Download Gene encoding the group B streptococcal protein R4, its

Indian J Med Res 119 (Suppl) May 2004, pp 213-220
Gene encoding the group B streptococcal protein R4, its presence in
clinical reference laboratory isolates & R4 protein pepsin sensitivity
B.L. Smith*†, A. Flores*, J. Dechaine†, J. Krepela†, A. Bergdall† & P. Ferrieri*
*Departments of Laboratory Medicine & Pathology & Pediatrics, University of Minnesota Medical School &
Department of Biology, Luther College, USA
†
Received August 7, 2003
Background & objectives: R proteins were first identified by Lancefield in group B Streptococcus (GBS)
as resistant to trypsin at pH8 and sensitive to pepsin at pH2. The R4 protein found predominantly in
type III and some type II and V invasive isolates conforms to these criteria. The Rib protein, although
structurally and epidemiologically similar to R4, was reported as resistant to both proteases. We report
here the gene encoding the R4 protein from a type III group B streptococcal isolate (76-043) well
characterized in our laboratory.
Methods: Trypsin extracted GBS proteins were assayed for protease sensitivities by double-diffusion
Ouchterlony using varying conditions for the enzyme pepsin. Standard haemoglobin assay was used
to examine pepsin enzymatic activity. Thirty clinical isolates of varying protein profiles identified by
double-diffusion from our reference strain laboratory were screened by PCR and Southern technique.
SDS-PAGE gel purified R4 amino acid sequences were determined and used to design oligonucleotide
primers for screening a 76-043 genomic library.
Results: R4 was sensitive to pepsin at pH2 but appeared resistant at pH4, the reported pH used for Rib.
By standard haemoglobin assay and trypsin extract studies of R4 protein, pepsin was shown to be active
at pH2, yet easily inactivated; assays of GBS surface proteins are critical at pH2. Of the amino acids
initially sequenced from R4, 88 per cent (61/69) showed identity to Rib; the r4 nucleotide sequence was
identical to that of rib. All isolates with strong positive protein reactions for R4 were positive in both
PCR and Southern technique, whereas isolates expressing alpha, beta, R1/R4, and R5 (BPS) protein
profiles were not.
Interpretation & conclusion: Sequenced PCR products aligned with identity to the R4 and Rib nucleotide
sequences and confirmed the identity of these proteins and their molecular sequences.
Key words a-like proteins - group B Streptococcus - pepsin sensitive - R4 - Rib - surface protein - trypsin resistant
Group B streptococcus is a leading cause of infant
mortality and studies of protein and genetic profiles are
invaluable for detection and identification of virulent
clinical isolates. Historically, proteins from Streptococcus
were identified by double-diffusion Ouchterlony and their
reactivity to the enzymes trypsin and pepsin. Lancefield’s
classic experiments first identifying R proteins in group
A Streptococcus (GAS), group B Streptococcus (GBS)
and other streptococcal species defined R proteins as
resistant to trypsin at pH8 and sensitive to pepsin at pH2.
Although the first pepsin studies varied pH2-pH3 and
pepsin concentration 0.5-1.0 per cent 1-4, standard
protocols now test pepsin sensitivity at pH2 and 0.5 per
cent pepsin5, 7 and characterization of various R proteins
has continued in several laboratories6-8. The R4 protein
which has been well characterized in our laboratory,
conforms to these criteria, is found predominantly in type
III as well as some type II and V invasive isolates that
cause disease, and is useful in serotyping and
characterization of invasive isolates5. Numerous studies
213
214
INDIAN J MED RES (SUPPL) MAY 2004
in our reference laboratory and elsewhere have well
characterized the prevalence of R4 in invasive disease,
but information on the gene sequence of R4 is not known.
and the homology of the R4 and Rib amino acid and
molecular sequences.
Material & Methods
Another GBS surface protein, Rib, was named
primarily for its resistance to both proteases, and
identified at that time as a novel GBS surface protein
that conferred protective immunity9. Rib has been well
characterized9-11. Both R4 and Rib are highly associated
with type III and some type II GBS invasive strains,
both demonstrate similarity in type III isolates of different
geographic origin with some strain to strain variation5,7,9,
and both R4 and Rib are trypsin resistant and highly
repetitive in structure, but do not crossreact with alpha
proteins7,9, yet we believed that Rib resembled R4 protein
in more than simply structural and epidemiological
association. In addition, Bevanger et al 6 using a
monoclonal antibody raised against a purified R protein
initially termed Ra, demonstrated that both R4 and Rib
showed crossreactivity between reference GBS isolates
and anti-R4 protein serum. This suggested that Rib was
not only a member of the R protein family, but that Rib
resembled R4, one of the alpha-like GBS surface
proteins6. Although Lancefield initially believed that R
proteins in GAS were not immunogenic3, more recent
studies have shown immunogenicity of GBS R proteins
in rabbits and in humans, thus both R4 and Rib are
immunogenic12-14. Although serological crossreactivity
was shown to exist between the R28 protein of GAS
and Rib, Rib was not believed to be an R protein based
on early data suggesting inability of R proteins to confer
immunity and pepsin sensitivity results at pH49,15.
Because the standard assay for pepsin sensitivity is
performed at pH2, and Rib was identified as pepsin
resistant at pH4, we predicted that R4 and Rib were the
same. We have previously reported that R4 was sensitive
to pepsin at pH2 but appeared resistant to pepsin at pH47.
In this study, we sought to determine the nature of pepsin
activity with respect to pepsin sensitivity testing of GBS
surface proteins, and to determine if loss of pepsin activity
at higher pH was responsible for R4’s apparent
resistance to pepsin at pH4. We report that pepsin
sensitivity testing of GBS surface proteins is critical at
pH2. We also report the identification of the gene
sequence for the R4 protein from a type III invasive
isolate 76-043, the presence of the R4 gene in clinical
reference laboratory isolates with R4 protein profiles,
Bacterial isolates and growth: A variety of
Streptococcus agalactiae isolates have been obtained
from epidemiological studies spanning many years and
30 different GBS clinical isolates were obtained from
the University of Minnesota Medical School GBS
Reference Laboratory. Each previously serotyped isolate
was assayed by double-diffusion Ouchterlony and
identified by its hot HCl- and trypsin-extracted surface
proteins from GBS5,7. Isolates were identified by serotype
and by protein profile as R4, R1/R4, R5 (BPS), alpha,
beta, or negative in which no associated protein was
detected (Table I). A type III group B streptococcal
isolate (76-043) identified with antisera in our reference
laboratory and well characterized in our laboratory with
respect to polysaccharide and protein profiles, opsonic
requirements, and virulence in animal models of infection
was extracted by both hot HCl- and trypsin-extracted
methods5,7. Surface protein R4 was identified, isolated,
and amino acid sequences and nucleotide sequences for
R4 were determined from this isolate. S. agalactiae
isolates were grown to stationary phase (THB OD600
~0.5-0.7) in Todd-Hewitt Broth (THB) (Fisher, Pittsburg,
PA) at 37oC without shaking.
Escherichia coli strain DH5a used for
transformation, XL1-Blue MRF’ used as the bacterial
host strain for the lambda phage, and SOLR cells and
ExAssist helper phage used for in vivo excision were
provided by Stratagene (LaJolla, CA). E. coli was grown
in Luria Broth (LB) at 37oC with aeration or on NZCYM
media (Life Technologies, Grand Island, NY) as specified
by Stratagene.
Pepsin sensitivity testing of trypsinized extracts in
immunodiffusion: Double diffusion Ouchterlony was
performed as described previously using antiserum that
detects R45,16. To examine R4 protein sensitivity to
pepsin, Lancefield’s standard assay using trypsinized cell
extracts was followed1,5: extraction of GBS isolate 76043 surface proteins with 0.1 per cent trypsin in
Sorensen’s phosphate buffer/30 min/37oC, reaction
stopped at pH6/ice/5 min, and extracts kept at -80oC
until pepsin treatment. 1.0 per cent Pepsin (Sigma, USA)
SMITH et al: SEQUENCE OF GBS PEPSIN-SENSITIVE R4 PROTEIN
was prepared by resuspension in acidified water at
varying pH. Equal volumes of GBS trypsinized cell
extracts were incubated with 1.0 per cent pepsin (final
concentration 0.5% pepsin), or were not treated with
pepsin as controls maintaining equivalent volumes and
protein concentrations with acidified water. Cell extracts
tested in immunodiffusion included a non-pepsin/non-pH
control, a non-pepsin/pH2 control, and incubation with
pepsin at pH2, pH4, pH6, pH8. After incubation for 2 h
at 37oC, the reaction was stopped at neutral pH and the
extracts were kept at -80oC until ready for use in
immunodiffusion.
Standard haemoglobin assay: To examine pepsin
enzymatic activity, a standard spectrophometric pepsin
assay was used with haemoglobin as a substrate. Pepsin
was dissolved in acidified water at the same varying pH
conditions as above and incubated with 2.5 per cent
(w/v) haemoglobin at 37oC for 10 min. After digestion,
the resulting peptide fragments soluble in trichloroacetic
acid (TCA) were quantified by A280 (Sigma,
Communication) 17,18. Activity of pepsin was also
observed after freeze-thaw and after irreversible
denaturation of pepsin at pH > 819.
Determination of R4 amino acid sequence: GBS
trypsinized cell extracts were electrophoresed on 7.5 per
cent SDS-PAGE under reducing conditions, and
transferred and immobilized on PVDF membranes or
maintained in SDS-PAGE gel slices and subjected to
amino-terminal and internal peptide sequencing at
Harvard Microchemistry Facility, Cambridge, MA. The
N-terminal sequence and five internal amino acid
sequences were obtained and a BLASTp search was
performed using http://www.ncbi.nlm.nih.gov/blast/.
Generation of R4 sequence-probe and screening
of isolates by polymerase chain reaction and
southern screening: From amino acid sequences
determined above, oligonucleotide primers were derived
from the amino-terminal sequence of R4, R4Nterm 5’
–ACAGTATTGAAGACAGATGGA- 3’, and internal
peptide sequences designated R4peak31U 5’GTTTTGATAAGTTTAGAT-3’, R4peak31D 5’ –
ATCTAAACTTATCAAAAC- 3’, and R4peak18 5'TTCTAAATTAGTAACTTCAGTTAT -3’ (Integrated
DNA technologies, Inc., Coralville, IA) (Fig. 1).
(2µM)Primers amplified 75ng of 76-043 genomic
215
DNA by PCR in a 100µl reaction: 1x buffer/ 2.5mM
MgCl 2 / 0.1mM dNTP’s/ 2.4U taq polymerase
(Promega, Madison, WI) at 94 oC for 5 min, 30
consecutive cycles at 94oC for 1 min, 40oC for 1 min,
and 72oC for 1 min with a final extension 72oC for 7
min. The amplified products were cleaned by WizardTM
PCR Preps DNA Purification System (Promega,
Madison, WI), and sequenced by the University of
Minnesota Microchemical Facility and Advanced
Genetic Computing Facility. A 262bp digoxygeninlabeled r4 probe was generated by the addition of
digoxygenin-11-dUTP (alkali labile) per manufacturer’s
instructions using R4Nterm and internal R4peak18
primers. Probe concentration was assayed by dot blot
and used to screen the library and to perform Southern
blot using digoxygenin protocol per manufacturer’s
instructions (Roche Molecular Biochemicals,
Indianapolis, IN).
Preparation of genomic DNA: Genomic DNA for PCR
template DNA, Southern, and for construction of the
genomic library was isolated from all GBS isolates using
a method previously described20 and adapted for Qiagen
DNeasyTM kit as per manufacturer’s protocols (Qiagen,
Valencia, CA) or were phenol:chloroform extracted. For
Southern blot screening of clinical isolates, approximately
1 µg of DNA from isolates 1-30 and positive control
isolate 76-043 were digested either with EcoRV which
cut 1x within the r4 gene sequence or HindIII which cut
outside the r4 sequence.
Construction and screening of GBS genomic library:
A genomic library of randomly sheared 76-043 DNA in
Lambda ZapII vector was created by Stratagene
(Stratagene, LaJolla, CA). The digoxygenin-labeled
262bp r4 probe was used to screen replica filters of
about 11,500 plaques from the library after incubation
with XL1-Blue MRF’ bacterial host strain and plated on
NZCYM bottom agar in 0.7 per cent top agarose as
specified by Stratagene. Digoxygenin-detection protocol
was followed as per manufacturer’s instructions (Roche
Molecular Biochemicals, Indianapolis, IN). Plaques
identified in the initial screening were re-hybridized with
the 262bp r4 probe in a secondary screen. Plaques with
the strongest signal were chosen for in vivo excision of
the pBluescript SK(-) phagemid by co-infection with
helper phage according to procedure provided by
Stratagene.
INDIAN J MED RES (SUPPL) MAY 2004
216
Results
Because of similarities between R4 and Rib, and the
classification of Rib as a pepsin resistant protein at pH4,
it was important to first study the activity of pepsin in
relation to pepsin sensitivity testing; second, and more
importantly, to determine the gene sequence encoding
the R4 protein; and third to determine if the gene sequence
could be detected only in isolates previously determined
to be R4 expressing isolates.
Pepsin sensitivity of trypsin-extracted proteins and
pepsin activity by standard haemoglobin assay:
Because pepsin is an enzyme with an optimal pH range
for activity, above which the enzyme is denatured18,19,21,
we examined if the loss of pepsin activity at higher pH
was responsible for R4’s apparent resistance to pepsin
at pH4. Here we directly examined pepsin sensitivity
and pepsin activity concurrently using two assays. First,
we tested trypsin-extracted R4 protein under various pH
conditions for pepsin sensitivity using two different
prototypic reference antisera for R4 in double-diffusion
(results not shown). The trypsin-extracted R4 showed a
precipitin result with anti-R4 antiserum for both controls.
As the classic example of pepsin sensitivity for pepsin
at pH2, no precipitin result was shown. At pH4, pH6
and pH8, however, precipitin results were positive
confirming our previous results that R4 appears resistant
to pepsin at higher pH.
In order to test directly the activity of the pepsin used
in these experiments, a second assay was used. We
tested pepsin activity using a standard haemoglobin
assay17 that determined pepsin enzymatic activity under
these different conditions. We first examined pepsin
digestion of haemoglobin at pH2, pH > 8, and pH > 8
returned to pH2. A280 measurements were significantly
decreased with A 280 =0.198, A 280 =0.003, and
A280=0.000, respectively, indicating that pepsin was
irreversibly denatured above pH8 in concordance with
other studies of pepsin activity18,19,21. In addition, we
observed that with repeated freeze-thaw of the pepsin,
loss of pepsin activity occurred (data not shown).
To examine directly pepsin activity of the acidified
pepsin used in the R4 pepsin sensitivity tests, we then
employed the haemoglobin assay with these pepsin
reagents. In duplicate experiments (Fig.2), pepsin activity
was highest at pH2 and pepsin activity was significantly
decreased for pepsin at pH4, pH6, and pH8.
R4 amino acid and nucleotide sequence
determination: To determine if R4 and Rib were the
same, it was necessary to obtain amino acid and
nucleotide sequences for R4. SDS-PAGE gel purified
R4 protein was sequenced and N-terminal and internal
amino acid sequences were aligned by BLAST to the
Rib protein. Six different amino acid sequences were
obtained by MALDI-mass spectrophotometry: Nterm,
peak31, peak18, peak 28, peak 23, and peak15. Of the
69 amino acids sequenced from R4, 61 showed identity
(88%) to the Rib amino acid sequence. The sequences
highlighted in Fig.1 indicate identity and alignments.
Amino acid sequences were used to design PCR
oligonucleotide primers as stated above. The amplified
product of R4Nterm/R4peak31D was 181bp; the
amplified product of R4peak31U/R4peak18 was 81bp
and the amplified product of R4Nterm/R4peak18 primers
was 262bp. These products were sequenced and aligned
with the rib nucleotide sequence in size and order.
Primers R4Nterm and R4peak18 shown in Fig.1 were
used to generate the 262bp digoxygenin-labeled r4 PCR
product used to screen the 76-043 GBS genomic library.
Using the R4 protein-generated probe, two clones were
obtained and used for sequencing the r4 gene. The entire
open reading frame for the gene encoding R4 was
subcloned. The resulting clones were sequenced from
the 5’ nucleotide sequences encoding the N-terminus
through the first three repeats, internal identical tandem
repeats of 237bp, through the last three repeats, and the
3’ nucleotide region encoding the carboxyl terminus. The
predicted translations were consistent with the known
amino acid sequence of the 120kDa R4 protein containing
approximately 12 tandem repeats (Fig.1). Although the
sequence was not determined for all internal DNA repeat
regions, the repeats of 237bp appeared to be identical
tandem repeats, consistent with other ladder-like proteins,
and were identical to the repeats found in the gene
encoding Rib10. Using NCBI BLASTn, r4 nucleotide
sequences were 99 per cent identical (3682/3693) to the
gene encoding Rib. A single nucleotide difference in 11
of the 12 repeats of the rib gene was the sole difference.
The r4 nucleotide sequence was highly homologous
(3576/3577) to the recently published genome of a type
V/R GBS strain. The r28 gene sequence encoding the
R protein of GAS, as well as gene sequences for other
alpha-like proteins also showed homology. Little
homology was detected with a GBS genome from a nonR4 producing type Ia strain. Fig.1 shows the deduced
SMITH et al: SEQUENCE OF GBS PEPSIN-SENSITIVE R4 PROTEIN
217
Table. Isolate 76-043 and 30 different GBS clinical isolates were identified by their double-diffusion protein
profiles, verified by PCR using R4-generated oligonucleotide primers and sequence identity to the r4 probe,
and confirmed by Southern blot detection using the digoxygenin-labeled R4-generated probe
Isolate No.
Serotype/protein profile
PCR results
Sequence results
Southern
76-043
III/R4
+
+
+
1
V/c (a only)
-
ND
-
2
V/R5
-
ND
-
3
Ib/c (b only)
-
ND
-
4
Ib/c (a and b)
-
ND
-
5
V/R4 (weak)
-
ND
-
6
III/R4
+
+
+
7
III/R4
+
+
+
8
III/R4
+
+
+
9
III/R4
+
+
+
10
V(R1/R4)
-
ND
-
11
V/negative
-
ND
-
12
III/R4
+
+
+
13
Ia/c (a only)
-
ND
-
14
V/negative
-
ND
-
15
II/R4
+
+
+
16
Ib/c (a and b)
-
ND
-
17
III/R4
+
+
+
18
II/c (a only)
-
ND
-
19
III/R4
+
+
+
20
Ia/negative
-
ND
-
21
III/R4
+
+
+
22
V/ (R1/R4)
-
ND
-
23
III/R4
+
+
+
24
Ia/c (a only)
-
ND
-
25
III/R4
+
+
+
26
III/R4
+
+
+
27
Ia/c (a only)
-
ND
-
28
V/negative
-
ND
-
29
III/R4
+
+
+
30
V/R4
+
+
+
PCR and Southern results were done in replicates and duplicates, respectively. Sequences were determined only for
samples that yielded a PCR product.
ND, not determined.
218
INDIAN J MED RES (SUPPL) MAY 2004
Fig.1. Amino acid and nucleotide sequence of R4. The nucleotide sequence of R4 is shown with its translated amino acid sequence. Highlighted
amino acid sequences were obtained by amino acid sequencing of R4 protein and aligned with identity to Rib protein sequences. Sequences for
the N-terminus and peak 18 were used to design the primers to create the R4 digoxygenin- labeled PCR probe for screening of the genomic
library of isolate 76-043 and for PCR and Southern screening of clinical isolates. (R4 Genbank Accession #AY179867).
SMITH et al: SEQUENCE OF GBS PEPSIN-SENSITIVE R4 PROTEIN
nucleotide sequence, the translated R4 protein and amino
acid sequences used to generate primers (R4 Genbank
Accession # AY179867).
PCR, sequencing, and southern screening of 30
different isolates using R4-generated primers and
probe: As a final determination that R4 and Rib were
the same and that clinical isolates identified as R4 isolates
could be detected using the R4-generated probe, PCR
and Southern blot were used to screen 30 clinical isolates
of varying protein profiles as identified by doublediffusion from a reference laboratory. All isolates with
strong positive protein reactions for R4 were positive by
PCR, whereas isolates expressing alpha, beta R1/R4 and
R5 (BPS) protein profiles were not detected. In addition,
R4 producing serotypes II, III and V were all detected.
Products were consistent in size with expected r4 and
rib sequences. Positive reactions with PCR products
were sequenced and aligned with identity to the r4 and
rib sequences. In Southern blot, the R4-generated
digoxygenin probe hybridized to EcoRV digested genomic
DNA as two bands as predicted based on sequence
restriction digest patterns for all PCR-positive/R4-positive
isolates. This confirmed that oligonucleotides generated
from the R4 protein in PCR, and the R4-generated probe
in Southern identified only R4-positive isolates from the
reference laboratory isolates (Table I).
Discussion
The R4 protein has been identified and characterized
as a pepsin sensitive protein. R4 is similar to Rib
epidemiologically, in size and in ladder-like repeats. Both
are trypsin resistant, do not crossreact with alpha, but
Fig.2. Pepsin activity tested by standard haemoglobin test. Activity
of pepsin at varying pH used concurrently in pepsin sensitivity
tests were tested by standard haemoglobin assay n=2, duplicates
done on separate days with no deviation P<0.05.
219
crossreact with each other and with anti-R4 antisera,
and are immunogenic, yet the Rib protein was described
as pepsin resistant at pH4. We previously reported R4
to be sensitive to pepsin at pH2 but appeared resistant
to pepsin at pH47. Therefore, we examined pepsin
enzymatic activity using a standard haemoglobin assay
correlating it with pepsin sensitivity tests of R4. By
Lancefield’s standard trypsin extract studies, we
determined that R4 was pepsin sensitive at pH2 and
appeared resistant at pH4, pH6, and pH8 likely due to
corresponding loss of pepsin activity at these higher pH
values. In concurrent tests, the pepsin used in the
sensitivity tests was determined to be inactive under
various conditions. By standard haemoglobin assay,
pepsin was shown to be active at pH2, yet inactive at
higher pH, inactive if irreversibly denatured at high pH
but restored to pH2, and decreased in activity with
repeated freeze-thaw usage. This supported our results
observed in double-diffusion pepsin sensitivity tests,
revealing that pepsin was inactive at pH4, and not that
R4 or Rib were pepsin resistant at this pH. These results
indicated that careful handling of pepsin is critical; fresh
pepsin, careful pH methods, and pH2 should be used
with each experiment to prevent irreversible denaturation
and promote optimal pepsin activity. Together these
results demonstrated that R4 was pepsin sensitive at
pH2, and that R4 and Rib appeared to be resistant due
to loss of pepsin activity at pH4. This proved to play an
important role in our later determination of R4 and Rib
similarities.
After determining the gene and amino acid sequence
of R4, confirming R4 sensitivity to pepsin at pH2 and
examining loss of pepsin activity with increasing pH, our
prediction that R4 and Rib protein are the same was
confirmed. The R4 protein amino acid and nucleotide
sequence was identified and aligned with identity to the
amino acid and nucleotide sequence of the Rib protein,
thereby confirming identity. It is of interest to note that
previous epidemiological studies of R4 as well as the
current PCR and Southern screening of clinical isolates
confirmed that R4 was found in serotypes II, III and V,
and that identity between the r4 gene of a type III isolate
in this study and the recently published genome of a type
V isolate further supported these data, whereas little
homology was detected in a type Ia genome.
R4-generated primers yielded PCR products while
the R4-generated digoxygenin-labeled probe detected
INDIAN J MED RES (SUPPL) MAY 2004
220
only R4-positive isolates in Southern blot, and not isolates
with alpha, beta, R1/R4 or R5 (BPS) proteins. PCR
product sequences were identical to nucleic acid
sequences encoding R4 and Rib. It is interesting to note
that some isolates serotyped as R1/R4 were not detected
by the r4 probe. Further sequence determination of the
R1 protein and its relationship to R4 are needed. One
cannot exclude that R1, when expressed with R4, is a
dual protein, but with epitopic distinction from R4.
Sequencing of R4 from strains expressing both R1 and
R4 might elucidate why these strains were PCR negative.
After many years of inference that R4 and Rib
proteins were identical, elucidation of the nucleotide
sequence verifies that these two genes and proteins are
the same. Much valuable reference information is known
for R4 and many valuable immunogenicity and protectivity
studies have been done for Rib. Taken together, much
more is now known for the R4/Rib protein.
Acknowledgment
This work was partially funded by Minnesota Medical
Foundation grant and by the NIH training grant in Pediatric Infectious
Diseases (HD07381). Authors thank Luther College Honors
Research students for PCR screening studies and for travel support
provided by Luther College.
References
1.
Lancefield R. Studies on the antigenic composition of group A
hemolytic streptococci. J Exp Med 1943; 78 : 465-76.
2.
Lancefield R, Dole V. The properties of T antigens extracted
from group A hemolytic streptococci. J Exp Med 1946; 84 :
449-71.
3.
Lancefield R, Perlmann G. Preparation and properties of a protein
(R Antigen) occurring in streptococci of group A, type 28 and
in certain streptococci of other serological species. J Exp Med
1952; 96 : 83-97.
7.
Flores AE, Ferrieri P. Molecular diversity among the trypsin
resistant surface proteins of group B streptococci. Zbl Bakt
1996; 285 : 44-51.
8.
Wilkinson H. Comparison of streptococcal R antigens. Appl
Microbiol 1972; 24 : 669-70.
9.
Stålhammer-Carlemalm M, Stenberg L, Lindahl G. Protein Rib:
a novel group B streptococcal cell surface protein that confers
protective immunity and is expressed by most strains causing
invasive infections. J Exp Med 1993; 177 : 1593-603.
10. Wastfelt M, Stålhammer-Carlemalm M, Dellisse A, Cabezon T,
Lindahl G. Identification of a family of streptococcal surface
proteins with extremely repetitive structure. J Biol Chem 1996;
271 : 18892-7.
11. Larsson C, Stålhammer-Carlemalm M, Lindahl G. Experimental
vaccination against group B Streptococcus, an encapsulated
bacterium, with highly purified preparations of cell surface
proteins Rib and a. Infect Immun 1996; 64 : 3518-23.
12. Fasola EL, Flores AE, Ferrieri P. Immune responses to the R4 protein
antigen of group B streptococci and its relationship to other
streptococcal R4 proteins. Clin Diagn Lab Immunol 1996; 3 : 321-5.
13. Hordnes K, Tynning T, Kvam AI, Bevanger L, Brown TA,
Jonsson R, et al. Cervical secretions in pregnant women colonized
rectally with group B streptococci have high levels of antibodies
to serotype III polysaccharide capsular antigen and protein R.
Scand J Immunol 1998; 47 : 179-88.
14. Linden V, Kvist K, Christensen P. Correlation between low
levels of maternal IgG antibodies to R protein and neonatal
septicemia with group B streptococci carrying R protein. Int
Arch Allergy Appl Immun 1983; 71 : 168-72.
15. Stålhammer-Carlemalm M, Areschoug T, Larsson C, Lindahl G.
The R28 protein of Streptococcus pyogenes is related to several
group B streptococcal surface proteins, confers protective
immunity and promotes binding to human epithelial cells. Mol
Microbiol 1999; 33 : 208-19.
16. Wilkinson H, Moody M. Serological relationships of type I
antigens of group B streptococci. J Bacteriol 1969; 97 : 629-34.
17. Anson ML. The estimation of pepsin, trypsin, papain, and
cathepsin with hemoglobin. J Gen Physiol 1938; 22 : 79-89.
18. Ryle A. The porcine pepsins and pepsinogens. Biochem J 1966;
98 : 485-7.
4.
Lancefield R. Differentiation of group A streptococci with a
common R antigen into three serological types, with special
reference to the bactericidal test. J Exp Med 1957; 106 : 525-44.
19. Richter S, Tanaka T, Yada R. Mechanism of activation of the
gastric aspartic proteinases: pepsinogen, progasticsin, and
prochymosin. Biochem J 1998; 335 : 481-90.
5.
Flores A, Ferrieri P. Molecular species of R-protein antigens
produced by clinical isolates of group B streptococci. J Clin
Microbiol 1989; 27 : 1050-4.
20. Suvorov AN, Flores AE, Ferrieri P. Cloning of the glutamine
synthetase gene from group B streptococci. Infect Immun
1997; 65 : 191-6.
6.
Bevanger L, Kvam A, Maeland J. A Streptococcus agalactiae R
protein analysed by polyclonal and monoclonal antibodies.
APMIS 1995; 103 : 731-6.
21. Cottrell T, Harris L, Tanaka T, Yada R. The sole lysine residue
is porcine pepsin works as a key residue for catalysis and
conformational flexibility. Glycobiology 1995; 270 : 19974-8.
Reprint requests: Dr B.L. Smith, Department of Pediatrics, University of Minnesota, 420, Delaware St SE No.196
Minneapolis MN 55455, USA
e-mail: [email protected]