. Clin. Invest. 106, 281-287.
Jacob, R., Peters, K. and Naim, H. Y. (2002). The prosequence of human
lactase-phlorizin hydrolase modulates the folding of the mature enzyme. J.
Biol. Chem. 277, 8217-8225.
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of
the head of bacteriophage T4. Nature 227, 680-685.
Letourneur, O., Sechi, S., Willette-Brown, J., Robertson, M. W. and Kinet,
J. P. (1995). Glycosylation of human truncated Fc epsilon RI alpha chain is
necessary for efficient folding in the endoplasmic reticulum. J. Biol. Chem.
270, 8249-8256.
Matter, K., Brauchbar, M., Bucher, K. and Hauri, H. P. (1990). Sorting of
endogenous plasma membrane proteins occurs from two sites in cultured
human intestinal epithelial cells (Caco-2). Cell 60, 429-437.
Meurisse, R., Brasseur, R. and Thomas, A. (2004). Aromatic side-chain
interactions in proteins: near- and far-sequence Tyr-X pairs. Proteins 54, 478490.
Molinari, M. and Helenius, A. (2000). Chaperone selection during glycoprotein
translocation into the endoplasmic reticulum. Science 288, 331-333.
Moolenaar, C. E., Ouwendijk, J., Wittpoth, M., Wisselaar, H. A., Hauri, H.
P., Ginsel, L. A., Naim, H. Y. and Fransen, J. A. (1997). A mutation in a
highly conserved region in brush-border sucrase- isomaltase and lysosomal
alpha-glucosidase results in Golgi retention. J. Cell Sci. 110, 557-567.
Naim, H. Y., Sterchi, E. E. and Lentze, M. J. (1987). Biosynthesis and
maturation of lactase-phlorizin hydrolase in the human small intestinal
epithelial cells. Biochem. J. 241, 427-434.
Naim, H. Y., Roth, J., Sterchi, E. E., Lentze, M., Milla, P., Schmitz, J. and
Hauri, H. P. (1988). Sucrase-isomaltase deficiency in humans. Different
mutations disrupt intracellular transport, processing, and function of an
intestinal brush border enzyme. J. Clin. Invest. 82, 667-679.
Naim, H. Y., Niermann, T., Kleinhans, U., Hollenberg, C. P. and Strasser,
A. W. (1991). Striking structural and functional similarities suggest that
intestinal sucrase-isomaltase, human lysosomal alpha-glucosidase and
Schwanniomyces occidentalis glucoamylase are derived from a common
ancestral gene. FEBS Lett. 294, 109-112.
Nehls, S., Snapp, E. L., Cole, N. B., Zaal, K. J., Kenworthy, A. K., Roberts,
T. H., Ellenberg, J., Presley, J. F., Siggia, E. and Lippincott-Schwartz, J.
(2000). Dynamics and retention of misfolded proteins in native ER
membranes. Nat. Cell Biol. 2, 288-295.
Nichols, W. C., Seligsohn, U., Zivelin, A., Terry, V. H., Hertel, C. E.,
Wheatley, M. A., Moussalli, M. J., Hauri, H. P., Ciavarella, N., Kaufman,
R. J. et al. (1998). Mutations in the ER-Golgi intermediate compartment
protein ERGIC- 53 cause combined deficiency of coagulation factors V and
VIII. Cell 93, 61-70.
Nufer, O., Guldbrandsen, S., Degen, M., Kappeler, F., Paccaud, J. P., Tani,
K. and Hauri, H. P. (2002). Role of cytoplasmic C-terminal amino acids of
membrane proteins in ER export. J. Cell Sci. 115, 619-628.
Otte, S. and Barlowe, C. (2002). The Erv41p-Erv46p complex: multiple export
signals are required in trans for COPII-dependent transport from the ER.
EMBO J. 21, 6095-6104.
Ouwendijk, J., Moolenaar, C. E., Peters, W. J., Hollenberg, C. P., Ginsel, L.
A., Fransen, J. A. and Naim, H. Y. (1996). Congenital sucrase-isomaltase
deficiency. Identification of a glutamine to proline substitution that leads to a
transport block of sucrase- isomaltase in a pre-Golgi compartment. J. Clin.
Invest. 97, 633-641.
Ouwendijk, J., Peters, W. J. M., te Morsche, R. H. M., van de Vorstenbosch,
R. A., Ginsel, L. A., Naim, H. Y. and Fransen, J. A. M. (1998). Analysis
of a naturally occurring mutation in sucrase-isomaltase: glutamine 1098 is not
essential for transport to the surface of COS-1 cells. Biochim. Biophys. Acta
1406, 299-306.
Propsting, M. J., Jacob, R. and Naim, H. Y. (2003). A glutamine to proline
exchange at amino acid residue 1098 in sucrase causes a temperature-sensitive
arrest of sucrase-isomaltase in the endoplasmic reticulum and cis-Golgi. J.
Biol. Chem. 278, 16310-16314.
Ritz, V., Alfalah, M., Zimmer, K. P., Schmitz, J., Jacob, R. and Naim, H. Y.
(2003). Congenital sucrase-isomaltase deficiency because of an accumulation
of the mutant enzyme in the endoplasmic reticulum. Gastroenterology 125,
1678-1685.
Rothman, J. E. and Orci, L. (1992). Molecular dissection of the secretory
pathway. Nature 355, 409-415.
Schweizer, A., Fransen, J. A., Bachi, T., Ginsel, L. and Hauri, H. P. (1988).
Identification, by a monoclonal antibody, of a 53-kD protein associated with
a tubulo-vesicular compartment at the cis-side of the Golgi apparatus. J. Cell
Biol. 107, 1643-1653.
Semenza, G. (1986). Anchoring and biosynthesis of stalked brush border
membrane proteins: glycosidases and peptidases of enterocytes and renal
tubuli. Annu. Rev. Cell Biol. 2, 255-313.
Sitia, R. and Braakman, I. (2003). Quality control in the endoplasmic reticulum
protein factory. Nature 426, 891-894.
Stein, M., Wandinger-Ness, A. and Roitbak, T. (2002). Altered trafficking and
epithelial cell polarity in disease. Trends Cell Biol. 12, 374.
Sterchi, E. E., Lentze, M. J. and Naim, H. Y. (1990). Molecular aspects of
disaccharidase deficiencies. Bailliere’s Clin. Gastr. 4, 79-96.
Treem, W. R. (1995). Congenital sucrase-isomaltase deficiency. J. Pediatr.
Gastr. Nutr. 21, 1-14.
Vashist, S. and Ng, D. T. (2004). Misfolded proteins are sorted by a sequential
checkpoint mechanism of ER quality control. J. Cell Biol. 165, 41-52.
Vashist, S., Kim, W., Belden, W. J., Spear, E. D., Barlowe, C. and Ng, D. T.
(2001). Distinct retrieval and retention mechanisms are required for the quality
control of endoplasmic reticulum protein folding. J. Cell Biol. 155, 355-368.